ID: 1167512115

View in Genome Browser
Species Human (GRCh38)
Location 19:49900922-49900944
Sequence AGCAGCCAGACACCTGGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 417
Summary {0: 1, 1: 0, 2: 4, 3: 46, 4: 366}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167512111_1167512115 18 Left 1167512111 19:49900881-49900903 CCACAATGATGGTTTCGATGAGG 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1167512115 19:49900922-49900944 AGCAGCCAGACACCTGGCCCTGG 0: 1
1: 0
2: 4
3: 46
4: 366

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167512115 Original CRISPR AGCAGCCAGACACCTGGCCC TGG Intronic
900090664 1:919033-919055 CACAGCCAGACTCCTAGCCCTGG - Intergenic
900095827 1:939794-939816 ACCTGCCAGACGCCTGCCCCAGG + Intronic
900344402 1:2204239-2204261 AACAGCCGGGCACCTGGGCCTGG - Intronic
900367685 1:2317941-2317963 AGCAGCCTCACACCCGGCACTGG - Intergenic
900420910 1:2555560-2555582 ATCTGCCAGACGCCTGGCCCAGG - Intergenic
901075746 1:6553991-6554013 GGCAGCCAGAGAACAGGCCCGGG + Intronic
903224748 1:21888154-21888176 AGCTGCCTGACACAGGGCCCTGG - Intronic
903413762 1:23168065-23168087 CGCAGCCAGACCGCTGGGCCGGG - Intronic
903768541 1:25749871-25749893 ACCAGCCAGACACCTGCTCCAGG + Intronic
904048934 1:27626487-27626509 ATCAGCCAGGCAACTGGACCTGG - Intronic
904265985 1:29318850-29318872 AGCAGTGACACACCTGGCCCTGG - Intronic
904349432 1:29895400-29895422 AGCACCCAGGCTCCTGGCCGGGG + Intergenic
904873027 1:33633698-33633720 AGTGGCCAGACACCCGGCACAGG + Intronic
906448417 1:45922867-45922889 AGCAGCCCAGCACCTGGCCCAGG - Intronic
907782497 1:57580095-57580117 AGTTGTCTGACACCTGGCCCTGG + Intronic
907831692 1:58070460-58070482 ATGAGCCAGACACCTGGGGCAGG + Intronic
909605067 1:77499711-77499733 AGCAGTGAGAAACCTGGCCGAGG + Intronic
911664462 1:100538333-100538355 AGCATCCACACACATGGTCCTGG - Exonic
913090860 1:115475683-115475705 AGCAGGGAGCCACCTGGTCCAGG + Intergenic
914407293 1:147389151-147389173 AGCAGCCAGGCATGTGGCCTTGG - Intergenic
915042874 1:152983312-152983334 TCCACCCAGACATCTGGCCCTGG - Intergenic
915504262 1:156343130-156343152 AACAGCCAGAGAGCTGGCACCGG - Intronic
916124039 1:161553415-161553437 GGCAGTGAGACACATGGCCCTGG + Intergenic
916133922 1:161634777-161634799 GGCAGTGAGACACATGGCCCTGG + Intronic
916338889 1:163706125-163706147 AGGATCCAGTCACCTGACCCCGG - Intergenic
916414647 1:164581084-164581106 TGCAGCCAGACTCTAGGCCCTGG + Intronic
916958006 1:169860388-169860410 ACCAGCCAGACACAAGGCCAGGG + Intronic
920111826 1:203592403-203592425 AGACGCCAGGCACCTGGGCCCGG - Intergenic
921049507 1:211501023-211501045 AGCAACCAGACTCTTGTCCCTGG - Intergenic
921774213 1:219078574-219078596 AGCTGGGAGACAACTGGCCCTGG - Intergenic
922199525 1:223390120-223390142 AGCAGGAAGACACCAGGCCGAGG - Intergenic
922241209 1:223756474-223756496 AGCAGCCTGAAAAATGGCCCTGG + Intronic
922701417 1:227763380-227763402 TGCAGACAGACACACGGCCCGGG - Intronic
922805683 1:228387611-228387633 AGCTGCCAGGTGCCTGGCCCTGG - Intergenic
923239104 1:232063106-232063128 AGTTGCCTGGCACCTGGCCCTGG + Intergenic
923279758 1:232432229-232432251 AACAGCCAGCCACCTTACCCGGG + Exonic
923295561 1:232591482-232591504 GGCAGCCACATTCCTGGCCCTGG - Intergenic
924032419 1:239899888-239899910 AGGAGCCAGGCACCTGCCCCTGG + Intronic
1062760268 10:12100-12122 AGGAGCCAGTCCCCTAGCCCAGG - Intergenic
1064486614 10:15799063-15799085 AGCAGCAAAACACATGGCCATGG + Intronic
1065599062 10:27350139-27350161 AGCAGCCGGGCATCTGGCCTGGG + Intergenic
1066953664 10:42145644-42145666 AGCAGCCAGGCAGCTGGAACTGG - Intergenic
1068945349 10:62723924-62723946 AGCAGCCACACATCCCGCCCAGG + Intergenic
1069710006 10:70482103-70482125 AGCAGCCAGGTGCATGGCCCTGG + Intronic
1069992778 10:72325303-72325325 AGCAGCCAGGCAGCTGGCTGGGG + Intergenic
