ID: 1167512117

View in Genome Browser
Species Human (GRCh38)
Location 19:49900931-49900953
Sequence ACACCTGGCCCTGGCCCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 398
Summary {0: 1, 1: 0, 2: 5, 3: 38, 4: 354}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167512111_1167512117 27 Left 1167512111 19:49900881-49900903 CCACAATGATGGTTTCGATGAGG 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1167512117 19:49900931-49900953 ACACCTGGCCCTGGCCCCACTGG 0: 1
1: 0
2: 5
3: 38
4: 354

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167512117 Original CRISPR ACACCTGGCCCTGGCCCCAC TGG Intronic
900096670 1:942712-942734 ACTGCTGGCCCTGCCCCCCCAGG + Exonic
900109702 1:1000300-1000322 TCACCCGGCCCTGTCCCCAGCGG - Intergenic
900120382 1:1046345-1046367 CCACCTGACCCTGTCCCAACCGG + Intronic
900181816 1:1314426-1314448 GCACCTGGCCGTGCCCTCACTGG - Intronic
900432997 1:2611721-2611743 ACAGCTGCCCCAGGCCCCAAGGG + Intronic
900675931 1:3886264-3886286 CCACCTTGCCCTGGACACACAGG + Intergenic
900993938 1:6110208-6110230 TGCTCTGGCCCTGGCCCCACTGG - Intronic
901026159 1:6279767-6279789 ACACCTGGCGCTACCACCACGGG + Intronic
901535034 1:9876987-9877009 AGAACTGGCCTTGGCTCCACAGG + Intronic
901627971 1:10634430-10634452 GGAGGTGGCCCTGGCCCCACAGG - Intergenic
902253444 1:15171416-15171438 CCACCTGGCCCTGGGTACACGGG + Intronic
903364047 1:22795034-22795056 GCAGCTGGCACAGGCCCCACTGG + Intronic
904032501 1:27541968-27541990 ACACAGTGCCCTGCCCCCACAGG - Intronic
904041810 1:27589859-27589881 GTGCCTGGCCCTGGCCCCACTGG - Intronic
904044596 1:27602218-27602240 ACATCTGGCCCTGGCCCCCAGGG + Intronic
904378569 1:30096533-30096555 ACCCCTGCCCCTGGCACCCCGGG + Intergenic
905149990 1:35919843-35919865 ACATCTGGCCCTGACCCCACTGG + Exonic
905307705 1:37030883-37030905 ACACCTCTCCCTGGCACCCCAGG - Intronic
905445685 1:38027275-38027297 CCAACAGGCCCTGGCCTCACCGG - Intergenic
906518549 1:46453726-46453748 ACACCTGACAGTGTCCCCACAGG - Intergenic
906862590 1:49377819-49377841 ACACCTGTACCTGGCTCCAGAGG + Intronic
907048044 1:51312007-51312029 ACACCAGGGCCTGGCCCCCTAGG + Intronic
911063826 1:93770129-93770151 TCACTTGGCCCAGGCTCCACTGG + Intronic
912451156 1:109768553-109768575 ACACCTGGCCCTGGGGCTGCTGG + Intronic
916264983 1:162881873-162881895 ACTCCTGGCCCTAGCCCCGAGGG + Intergenic
918013058 1:180605358-180605380 ACACAAGGCCCAGGCCCCCCAGG + Intergenic
918341355 1:183570378-183570400 ACCTCAGGCCCAGGCCCCACAGG + Intronic
918363078 1:183778956-183778978 ACACCTGGCACTGGTACAACTGG + Intronic
918795334 1:188887698-188887720 AGACTTGGCCCTAGCCCCAGAGG + Intergenic
920243829 1:204573289-204573311 CCACCTGGCCCAGGCCACAGAGG - Intergenic
