ID: 1167512114

View in Genome Browser
Species Human (GRCh38)
Location 19:49900916-49900938
Sequence CTATACAGCAGCCAGACACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 127}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167512111_1167512114 12 Left 1167512111 19:49900881-49900903 CCACAATGATGGTTTCGATGAGG 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1167512114 19:49900916-49900938 CTATACAGCAGCCAGACACCTGG 0: 1
1: 0
2: 0
3: 7
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167512114 Original CRISPR CTATACAGCAGCCAGACACC TGG Intronic
909634083 1:77795982-77796004 TTATTCAGCAGTGAGACACCTGG + Intronic
913098057 1:115538340-115538362 CTAGACAGCAGGCAGAGAGCAGG - Intergenic
915323222 1:155067412-155067434 CCTTGCAGCAGACAGACACCTGG - Exonic
917792323 1:178506903-178506925 TTTTACTGCACCCAGACACCTGG - Intergenic
921719872 1:218459690-218459712 CTCTGCAGCAGAAAGACACCGGG + Intergenic
922174805 1:223189058-223189080 CCATACAGGAGCCACCCACCAGG - Intergenic
922339002 1:224640685-224640707 CAACACAGCAGCCAGAGAGCCGG - Intronic
923212603 1:231818269-231818291 CTTTACAGCATCCACACACATGG - Intronic
1069477783 10:68750622-68750644 CTATACAACTGCCACACACTGGG - Intronic
1069554406 10:69387971-69387993 CTAAAGAGCAGACAGATACCTGG + Intronic
1071812702 10:89200564-89200586 CTATAGAGCTTCCAGAAACCAGG + Intergenic
1076427952 10:130380812-130380834 CTACCCAGCGTCCAGACACCTGG - Intergenic
1076501699 10:130942240-130942262 CTACACAGCATCGAGACACATGG + Intergenic
1079469102 11:20761269-20761291 CAATACAGTAGCCAGTCACTTGG + Intronic
1079616301 11:22497663-22497685 CTATGCAGCAGCAAGTCACTGGG + Intergenic
1084601584 11:70149021-70149043 CGATTCAGCAGGCAGACCCCTGG + Intronic
1084670629 11:70604565-70604587 CTACACAGCAACCACTCACCAGG - Intronic
1089075856 11:115737869-115737891 CTATCCAGCATCCACACACAAGG - Intergenic
1091913530 12:4250915-4250937 CTACACAGCAGCCACAAGCCTGG - Intergenic
1092522093 12:9285748-9285770 CTGTCCAGCGGCCAGACAGCCGG + Intergenic
1092545189 12:9446108-9446130 CTGTCCAGCGGCCAGACAGCCGG - Intergenic
1094507758 12:31075941-31075963 CTGTCCAGCGGCCAGACAGCCGG + Intronic
1097466801 12:59936659-59936681 CTTTTCAGAAACCAGACACCAGG - Intergenic
1101632811 12:106512072-106512094 ATGAAAAGCAGCCAGACACCAGG + Intronic
1101860299 12:108477078-108477100 CTGAACAGAAGCCAGAGACCTGG + Intergenic
1102465459 12:113128215-113128237 CCACACAGGAGGCAGACACCTGG + Intronic
1106481002 13:30136720-30136742 CTACAGAGCAGCCACACACAGGG + Intergenic
1108694528 13:52891223-52891245 CCAGTCAGCAGCCAGAAACCAGG - Intergenic
1108892684 13:55280139-55280161 CTATACAGAAGCCTTACACATGG - Intergenic
1114253048 14:20977973-20977995 CTTCACAGCAGCCAGACTCAGGG + Intergenic
1116418026 14:44701646-44701668 CTAGGCAGCCCCCAGACACCTGG - Intergenic
1118743695 14:68759012-68759034 CTCTGCAGAAGCCAGTCACCAGG - Intergenic
1120375614 14:83703005-83703027 CAATACAGCAGCAAGAAACTTGG - Intergenic
1121822070 14:96978742-96978764 CCATTCAACAGCCAGACAGCTGG + Intergenic
1125692246 15:41605629-41605651 CTGTACACCAGCCGCACACCTGG - Intergenic
1126625404 15:50681724-50681746 CTATCCAGCTGCCAGACTTCTGG - Intronic
1126823243 15:52525833-52525855 CTCAACAGCAGGCAGACAGCTGG - Intronic
1128254310 15:66185734-66185756 CCACCCAGCAGCCAGGCACCAGG + Intronic
1128460941 15:67866484-67866506 CTCTACAGCACGCAGTCACCTGG + Intergenic