1070744841 10:78927487-78927509 AGCAGCCAGACCAGTTGCCCGGG - Intergenic
1071155090 10:82678576-82678598 AGAGGCCTGACACCTGGCACTGG + Intronic
1071344838 10:84683242-84683264 AGTTGCCTGATACCTGGCCCTGG - Intergenic
1071504696 10:86225614-86225636 ATCTGCCAGACACCCTGCCCTGG + Intronic
1071695473 10:87864240-87864262 AGCAGCCAGAGGCCTGGCAGCGG - Exonic
1072455223 10:95569275-95569297 AGCAGCCAGACAGGTGGCCCTGG + Intergenic
1072901422 10:99410828-99410850 AGGAGCCAGGCAACTGGACCTGG + Intronic
1073063884 10:100747213-100747235 CGCAGCCAGCAACCTGGCCAGGG + Intronic
1073245546 10:102087801-102087823 AGCAGCCAGACAGCTGAGGCTGG - Intergenic
1074153729 10:110781129-110781151 CCCAGCCAGACACGAGGCCCCGG + Exonic
1074507762 10:114086610-114086632 AGCTGCCAGACCTCTGACCCAGG - Intergenic
1075078586 10:119368089-119368111 GGAAGCCAGACCCCGGGCCCTGG + Intronic
1075262248 10:120973357-120973379 AGTGCACAGACACCTGGCCCAGG - Intergenic
1075401142 10:122162681-122162703 AGCAGCCAAATCCCTGTCCCTGG - Intronic
1076073677 10:127514465-127514487 GGGAGCCAGAAACGTGGCCCTGG - Intergenic
1076103720 10:127803592-127803614 ACCCGCCAGAGCCCTGGCCCAGG + Intergenic
1076372691 10:129965146-129965168 CGCAGCCAGACACCCGGCTCCGG - Intergenic
1076567448 10:131408477-131408499 AGCAGACATTCACATGGCCCTGG + Intergenic
1076688634 10:132209468-132209490 AGCACACACACACCTGTCCCAGG + Intronic
1076724278 10:132406216-132406238 TGCCGCAAGACACGTGGCCCCGG + Exonic
1076769786 10:132656662-132656684 TGCAGCCAGCCAGCTGGGCCAGG + Intronic
1076797589 10:132805731-132805753 AGCAGCTGGAAACCTGGCCTGGG - Intergenic
1078441329 11:11371295-11371317 ACCAGGCAGGCAACTGGCCCTGG - Intronic
1078527978 11:12114978-12115000 ATGACCCAGAAACCTGGCCCTGG + Intronic
1079618849 11:22528717-22528739 AGCAGCCAGGAACCTGGAGCTGG - Intergenic
1080356066 11:31447273-31447295 AGCAGCCAGACCACTGGACTTGG - Intronic
1081701585 11:45155813-45155835 GGCAGCCAGACACTCTGCCCTGG - Intronic
1081779309 11:45699011-45699033 AGAAGCCAGACCCAAGGCCCTGG - Intergenic
1083157167 11:60830902-60830924 ACAACCCAGACACCTCGCCCTGG + Intergenic
1083724902 11:64622986-64623008 AGAGGCCGGACACCTGGCCCTGG + Exonic
1083811851 11:65110836-65110858 AGCAGCCCCACACCTGCCCAAGG + Intronic
1084603785 11:70161316-70161338 TGCAGCCATACACCTCGTCCAGG - Exonic
1085018513 11:73190722-73190744 ACCAGCCGGTCACCTGGGCCAGG - Intergenic
1085776313 11:79369948-79369970 AGCAGCTGGAGCCCTGGCCCTGG + Intronic
1088580688 11:111312701-111312723 AGCACAGAGCCACCTGGCCCTGG - Intergenic
1089675805 11:120088309-120088331 TGCAGCCTGTCTCCTGGCCCAGG + Intergenic
1089690477 11:120183960-120183982 GAAAGCCTGACACCTGGCCCTGG - Intronic
1090171670 11:124611292-124611314 AGCAGCGTGGCACCAGGCCCAGG + Intergenic
1090248763 11:125236568-125236590 GGCAGCCGGGCACCTGGCTCTGG + Intronic
1091184976 11:133638764-133638786 TGCAGCCAGACACCTGAGCAAGG - Intergenic
1091918260 12:4284485-4284507 AGCAGCCACACGCCTTGCCATGG - Intronic
1094136565 12:27133225-27133247 AGCAGACACACACCTGGGGCAGG - Intergenic
1094564795 12:31590313-31590335 ACCCGCCAGCCACCCGGCCCCGG - Intronic
1094603632 12:31932268-31932290 ACCACCCAATCACCTGGCCCAGG + Intergenic
1094692230 12:32781128-32781150 AGCACCCAGACCCCTTGTCCAGG + Intergenic
1094807823 12:34108534-34108556 AGGAGCCAGTCCCCTAGCCCAGG - Intergenic
1096386245 12:51197096-51197118 AGCAGGTAGACCCCTAGCCCTGG - Intronic
1096547866 12:52353547-52353569 GGGAATCAGACACCTGGCCCAGG - Intergenic
1097877561 12:64657607-64657629 AGCAGGCAGAGACCTGCCCTGGG - Intronic
1098234008 12:68401339-68401361 AGAAGCCATTAACCTGGCCCAGG + Intergenic
1098628045 12:72697416-72697438 AGGAGCTAAACACCTGGGCCTGG + Intergenic
1099806909 12:87531434-87531456 AGCAGCCAGGAAGCTGGACCTGG + Intergenic