920499401 1:206476880-206476902 TCCCCTGGCCCTTCCCCCACCGG + Intronic
922704532 1:227782232-227782254 AGACCTTGCCCTGTCCCCTCTGG + Intergenic
923400092 1:233608323-233608345 ACAACTGGACGTGGCACCACTGG + Intergenic
1063313790 10:4982574-4982596 CCACCTAACCCTGGACCCACTGG + Exonic
1065925092 10:30428021-30428043 ACACCAGGCCCTAGAGCCACAGG - Intergenic
1066357035 10:34694953-34694975 ATTCCTGGCCCTCTCCCCACCGG - Intronic
1067058608 10:43066385-43066407 GCCCCTGGCCCTGGCCTTACTGG - Intergenic
1069768145 10:70879068-70879090 ACTCCTGGCCCAGGCCCTAGGGG + Exonic
1069812189 10:71170247-71170269 ACACATCTCCCTGGCCCCTCAGG + Intergenic
1069905593 10:71730447-71730469 ACCCCTGGCCCGGCTCCCACAGG + Intronic
1070785171 10:79158485-79158507 AGCCCTGGCCCTGGCCTCAAGGG - Intronic
1072638110 10:97190289-97190311 CCTCCTGGCCCTGCCACCACAGG + Intronic
1072691335 10:97573985-97574007 GCACCTGGCCCTGTCCACAGAGG - Intronic
1073122547 10:101131522-101131544 CATGCTGGCCCTGGCCCCACCGG - Exonic
1074085732 10:110207933-110207955 GCACCTGGGCTTGGCCCCAGCGG - Exonic
1074183685 10:111083709-111083731 AGGCCTGGCACTGGTCCCACAGG - Intergenic
1074891411 10:117739299-117739321 AGACCTGCCTCTGGCCCCAGGGG + Intergenic
1075276628 10:121099642-121099664 ACCTCTGGCTCTGACCCCACTGG - Intergenic
1076119239 10:127922523-127922545 ACACATGGCCCCGGCCCACCTGG - Intronic
1076264894 10:129101982-129102004 AAACCTGGGCCTGGCCACAATGG + Intergenic
1076307270 10:129474165-129474187 TCCGCAGGCCCTGGCCCCACTGG - Intronic
1076318202 10:129558104-129558126 ACACCTGACCCCGGGCGCACAGG - Intronic
1076616690 10:131759748-131759770 ACACCTGGCCTGGACCTCACTGG + Intergenic
1077225446 11:1437372-1437394 ACCCCAGGCCGTGGCCTCACTGG + Intronic
1077351547 11:2095369-2095391 ACCCCTCGCCCAGGCCCGACTGG + Intergenic
1077533491 11:3108072-3108094 ACCCCTGGCCCTGCCCCAGCAGG + Intronic
1078453433 11:11457151-11457173 ACACAAAGCACTGGCCCCACTGG + Intronic
1078534491 11:12162266-12162288 ACACCTGGACCTAGACCCTCTGG + Exonic
1078572296 11:12469614-12469636 AGGCCTGGCCCTTGCCCCATGGG - Intronic
1080583765 11:33664279-33664301 ACACCTGGAGGTGGACCCACTGG - Intronic
1081865525 11:46357661-46357683 AGACCTGGCCCCGGCCCCCCAGG + Intronic
1083282914 11:61638470-61638492 ACGCCAGGCCCTGGCCTCCCAGG - Intergenic
1083336341 11:61923939-61923961 AGACCAGGCCCAGGCCCCTCAGG + Intergenic
1083925211 11:65801814-65801836 ACCCCTGGCATGGGCCCCACAGG - Intergenic
1083961205 11:66015966-66015988 AAGCCTCGCCCTGGCCCCAGGGG - Intergenic
1084044070 11:66559184-66559206 ACCCCTGCCCCTGCCGCCACTGG + Intronic
1084265062 11:68000803-68000825 ACAACTTGCCCAGGTCCCACAGG - Intronic