1132747050 16:1441162-1441184 CTAGAGAGCACTCAGACACCCGG + Intronic
1133891714 16:9885485-9885507 TTATACAGACGCCAAACACCAGG - Intronic
1135482988 16:22838518-22838540 CTATTCAGCTACCATACACCTGG - Intronic
1138291955 16:55855477-55855499 CTACACACCAGCCAGGCATCAGG - Intronic
1138434550 16:56989751-56989773 CTATCCATCGGCCAGCCACCCGG - Intronic
1138814974 16:60193652-60193674 CAATACAACACCCTGACACCAGG + Intergenic
1139922443 16:70468695-70468717 CACTCCAGCAGCCAGACTCCAGG - Intronic
1140792213 16:78402834-78402856 CTGTAAAGCAACCAGACCCCAGG - Intronic
1143504081 17:7354349-7354371 CTATACATCAGTCAGCCACACGG - Exonic
1144643880 17:16955259-16955281 CCAAACAGAAGGCAGACACCTGG + Intronic
1145204912 17:20979126-20979148 CCAAACAGAAGGCAGACACCTGG - Intergenic
1145269946 17:21399527-21399549 CCAAACAGGGGCCAGACACCAGG + Intronic
1146082528 17:29793923-29793945 CTATACAGGAGGCAGACAGTGGG - Exonic
1148328279 17:46796742-46796764 CTATGCAGCAGCCAGGAACCAGG - Intronic
1156806607 18:41190613-41190635 CTATTCAGCACCCACCCACCTGG + Intergenic
1159312893 18:66733507-66733529 CAATACAGCAGCCAGGAAACAGG + Intergenic
1160007313 18:75076857-75076879 CTAGCCAGCAGCCAGGCTCCAGG + Intergenic
1160493192 18:79354916-79354938 CTCTACTCCAGCCAGACGCCAGG + Intronic
1163685168 19:18708434-18708456 TGATACAGAAGCCAGAAACCCGG - Intronic
1165477139 19:36037492-36037514 CTCTTCTGCAGCCAGACACCTGG + Intronic
1166543117 19:43618814-43618836 TTATACGGCAACCACACACCTGG + Intronic
1167512114 19:49900916-49900938 CTATACAGCAGCCAGACACCTGG + Intronic
926702525 2:15813313-15813335 ATACACAGCAGCCCCACACCCGG - Intergenic
927206699 2:20615689-20615711 CTCCACATCAGCCTGACACCGGG + Intronic
928315895 2:30245539-30245561 CTCTACAGTAGCCTGACATCGGG + Intronic
931699674 2:64899438-64899460 CAATGCAGCAGCCGAACACCGGG - Intergenic
932688544 2:73893467-73893489 CTAAACAGCTCACAGACACCAGG - Intronic
935561050 2:104560609-104560631 GCATCCAGCAGCCAGAGACCAGG + Intergenic
937920124 2:127122836-127122858 CTCAACAGCAACCAGACAGCGGG + Intergenic
938313557 2:130311075-130311097 CTAAACAGAAGCCAAAAACCAGG - Intergenic
939877909 2:147598807-147598829 TTATAGAGGAGCCAGACCCCTGG - Intergenic
940817120 2:158309773-158309795 AAATACAGCAACCAGAAACCAGG + Intronic
942546422 2:177069071-177069093 TTATGCAGAAGCCACACACCAGG + Intergenic
947000602 2:225451207-225451229 GTCTACAGCTGCCAGGCACCAGG + Intronic
948177400 2:235954891-235954913 CTAGACAACATCCAGACACATGG - Intronic
1173040512 20:39458066-39458088 CTATACAGTATCCAGAAAACTGG + Intergenic
1173874785 20:46363736-46363758 CTATAAAGCAGCCAGAGAGATGG + Intronic
1174441628 20:50560180-50560202 CCATACACAAGCCAAACACCAGG - Intronic
1175268280 20:57715516-57715538 GTATCCAGAAGCCAGTCACCTGG + Intergenic
1175480158 20:59305005-59305027 CTGAAGAGCAGCCAGGCACCTGG - Intronic
1175714692 20:61247540-61247562 CTATAAACCAGCCAGAGACAAGG + Intergenic
1179388889 21:40969590-40969612 CCGTACAGCAGCCAGAAACCTGG - Intergenic
1181824518 22:25504234-25504256 CTGTACTGCAGCCTGACCCCAGG + Intergenic
1184482176 22:44754107-44754129 CTACACAGAAGCCAGACTCTGGG - Intronic
1184884368 22:47333292-47333314 CTATCCAGCAGCCAGACCGTGGG - Intergenic
951330086 3:21356445-21356467 CTAGACAACAGCCAGAACCCAGG + Intergenic
951918439 3:27826702-27826724 CTAGGCAGCAGACAGGCACCTGG + Intergenic
953678321 3:45020617-45020639 CTATACAGCTGAGAGACACATGG - Intronic