1100338981 12:93660046-93660068 AGCTGCCTGGCACCTGGCCCTGG - Intergenic
1101059915 12:100960015-100960037 TGCATCCAGACACCTGCCTCTGG + Intronic
1103323114 12:120102985-120103007 AGCTGCCAGACACCACACCCCGG + Intronic
1103443977 12:120981956-120981978 AGCAGCCTGAGACGTGGCCAAGG + Intronic
1104785316 12:131444828-131444850 AGCAGCCACAGCCATGGCCCTGG - Intergenic
1105564336 13:21529379-21529401 AGCTGCCAGACACCTGGTTTTGG - Intronic
1105891534 13:24685747-24685769 AGCAGCCCGAGAGCTGGCTCTGG - Intronic
1107559003 13:41543964-41543986 AGCTGCCTGGCACCTGGCCCTGG - Intergenic
1109892549 13:68634723-68634745 AGTTGCCAGGCACCTGGTCCTGG - Intergenic
1110412027 13:75214977-75214999 AGAAGGTAGACACCTGGCCCAGG - Intergenic
1110611202 13:77490114-77490136 AGCAGCCAGTGACCAGACCCTGG - Intergenic
1111684533 13:91486026-91486048 AGCTGCCTGCCACCTGGCTCAGG + Intronic
1112286715 13:98111340-98111362 GGCAGGCTGACAGCTGGCCCTGG + Intergenic
1112356673 13:98679287-98679309 AGCAGCCAGATATATGGCCTTGG + Intergenic
1112967057 13:105210327-105210349 ATCAGCCAGACAGCCGGGCCCGG + Intergenic
1113655672 13:112066887-112066909 AGCAGCCATACGCCGGGCCCGGG - Intergenic
1113884584 13:113651946-113651968 ATCAGCAAGCCACTTGGCCCAGG + Intronic
1114031604 14:18584504-18584526 AGGAGCCAGTCCCCTAGCCCAGG - Intergenic
1117518297 14:56524529-56524551 ATCTGCCAGACACCTACCCCAGG - Intronic
1118743693 14:68759006-68759028 AGAAGCCAGTCACCAGGCCTGGG - Intergenic
1118809111 14:69260769-69260791 AGCCCCCAGACTCCCGGCCCCGG - Intronic
1119175370 14:72564601-72564623 GGCAGCCAGGCCCCTTGCCCTGG - Intronic
1119382710 14:74239363-74239385 AGCAGCCAATCACCGGGGCCAGG - Intergenic
1121407619 14:93728531-93728553 AAGACCCAGACACCTTGCCCCGG - Intronic
1122106757 14:99463551-99463573 AGCAGTCCGGCGCCTGGCCCAGG - Exonic
1123105808 14:105840595-105840617 AGAAGCCAGACACCTCACACAGG + Intergenic
1123197511 14:106630682-106630704 AGCAGCTTGACACCTGATCCAGG - Intergenic
1124007336 15:25805107-25805129 AGCATCCACACACGGGGCCCCGG + Intronic
1124168482 15:27350745-27350767 ACCTGGCAGACACCTGGCACTGG + Intronic
1124374298 15:29120826-29120848 AGCAGCAAGAGCCCAGGCCCCGG - Exonic
1124532626 15:30520631-30520653 AGAAGGCAGCCACCTGGCCAGGG + Intergenic
1124766027 15:32487013-32487035 AGAAGGCAGCCACCTGGCCAGGG - Intergenic
1125516050 15:40322074-40322096 GGCAGCCCCACACCTGGGCCTGG + Intergenic
1125757164 15:42071718-42071740 TCCATTCAGACACCTGGCCCAGG + Intronic
1126041582 15:44596146-44596168 AGGAGCCAGACTCCTGGCACTGG - Exonic
1127960080 15:63884426-63884448 AGCAGACTCAGACCTGGCCCTGG + Intergenic
1128061650 15:64739250-64739272 GGCATCCTGACACCTGGCCCAGG + Intergenic
1128322074 15:66701324-66701346 AGCAGCCTGACGCCCGGCGCGGG - Intergenic
1129032292 15:72628313-72628335 AGCAGCCCCGCACCTGCCCCAGG + Intergenic
1129217604 15:74108926-74108948 AGCAGCCCCGCACCTGCCCCAGG - Intronic
1129472966 15:75765435-75765457 AGCAGCCAGACAGCTGGACAGGG - Intergenic
1129678226 15:77643718-77643740 AGCACCCACAGCCCTGGCCCAGG + Intronic
1129711529 15:77822695-77822717 AGCAGCCAGCCACCAGCCCCTGG - Intergenic
1129734765 15:77953227-77953249 AGCAGCCCTGCACCTGCCCCCGG - Intergenic
1129840825 15:78742764-78742786 AGCAGCCCTGCACCTGCCCCCGG + Intergenic
1130430811 15:83845071-83845093 AGCAGGGAGACACATGGTCCAGG - Intronic
1132143685 15:99414482-99414504 AGCAGCCAGGACCATGGCCCGGG + Intergenic
1132168242 15:99619196-99619218 AGCAGCCAGACTCCTTACCTTGG + Intronic
1132320688 15:100922921-100922943 AGAACTCAGGCACCTGGCCCAGG - Intronic
1132386962 15:101407570-101407592 AGCTGCCTGACACCTGGCCTTGG - Intronic
1132551529 16:555724-555746 AGCAGCCCCTCACGTGGCCCCGG - Intergenic
1132709371 16:1259624-1259646 AGCAGCCGGCAACCTGGCCTGGG + Intergenic
1132798875 16:1741692-1741714 GGCAGCCAGCCACCAGGCCCAGG - Intronic