1084378376 11:68794256-68794278 CCACCTGGTCCTGGACCCCCTGG - Intronic
1084423572 11:69072325-69072347 ACACCTGGCCCACGCACCTCTGG - Intronic
1084881278 11:72173258-72173280 ACCGCTGGCTCTGGCCACACTGG - Intergenic
1085053870 11:73393047-73393069 ACACCCTGCCCTGGGCCCATGGG + Intronic
1085388303 11:76169637-76169659 GCACCTTCCCCTGACCCCACTGG - Intergenic
1085403793 11:76249878-76249900 CCACCTGTTCCTGGCCCCACTGG - Intergenic
1085520914 11:77138415-77138437 CCTCCTGGCCCGGGCCTCACCGG - Intronic
1087642450 11:100769815-100769837 ACACCTCCCCCTGGCCAAACAGG - Intronic
1088920967 11:114259539-114259561 ACACCTGGTCCTTGGCCCATGGG + Intronic
1089051909 11:115552965-115552987 AACCTTGGCCCTGGACCCACTGG - Intergenic
1089422639 11:118343128-118343150 ATGGCTGGCCCAGGCCCCACAGG - Intergenic
1089812586 11:121143979-121144001 ACAGCTGGCCTTGGCCCCATGGG - Intronic
1091059589 11:132449085-132449107 AGAGCTGGCCCAGGCCACACTGG + Intronic
1091305534 11:134533459-134533481 AGACCCGGCCCTTGCCCCATGGG - Intergenic
1093429663 12:19070499-19070521 ACACTTGGCTGTGGACCCACAGG + Intergenic
1094414361 12:30201714-30201736 ACACCCGGCCCTGGCTCAAAGGG - Intergenic
1095978151 12:47953963-47953985 TGACCTGCCCCTGGCCCCACAGG + Intergenic
1096842068 12:54385706-54385728 TGGCCTGGCCCTGGCCCCCCAGG + Intronic
1101564001 12:105888043-105888065 ACACGTGGCCCTTGCCCAAAAGG + Intergenic
1102454369 12:113062787-113062809 AAGCCAGGCTCTGGCCCCACAGG + Intronic
1102692227 12:114770322-114770344 ACACTTGGGCCTAGCCCCTCTGG + Intergenic
1103906624 12:124330962-124330984 ACACCTGGCCTGGACCACACGGG - Intronic
1106410509 13:29508064-29508086 ACCCCAGGCCATGGCTCCACAGG + Intergenic
1107559176 13:41545079-41545101 GCAGCTGCCCTTGGCCCCACTGG - Intergenic
1113714519 13:112493540-112493562 ACACCAGGCCCTGTTCCCAAAGG - Intronic
1117369409 14:55062918-55062940 GTGCCGGGCCCTGGCCCCACAGG + Exonic
1117766919 14:59093031-59093053 TCACCTGGCCCTGGCCCAGTGGG - Intergenic
1119485692 14:74985068-74985090 AGCCTTGGCCCTGGCCCCCCCGG - Intergenic
1119645053 14:76341976-76341998 ACTCCAGGCCATGGCCTCACTGG - Intronic
1119703407 14:76769876-76769898 ACACCTAGGACTGGCCCCAGAGG - Intronic
1121016427 14:90552108-90552130 ACACCAGGACCTGGCCCCTGTGG - Intronic
1121562697 14:94886755-94886777 ACTCCTGGCCCCTGCCTCACTGG - Intergenic
1122552984 14:102560192-102560214 ACCCCTGGCTCTGTCTCCACTGG - Intergenic
1122579864 14:102764729-102764751 ACACCTGGGCCGGGGGCCACAGG + Intergenic
1122717891 14:103706283-103706305 ACCCCAGGCCCTGGACCCACAGG - Intronic
1122999794 14:105287196-105287218 AGACCTGGCCCTGGTACCTCTGG + Intronic
1125519417 15:40339790-40339812 ACCCCTGGCCCCAGCCCCAGAGG + Intronic