954076458 3:48185377-48185399 CTGTACACCAGCCTGAGACCTGG + Intronic
954406493 3:50348184-50348206 CTATACTGCAGCCTGAGCCCTGG - Exonic
961422779 3:126819370-126819392 TCATACAGCATCCAGAAACCTGG - Intronic
962151415 3:132897495-132897517 CTATACAGGTGCCCGCCACCAGG + Intergenic
964718738 3:159750684-159750706 GTATACAGCAGCCAGGAACAGGG + Intronic
973169216 4:47118384-47118406 TTAGACAGCTGCAAGACACCTGG - Intronic
981104662 4:140866759-140866781 CTACACAGCTGGCAAACACCAGG - Exonic
982381859 4:154757477-154757499 CTACCCAGCAGTGAGACACCTGG - Intergenic
986669201 5:10127846-10127868 CTAAACAGTAGGCAGCCACCTGG + Intergenic
990965195 5:61438971-61438993 CAATATAGCTGCCAGACTCCTGG - Intronic
992610982 5:78508405-78508427 GAATACACCATCCAGACACCAGG - Intronic
993859563 5:93118734-93118756 CTATAAAGCAGTCCAACACCTGG - Intergenic
993902532 5:93594613-93594635 CTATCAAGCAACCAGACACATGG - Exonic
997260595 5:132463082-132463104 CTGTACAGCAGCAAGTCAGCAGG + Exonic
999696559 5:154192181-154192203 CTAGACAGCAGCCTGATACTGGG - Intronic
1007138413 6:39545975-39545997 CAATGCAGCAGCCAGGCACAGGG - Intronic
1007633883 6:43286728-43286750 CTATGCAGGAGCCAGAACCCAGG - Exonic
1013816897 6:114109546-114109568 CTGTGCTGCAGCCAGACAGCTGG - Intronic
1015334347 6:132020264-132020286 ATAAACAGCAGCCACACACCAGG - Intergenic
1017806756 6:157953017-157953039 CCAGTCAGCAGCCAGAAACCTGG + Intergenic
1025873089 7:65453264-65453286 CAAAAATGCAGCCAGACACCTGG - Intergenic
1026434647 7:70384920-70384942 CTACACAGAAGCCAGACATGTGG + Intronic
1032297492 7:130653650-130653672 ATGGGCAGCAGCCAGACACCAGG + Intronic
1034260689 7:149753457-149753479 CTCTACAGGAGCCAGACCCAGGG - Intergenic
1034496293 7:151424905-151424927 TGTTACAGCAGCCAGACACCCGG + Intergenic
1038435933 8:27536017-27536039 CCATACACAAGCCAGAGACCTGG + Intronic
1040299906 8:46182545-46182567 ATATGCAGCAGCGAGACAGCAGG - Intergenic
1040483592 8:47849760-47849782 ATCTACACGAGCCAGACACCTGG - Intronic
1043525083 8:81087784-81087806 CTACACTGCAGTCAGTCACCTGG + Intronic
1044953349 8:97454805-97454827 CTAGACAGCACTTAGACACCTGG + Intergenic
1046973729 8:120250490-120250512 TTATACAGCAAGCAGACAGCAGG - Intronic
1049494151 8:142921934-142921956 CCCTCCAGCAGCCACACACCAGG + Intergenic
1049670947 8:143869622-143869644 GCATCCAGCAGCCAGACAGCGGG + Exonic
1053539673 9:38960329-38960351 CAATTCTGAAGCCAGACACCTGG + Intergenic
1054626468 9:67403589-67403611 CAATTCTGAAGCCAGACACCTGG - Intergenic
1055275027 9:74605511-74605533 CTAAGGAGCAGACAGACACCGGG - Intronic
1056751253 9:89353051-89353073 TTGAACAGCAGCCACACACCCGG - Intronic
1057321645 9:94018637-94018659 CTGTTCAGAAGGCAGACACCAGG - Intergenic
1058776318 9:108287369-108287391 CTAAACAGAAACCAGAAACCAGG - Intergenic
1059380530 9:113919991-113920013 CTACACAGGGGCCTGACACCTGG + Intronic
1059954588 9:119502316-119502338 TTATCCAACAGCCAGAAACCAGG - Intronic
1061814949 9:133188962-133188984 CTAGCCAGCAGCCAGACCCTGGG + Intergenic
1189712671 X:43829877-43829899 CAATACAGTAGCCACTCACCAGG + Intronic
1192178892 X:68903090-68903112 CCCCACAGCAGCCAGACCCCAGG - Intergenic
1195130196 X:101843597-101843619 CTAGACACCAGCTACACACCTGG + Intronic
1195176077 X:102316669-102316691 CTAGACACCAGCCACACACCTGG - Intronic
1195182787 X:102370424-102370446 CTAGACACCAGCCACACACCTGG + Intronic
1198065322 X:133090726-133090748 CTATATAGCAGCCAACCACAAGG - Exonic