1132864595 16:2087184-2087206 AGCAGCCTGACAGCTGCCACTGG - Intronic
1133325195 16:4937655-4937677 AGCAGTAAAACACCTTGCCCAGG - Intronic
1133597680 16:7309102-7309124 ATCAGGCAGCCACCTGGGCCTGG - Intronic
1135974624 16:27099925-27099947 ATGAGCCACACACCTGGCCAGGG + Intergenic
1136271161 16:29149070-29149092 AGCCCCCAGGCACCTGGGCCGGG + Intergenic
1136580658 16:31149165-31149187 CGCAGCCGGGCACCTGGCCTTGG - Exonic
1136627023 16:31467523-31467545 AGCAGTAGGACACGTGGCCCAGG - Intergenic
1136771139 16:32842331-32842353 AGCAGCCAGGCAGCTGGAACTGG - Intergenic
1136899439 16:34019151-34019173 AGCAGCCAGGCAGCTGGAACTGG + Intergenic
1137002801 16:35246009-35246031 CTCAGCCACACTCCTGGCCCTGG - Intergenic
1137083736 16:36097558-36097580 AGCAGCCAGACAGCTGGAACTGG - Intergenic
1138820732 16:60255967-60255989 AGCAGCCAGAAACCTGTAGCTGG - Intergenic
1138999712 16:62494726-62494748 AGTTGCCTGGCACCTGGCCCTGG + Intergenic
1140201997 16:72902504-72902526 AGCAGCAAGGCACCCGTCCCTGG + Intronic
1141939971 16:87269089-87269111 AGCTGTCAGGTACCTGGCCCTGG - Intronic
1141976351 16:87518838-87518860 AGCAGCCAGAAGCCAGGCTCAGG + Intergenic
1142003909 16:87680038-87680060 GGCAGCCACACACCCAGCCCAGG + Intronic
1142184928 16:88690316-88690338 GGCTGCCAGCCACCTGGCACTGG - Intergenic
1142187927 16:88703315-88703337 AGCTGCCAGAGACCAGGCCGGGG + Intronic
1142291741 16:89196328-89196350 GGCAGCCAGCCTCCTGGCCCAGG + Intronic
1142291773 16:89196409-89196431 GGCAGCCAGCCTCCTGGCCCAGG + Intronic
1142309606 16:89304915-89304937 AGCAGCCCCATACCTCGCCCAGG + Intronic
1142432592 16:90038013-90038035 AGAACCCAGAAACCTGGCCAAGG - Intronic
1203073562 16_KI270728v1_random:1104444-1104466 AGCAGCCAGGCAGCTGGAACTGG - Intergenic
1142645666 17:1312524-1312546 GGCTCCCAGCCACCTGGCCCTGG - Intergenic
1143145416 17:4772121-4772143 GGCACCCAGCCAGCTGGCCCGGG - Intronic
1143846670 17:9777342-9777364 AGCAGGCAGACCCCTGCCCCCGG + Intronic
1144150299 17:12436557-12436579 AGCTGCCAGTCTTCTGGCCCTGG + Intergenic
1144737167 17:17561658-17561680 AGAAGCCAGGAACCTTGCCCAGG + Intronic
1144955556 17:19017234-19017256 GCCAGCCTGACACCTGGCACGGG - Intronic
1145690696 17:26736194-26736216 AGCAGCCAGGCAGCTGGAACTGG + Intergenic
1146061969 17:29612494-29612516 AGCAGCGAGACGCCTTCCCCAGG + Exonic
1146457860 17:33021115-33021137 AGCAGACAGACACATAGCCTCGG - Intronic
1146641938 17:34548238-34548260 AGCAGGCAGGCTCCTGGCCTGGG - Intergenic
1147359887 17:39923916-39923938 ATCACCCTGACACCTGGGCCAGG + Intronic
1148126237 17:45238655-45238677 AGCAGCCTGAGGCCTGGGCCAGG + Intronic
1148202042 17:45755873-45755895 AGAAGCCAGAGACCTGCCCAGGG - Intergenic
1148778671 17:50109846-50109868 AGCTGCCAGACACGGGGGCCTGG - Intronic
1152237648 17:79146890-79146912 AGCTGCCAGACACCCTGCCCAGG - Intronic
1152344230 17:79741820-79741842 CGCAGCGAGACAGCCGGCCCAGG - Exonic
1152465099 17:80461916-80461938 AGCTGCTGGACGCCTGGCCCAGG + Intergenic
1152641257 17:81450235-81450257 AGGAGCCAGACACCTTGCGGTGG - Intronic
1152953176 18:12454-12476 AGGAGCCAGTCCCCTAGCCCAGG - Intergenic
1153676794 18:7462877-7462899 AGCAGCCAGACAGACAGCCCAGG - Intergenic
1153939706 18:9967590-9967612 AGTTGCCAGAGACCTGGCCCAGG - Intergenic
1156616493 18:38791816-38791838 AGCAGACAGACACATGGCCCAGG + Intergenic
1157138809 18:45084947-45084969 GTAAGCCAGACACCTAGCCCAGG + Intergenic
1158314800 18:56199977-56199999 AGCAGCCAGACATTTGCCTCAGG + Intergenic
1158509800 18:58080259-58080281 AGATGCCAGACACCTGGCTCCGG + Intronic
1159882038 18:73867212-73867234 AGCAGCCAGACACCAAGGCGAGG - Intergenic
1160225060 18:77006005-77006027 AGAAGACAGACACCTGCCCCAGG + Intronic
1160682654 19:418910-418932 GGCAGCCACACACCTGGCTCAGG + Exonic
1160708023 19:538922-538944 AGGAGCCAGCCACCTGGGCCAGG - Intronic