1126698053 15:51342067-51342089 CCACCTGGCCGGGGCGCCACGGG - Intronic
1128061652 15:64739259-64739281 ACACCTGGCCCAGGCCAGCCTGG + Intergenic
1128211962 15:65909274-65909296 CCCGCTGGCCCTGGCCCCTCTGG - Intronic
1128301566 15:66569450-66569472 AACACTGGCCCTGGCTCCACCGG - Intergenic
1128729345 15:70010187-70010209 AGACATGGCCCTGGCCTCACAGG + Intergenic
1129342130 15:74892949-74892971 ACACCTGAGCCTGGTCTCACTGG - Intronic
1129986560 15:79923854-79923876 ACACCTGGCCCCGCCCCGTCGGG - Intergenic
1132674780 16:1117106-1117128 ACCCCTCACCCTGTCCCCACAGG + Intergenic
1132679464 16:1133817-1133839 ACCCCCGGCCCTGGCCTCTCTGG - Intergenic
1132696904 16:1206037-1206059 ACCCCAGGCCCTCGTCCCACTGG - Intronic
1132832478 16:1935566-1935588 CCACCTGGCCCCTGCCCCCCAGG + Intergenic
1132959175 16:2612709-2612731 GCGCCTGCCCATGGCCCCACAGG + Intergenic
1132972235 16:2694684-2694706 GCGCCTGCCCATGGCCCCACAGG + Intronic
1133574894 16:7079253-7079275 ACATCTGGCTCTGCCCCAACTGG + Intronic
1134522513 16:14925079-14925101 CCACTTGGGCCTGTCCCCACAGG + Intronic
1134710183 16:16323730-16323752 CCACTTGGGCCTGTCCCCACAGG + Intergenic
1134717397 16:16363730-16363752 CCACTTGGGCCTGTCCCCACAGG + Intergenic
1134949420 16:18344915-18344937 CCACTTGGGCCTGTCCCCACAGG - Intergenic
1134957355 16:18388429-18388451 CCACTTGGGCCTGTCCCCACAGG - Intergenic
1136248763 16:28990040-28990062 CCACCCTGCCCTGGGCCCACAGG + Intronic
1136373240 16:29848957-29848979 ACAACTGTTCCTGGCCCCAAAGG - Intergenic
1137557222 16:49478306-49478328 ACCCCTGCCCCTGTCCCCACGGG + Intergenic
1137723144 16:50639536-50639558 CCACCTGCCCCCTGCCCCACCGG + Exonic
1137967482 16:52950889-52950911 ACAGCTTGCCATGTCCCCACTGG - Intergenic
1139947651 16:70652161-70652183 ACACCTGGCCTTGGCCTTGCAGG - Intronic
1141278521 16:82609293-82609315 AGCCCTGGCCCTGGCCACTCCGG - Intergenic
1141296244 16:82772418-82772440 AAACCTGCCCCTGCCCACACAGG + Intronic
1141635847 16:85313418-85313440 TGGCCTGGCCCTGGCCCAACGGG - Intergenic
1141701974 16:85646809-85646831 ACCCCAGGCCCAGGCCTCACTGG + Intronic
1141788066 16:86214881-86214903 GCCCCAGGCCCTGACCCCACTGG + Intergenic
1141875171 16:86819302-86819324 AAACTTGGCCCTGGCCACACTGG - Intergenic
1141879493 16:86848328-86848350 AGACCAGGCCCTGGCTCCTCGGG - Intergenic
1142106069 16:88303485-88303507 GCACCTGGCCCTGGCTCCCATGG + Intergenic
1143106522 17:4533111-4533133 CCACCTGTCCTTGGCCCCACAGG - Exonic
1143628931 17:8126096-8126118 AGACCTGGCCCTTCCCCCGCGGG - Intergenic
1144495102 17:15741002-15741024 ACACCTGCCTCAGGCCCCAGGGG - Intronic
1144944118 17:18961101-18961123 GGGCCTGGCCCTGCCCCCACGGG + Intronic
1145795544 17:27653480-27653502 ACCCCTGGTCCTGGCTCCAACGG + Intergenic