1161034459 19:2076720-2076742 AGCAGTCAGGGTCCTGGCCCCGG + Intronic
1161160197 19:2757485-2757507 AGCAGGCAGCCTCCTGGCCCTGG - Intronic
1161384399 19:3983322-3983344 AGGAGCCACACACCTGGCCCAGG + Intronic
1162004429 19:7768162-7768184 AGCGGCCTGACACCTGGCCTTGG + Intronic
1162561261 19:11419245-11419267 AGCAGGCAAAGAGCTGGCCCTGG - Exonic
1163115186 19:15184927-15184949 AGCAGACAGGCAGCTGGCCAGGG + Exonic
1164435494 19:28225001-28225023 AGGAGTCAGACACCTCCCCCAGG - Intergenic
1165454277 19:35901713-35901735 AGGAGCCTGACACCATGCCCGGG + Intronic
1167301420 19:48680170-48680192 GGCCCCCAGACACCTGCCCCGGG + Intergenic
1167512115 19:49900922-49900944 AGCAGCCAGACACCTGGCCCTGG + Intronic
1168639249 19:58019891-58019913 AGCTGACACAGACCTGGCCCAGG + Intergenic
1202670350 1_KI270709v1_random:44301-44323 AGCAGCCAGGCAGCTGGAACTGG + Intergenic
925599214 2:5590853-5590875 ATCAGCCAGACAGCTGCCACAGG + Intergenic
925792965 2:7511532-7511554 AGCAGGCAGACCCCTGCTCCAGG - Intergenic
925981936 2:9184225-9184247 GGAAGCCAGACTCCAGGCCCCGG - Intergenic
927553160 2:24016302-24016324 AGGATCCAGGCACCTGGTCCTGG + Intronic
928100095 2:28431880-28431902 AGTGGCCACAGACCTGGCCCAGG - Intergenic
928307840 2:30185602-30185624 AGTGGCCAGAACCCTGGCCCGGG - Intergenic
928420209 2:31132433-31132455 ACCACCCAGACACCTGCTCCTGG + Intronic
929536918 2:42789666-42789688 AGGAGCCTGAGACCTGGCTCAGG - Intronic
930601690 2:53451223-53451245 AGCCTCCACACACCTGGGCCAGG + Intergenic
930978747 2:57496444-57496466 AGCACCCAAACATCTGTCCCAGG + Intergenic
931451488 2:62370759-62370781 AGCAGCCAAAAGCCTAGCCCTGG - Intergenic
931811155 2:65856375-65856397 GGCAGCCAGGCACATAGCCCTGG - Intergenic
932275423 2:70448380-70448402 AGCTGCCACACACCTGGCAGTGG - Exonic
932810659 2:74823021-74823043 AGCTGCCAGAAACAGGGCCCTGG + Intergenic
932949133 2:76272170-76272192 AGTTGCCTGAAACCTGGCCCTGG - Intergenic
934037821 2:88103393-88103415 TGCAGCCAGACACTTGTCCCTGG + Intronic
934251079 2:90355984-90356006 AGCAGCCAGGCAGCTGGAACTGG - Intergenic
934258483 2:91447426-91447448 AGCAGCCAGGCAGCTGGAACTGG + Intergenic
934553224 2:95274719-95274741 AGGGGCCAGCCACCGGGCCCTGG - Exonic
936011661 2:108929067-108929089 TGCAGCCGCACACCTGGCCTTGG - Intronic
937855941 2:126672055-126672077 ATCCCCCAGCCACCTGGCCCTGG - Intronic
937920125 2:127122842-127122864 AGCAACCAGACAGCGGGCCTTGG + Intergenic
938473770 2:131589649-131589671 AGCAGGCAGACACCTGGGTGGGG - Intergenic
940824470 2:158395248-158395270 AGCAGCCAGAAACCTGCCCGTGG + Intronic
943853811 2:192762870-192762892 AGTTGCCTGATACCTGGCCCTGG + Intergenic
946422839 2:219574716-219574738 AGCTGCCAGAGGGCTGGCCCAGG + Exonic
946596182 2:221308187-221308209 AGCAACCAGCCAGTTGGCCCTGG + Intergenic
947123989 2:226847966-226847988 GCCAGCCAGATGCCTGGCCCTGG + Intronic
947300266 2:228681699-228681721 AGCAGCCACAAACACGGCCCTGG + Intergenic
947807551 2:232978924-232978946 AGAAGCCAGACACCCAGCCTGGG - Intronic
948481830 2:238255047-238255069 AGGAGCCAGACTTCTGGGCCAGG + Intronic
948825860 2:240573240-240573262 AGCCGGCAGACATCGGGCCCAGG + Exonic
1168840698 20:908241-908263 AGGAGCCAGACAGATGTCCCTGG - Intronic
1168964998 20:1893916-1893938 ACCACCGAGACACCTGGCCAGGG + Intergenic
1170785612 20:19464598-19464620 AGGCCCCAGACACCAGGCCCAGG - Intronic
1171343818 20:24450968-24450990 AGCAGCCAGAGCAGTGGCCCTGG - Intergenic
1172278526 20:33694392-33694414 AAAAGCCAGACCCCTTGCCCTGG + Intergenic
1172508255 20:35480043-35480065 TGCAGCCAGACAGCTGGCCCAGG + Exonic
1173809086 20:45945530-45945552 ACCAGCCAGGCAACTGGCCGGGG - Intronic
1174041689 20:47704944-47704966 AGCACAGAGCCACCTGGCCCTGG + Intronic
1174163100 20:48565507-48565529 AGCTGTCTGGCACCTGGCCCTGG - Intergenic
1174379192 20:50145958-50145980 AGGAGCCAGACCTCTGGCCATGG - Intronic
1175230681 20:57471506-57471528 AGAAGGCAGACACCTGGGCCAGG - Intergenic
1175639273 20:60613936-60613958 AGCAGCGAGACTCCTGTCCTTGG + Intergenic
1175748797 20:61480567-61480589 GGCAGCCAGCCACCAGGCCCCGG - Intronic
1176038258 20:63050664-63050686 AGCAGCCACACAGATGCCCCGGG - Intergenic
1176097181 20:63349544-63349566 AGCAGCCTGAGGCCTGGGCCCGG + Intronic
1176146145 20:63566396-63566418 TGCCGACAGACACCTGGCCTAGG + Exonic
1176237797 20:64062324-64062346 GGCAGCCAGAGAGATGGCCCAGG - Intronic
1176269596 20:64228952-64228974 AGCAGCCAGACCTCACGCCCGGG + Intronic
1178442651 21:32611682-32611704 AGCAGCGAGCCACCTGGCTTTGG - Intronic
1178707832 21:34889565-34889587 AGCAGCCGGACAGCCTGCCCGGG + Intronic
1179711271 21:43264618-43264640 AGTTGCCTGGCACCTGGCCCTGG + Intergenic
1180455716 22:15511561-15511583 AGGAGCCAGTCCCCTAGCCCAGG - Intergenic
1180974886 22:19842854-19842876 AGCAGCCACAGCCCTGGCCATGG + Intronic
1181005393 22:20011042-20011064 AGCAGGCAGGTTCCTGGCCCTGG + Intronic
1181032225 22:20154205-20154227 GGCGGCTGGACACCTGGCCCTGG + Intergenic
1181627865 22:24133644-24133666 AGCAGCCAAGCACCTTGCACTGG - Intronic
1182422427 22:30254901-30254923 ATCAGCCAGACCCCAGGTCCAGG + Intergenic
1182747081 22:32614393-32614415 AGCTGCCTGACCCCAGGCCCAGG - Intronic
1183089640 22:35512826-35512848 AGGAGTCAGACACTTGGCTCAGG + Intergenic
1183428210 22:37750870-37750892 GGCAACCAGACACCTTGGCCTGG + Intronic
1184109489 22:42386767-42386789 AGAAGTCAGACACCTCGGCCAGG + Intronic
1184214816 22:43059652-43059674 AACATCCAGACCCCTGCCCCAGG + Intronic
1184405765 22:44299518-44299540 AGCCCCCAGACCCCTGGCCTGGG + Intronic
1184536565 22:45091638-45091660 AGCAGCAAGACAACTGGCCTCGG + Intergenic
1184715936 22:46281850-46281872 AGCAGCCAAACACCTGAGGCAGG - Intronic
1185058144 22:48591890-48591912 GGGAGACAGACACCGGGCCCAGG - Intronic
1185179370 22:49350287-49350309 GGCTGCCGGCCACCTGGCCCGGG + Intergenic
1203236033 22_KI270732v1_random:2212-2234 AGCAGCCAGGCAGCTGGAACTGG + Intergenic
1203324497 22_KI270738v1_random:975-997 AGCAGCCAGGCAGCTGGAACTGG - Intergenic
950118851 3:10468431-10468453 AGCCGCCAGCCCTCTGGCCCAGG - Intronic
950643021 3:14360521-14360543 GGCAGCCAGACCCCAGGGCCTGG - Intergenic
950644681 3:14369950-14369972 CCCGGCCAGCCACCTGGCCCGGG + Intergenic
950655378 3:14433149-14433171 ACCTGCTACACACCTGGCCCAGG - Intronic
950839828 3:15957019-15957041 AGCAGCCAGAGAGCAAGCCCTGG + Intergenic
952180536 3:30912140-30912162 GGCAGCTAGTCACCTGCCCCAGG - Intergenic
954391042 3:50268003-50268025 AGGAGCCAGACACCTCCCCCTGG - Intronic
954439588 3:50514516-50514538 AGCAGACATCCACCGGGCCCAGG + Intergenic
954873539 3:53785672-53785694 AGCACTCAGCCACCTGGCTCAGG - Intronic
956334428 3:68147261-68147283 AGTTGCCTGATACCTGGCCCTGG - Intronic
960078546 3:113515474-113515496 AGGCGCCCGCCACCTGGCCCGGG - Intergenic
960516520 3:118608186-118608208 AGCAGCCACAGACCTCACCCAGG - Intergenic
960568177 3:119157027-119157049 AGCAGCCAGTCACCTGGGACTGG - Intronic
961027218 3:123568884-123568906 AGAAGCCACACAACTTGCCCAGG + Intronic
962476230 3:135757834-135757856 AGCAGCCAGAACCCAAGCCCAGG + Intergenic
962479661 3:135787469-135787491 AGCAACCAAGCGCCTGGCCCTGG - Intergenic
964753040 3:160069490-160069512 AGCAGACAAAAACCTGGCTCTGG - Intergenic
964763481 3:160156445-160156467 ATGAGCCATGCACCTGGCCCAGG - Intergenic
966924484 3:184635417-184635439 AGCCGCCAGACCACTTGCCCCGG - Intronic
967886284 3:194335913-194335935 AGCTGCCACTCAGCTGGCCCAGG - Intergenic
968608470 4:1546441-1546463 GACAGCCAGACCCCTGCCCCAGG + Intergenic
968708670 4:2096269-2096291 AGCAGACACAGACGTGGCCCAGG - Intronic
969096588 4:4737004-4737026 AGCAGCCTGTCACCCAGCCCAGG + Intergenic
969680854 4:8642602-8642624 AGCAGCGAGACAGCTGGGCAGGG - Intergenic
972644400 4:40954053-40954075 AGAAGCCAGGCCCCTAGCCCTGG - Intronic
973930924 4:55792673-55792695 AGCAACAAGACACCTGGTGCGGG - Intergenic
976280318 4:83320660-83320682 ATCAGCCAGTCAGCCGGCCCTGG - Intronic
976344088 4:83979627-83979649 AGCCTCCAAACGCCTGGCCCAGG - Intergenic
981141019 4:141269375-141269397 AGCAGCCATACACATGGCCTAGG + Intergenic
982850808 4:160313276-160313298 ATTTGCAAGACACCTGGCCCAGG + Intergenic
984833727 4:183999861-183999883 AGCAGCCAGACACCTTGTCGGGG + Intronic
985514734 5:335672-335694 AGCAGCCAGAGCCTTGGCCATGG + Intronic
986706352 5:10457535-10457557 AGCAGACAGACACCTTGGCCAGG - Intronic
986775225 5:11008090-11008112 AGGAGCCAAACCCCTGGCTCTGG + Intronic
987383313 5:17306497-17306519 AGCACACAGCCAACTGGCCCAGG + Intergenic
990532422 5:56687722-56687744 AGTTGCCTGATACCTGGCCCTGG - Intergenic
990866915 5:60390055-60390077 AACAGCCACACACTTGCCCCGGG - Intronic
992611462 5:78511692-78511714 AGCAGGCAGACAGCTGGTGCAGG - Intronic
992644979 5:78803530-78803552 AGCAGACAGAGCCCTGGCCTTGG + Intronic
996236714 5:121140042-121140064 ATCAGCCAGCCAGCTGGTCCAGG + Intergenic
996445856 5:123549505-123549527 AGCTTCCAGGTACCTGGCCCTGG - Intronic
997249487 5:132377537-132377559 AGCAGCCAGACGCTTGGATCTGG - Intronic
998152363 5:139764663-139764685 AGCAGCCAGCAAGCTGGGCCAGG + Intergenic
998165720 5:139842417-139842439 TGCTGCCAGTCACATGGCCCTGG - Exonic
998473479 5:142401348-142401370 TCCAGCCAGAAACCTGCCCCAGG - Intergenic
998769010 5:145520601-145520623 CCCAGCCAGCCACCTGGCACGGG + Intronic
999285888 5:150394033-150394055 GGGAGCCAGACACCTGGGCGTGG - Intronic
999384031 5:151141622-151141644 AGCATCCAGAGGCCTGGCCGGGG - Intronic
1001024696 5:168214231-168214253 GGCAGCCAGACACATGGCAGGGG + Intronic
1001296668 5:170503817-170503839 ATCAGCCAGGTGCCTGGCCCCGG + Intronic
1001319420 5:170668218-170668240 TGCAGCCAGGCTCCTGGCCAGGG + Intronic
1002830585 6:816737-816759 AGCTGCCTGTTACCTGGCCCTGG - Intergenic
1004494933 6:16154577-16154599 GGCAGCCTTACACATGGCCCGGG + Intergenic
1005226789 6:23652505-23652527 AGCAGGCAGAAACCTATCCCAGG + Intergenic
1005831856 6:29677322-29677344 AGACGGCAGACACCTAGCCCAGG - Intronic
1006795159 6:36727523-36727545 GGCATCCAGACCCCAGGCCCTGG - Intronic
1007103579 6:39268287-39268309 AGCAGCCTAACACCTGGCGGAGG - Intergenic
1007108030 6:39296733-39296755 AGCAGGCAGACCTCTGGCCCCGG - Intergenic
1007420983 6:41719573-41719595 GGAGGCCAGACACCCGGCCCAGG + Intronic
1011704329 6:89985825-89985847 AGCAGGCAGACACCAGGGCTAGG + Intronic
1013465563 6:110414509-110414531 AGCCTCAGGACACCTGGCCCGGG - Intronic
1016885454 6:148955509-148955531 AGCTGCCCAGCACCTGGCCCTGG - Intronic
1017031794 6:150230355-150230377 GGCAGCCAGCCCCCAGGCCCAGG + Intronic
1017637514 6:156456755-156456777 AGCAATCAGTCACCTGGACCTGG - Intergenic
1018081619 6:160263697-160263719 ATGAGCCCCACACCTGGCCCTGG - Intronic
1019387884 7:768695-768717 GGAAGGCAGACACGTGGCCCAGG + Intronic
1019444485 7:1064289-1064311 AGCAGCCACAGAACAGGCCCCGG + Intronic
1019536928 7:1534112-1534134 ACCAGCCAGCAGCCTGGCCCTGG - Intronic
1019606581 7:1913245-1913267 AGCAGCCAGACACAGGGCTCTGG + Intronic
1020049637 7:5072953-5072975 GGCAGACTCACACCTGGCCCCGG + Exonic
1020126132 7:5533344-5533366 ACCACCCAGCCACCTTGCCCTGG + Intronic
1023872557 7:44270593-44270615 TGCAGCCAGTTTCCTGGCCCAGG - Intronic
1024021238 7:45372913-45372935 AGCAGCCAGACACCTGTGCTAGG - Intergenic
1024075082 7:45814017-45814039 AGCAGGCAGGGACATGGCCCCGG + Intergenic
1025052364 7:55741792-55741814 AGCAGGCAGGGACTTGGCCCCGG - Intergenic
1025129320 7:56367475-56367497 AGCAGGCAGGGACTTGGCCCCGG - Intergenic
1025145006 7:56494673-56494695 AGGAGCCAGACTCCTGGGCAGGG + Intergenic
1025320867 7:58091934-58091956 AGCAGCCAGGCAGCTGGAACTGG + Intergenic
1025956900 7:66189963-66189985 AGGTTCCAGACACCTGGGCCTGG - Intergenic
1026958690 7:74394806-74394828 ACCAGCCAGGCCCCTGGCCAGGG + Intronic
1030157744 7:106473224-106473246 AGAAGCCAGACAGCTGGGCATGG + Intergenic
1031162662 7:118186739-118186761 AGAAGCCAGGCAACTGGCCTTGG - Intronic
1032465802 7:132144050-132144072 AGCACCCTGGCACCTAGCCCTGG - Intronic
1033290595 7:140079522-140079544 ATCACCCAGACTCCTGGCCTGGG + Intergenic
1034474645 7:151275459-151275481 AGCAGACAGAGACCGGCCCCAGG + Intronic
1034563449 7:151895958-151895980 GGCACACAGACACCTGGCGCCGG - Intergenic
1035228003 7:157444170-157444192 AGCCCCCAGACACCTGGCCTGGG - Intergenic
1035578115 8:721489-721511 GGCCCCCACACACCTGGCCCAGG + Intronic
1036207980 8:6819223-6819245 GGCTGCCAGACCCCAGGCCCTGG - Intronic
1036632231 8:10523987-10524009 CACACCCAGGCACCTGGCCCTGG - Intergenic
1037752723 8:21693062-21693084 GGCAGCCTGAGAGCTGGCCCAGG - Exonic
1037819215 8:22127614-22127636 GGCAGCCAGACACTGTGCCCTGG - Exonic
1037850406 8:22322891-22322913 AAGAGCCAGACACCTTCCCCAGG + Intronic
1038404281 8:27310388-27310410 AGGAGCCACAGACCTGGCCAGGG - Intronic
1038436538 8:27540498-27540520 AAAATGCAGACACCTGGCCCGGG + Intronic
1038487927 8:27949807-27949829 AGGAGCCAGACCCATGTCCCTGG - Intronic
1040408772 8:47134281-47134303 AGCAGGCAGACACGTGGACAGGG + Intergenic
1040538433 8:48329906-48329928 AGCAGCCAGAAGACCGGCCCAGG + Intergenic
1041099557 8:54382223-54382245 AGGAGCCAGACGCCAGGCCCCGG + Intergenic
1044628646 8:94258462-94258484 ATCAGCCACACACCTGGCTCTGG - Intronic
1045349268 8:101323232-101323254 TACAGCCAGCCACCTGGCCATGG - Intergenic
1046408232 8:113803244-113803266 AGTTGCCTGATACCTGGCCCTGG + Intergenic
1047254615 8:123206273-123206295 AGCACCCAGACACGGGGCCGAGG - Intronic
1047975104 8:130122044-130122066 AGCAGCCAGGCAGCTGGAACAGG - Intronic
1049807794 8:144548694-144548716 AGCAGACAGACACCTGGTCGTGG - Intronic
1051520820 9:17985910-17985932 ACAAGCCAGAATCCTGGCCCAGG + Intergenic
1052827760 9:33189403-33189425 ACCAGCCAGACGTCTGTCCCAGG + Intergenic
1052888793 9:33676855-33676877 AGCAGCCAGAGGCCTGGCAGCGG + Intergenic
1053052691 9:34975080-34975102 AGCAGCCAGAGATCTGACCACGG + Intronic
1053289579 9:36871147-36871169 AGCAGCCTGACGCCAGGCCTGGG - Intronic
1055360762 9:75488219-75488241 AGCAGCCAGCTGCCTAGCCCTGG + Intergenic
1055889186 9:81104828-81104850 AGCATCCAGACACCAGGGACTGG + Intergenic
1056260615 9:84844266-84844288 AGCAGCCAGCACTCTGGCCCAGG - Intronic
1056311911 9:85349234-85349256 AGCAGCCACACACCGTTCCCTGG - Intergenic
1056606892 9:88093288-88093310 AGCTGACAGAGACCTGGGCCAGG - Intergenic
1057083226 9:92188235-92188257 AGCAGACAGACACAGGGGCCAGG + Intergenic
1058703599 9:107620940-107620962 AGCAGCCAATCACATGGGCCTGG - Intergenic
1059669453 9:116478657-116478679 AGAAGACAGACACCAGCCCCTGG - Intronic
1060594461 9:124839998-124840020 AGCAGCCCCACACCTCCCCCAGG - Intergenic
1061457893 9:130712637-130712659 TGCACCAAGACTCCTGGCCCGGG - Intergenic
1061484393 9:130912956-130912978 AGCACCCCGACCCCTGCCCCAGG - Intronic
1061484719 9:130914479-130914501 AGCAGGCTGACACAGGGCCCAGG - Intronic
1062076215 9:134591339-134591361 AGTTGCCTGGCACCTGGCCCTGG - Intergenic
1062254489 9:135614660-135614682 AGCGCCCAGACACTGGGCCCAGG + Intergenic
1186705251 X:12133898-12133920 ACCAGCCAGACAGCTGACACTGG + Intergenic
1191182069 X:57574801-57574823 AGCAGCCAAATACCTGACCTAGG + Intergenic
1191654220 X:63578020-63578042 AGTAGCCAGAGACCTTGCACTGG - Intergenic
1192763127 X:74117897-74117919 AGCAGCCACCCACCTGGAACTGG + Intergenic
1193987969 X:88270001-88270023 AGCTGCCTGGTACCTGGCCCTGG - Intergenic
1197727602 X:129786651-129786673 AGCAGCCAGAAACCAGGGCAAGG - Intronic
1200161943 X:154014083-154014105 AGCAGCAGGCCAGCTGGCCCAGG + Exonic