1145809980 17:27758811-27758833 ACCCCTGGTCCTGGCTCCAACGG + Intronic
1146692026 17:34883315-34883337 ACACTTAGCCCTGTCCCCACCGG - Intergenic
1146924762 17:36736497-36736519 ACATCTGGCCTTGGCCCCAGTGG + Intergenic
1147359890 17:39923925-39923947 ACACCTGGGCCAGGCCCGACAGG + Intronic
1148211320 17:45810559-45810581 ACACCGGGCCCTGGGCACCCTGG - Intronic
1149223759 17:54444488-54444510 TCATCTGGCCCTGGCCCTAAGGG - Intergenic
1149790362 17:59471399-59471421 AGACCTGGTTCTGTCCCCACTGG - Intergenic
1150331280 17:64296508-64296530 CCCACTGGCCCTAGCCCCACAGG + Intergenic
1151746534 17:76014616-76014638 GCACCTGCCCCTGTCCCCACGGG - Intronic
1152063073 17:78093685-78093707 ACTCCTGGCAGTGTCCCCACTGG + Exonic
1152133109 17:78489116-78489138 GCTCCTGGCCCTGTCCCCATAGG + Intronic
1152374751 17:79913362-79913384 ACCCTGAGCCCTGGCCCCACAGG - Intergenic
1152389139 17:79992412-79992434 ACCCCACCCCCTGGCCCCACCGG - Intronic
1152514475 17:80815235-80815257 ACACCTGGCCCAGGCTCTGCTGG + Intronic
1152573279 17:81129717-81129739 ACACCTGCCCCTGGACCCAAGGG + Intronic
1152612827 17:81323956-81323978 ACAGCTGGCCCAGGCCCGAGAGG + Intronic
1153816765 18:8797475-8797497 ACACCCGGGGCTGGCGCCACTGG + Intronic
1157140760 18:45103737-45103759 ACAACTGGCCCAAGTCCCACAGG - Intergenic
1157170465 18:45399907-45399929 ACACTTGGCTGTGGCCCCAAAGG + Intronic
1157413802 18:47485551-47485573 ACACTTGGCCCAGGACCCAAAGG - Intergenic
1157540863 18:48505585-48505607 ACACCTAGCCCTGCCCCCACCGG + Intergenic
1157595316 18:48860549-48860571 AAACCTGGTCCTGGCCCCAGGGG + Exonic
1160734976 19:658293-658315 GCGCCTGGCCCTGGGCCCTCAGG - Intronic
1161155565 19:2730636-2730658 CAGCCTGGCCCTGGCCCCAGGGG - Intronic
1161551200 19:4913597-4913619 ACACCTGGCCCTAGCCTTGCCGG + Intronic
1161800915 19:6416373-6416395 CCACCTGGGCCTGGTCCAACTGG + Exonic
1162128483 19:8511739-8511761 ACCCCCGCCCCTGCCCCCACCGG - Exonic
1162317217 19:9946861-9946883 ACACCTGGACCAGGCTGCACTGG + Intergenic
1162796080 19:13088363-13088385 GCCCCTGGCCCAGGCCCCTCTGG + Intronic
1163445149 19:17341580-17341602 AGACCTGGCCCTGGCGGCAGAGG + Exonic
1163531778 19:17854170-17854192 ACTCCTCGCCTGGGCCCCACTGG + Intergenic
1163709836 19:18840003-18840025 AGCCCCTGCCCTGGCCCCACTGG - Intronic
1164615310 19:29664028-29664050 TCACCTGGTCCTGGCCCAGCAGG + Intergenic
1164813382 19:31175765-31175787 GCTCCTGGCCAGGGCCCCACTGG - Intergenic
1165061380 19:33206841-33206863 CCACCTGGCCATGGGCCCTCAGG - Intronic
1165422132 19:35727547-35727569 GCACCTGGCGCAGGCCCCCCTGG - Exonic
1165495576 19:36150589-36150611 ACTCCTGGCCCTGTCCCCCAAGG + Intergenic
1165935397 19:39385553-39385575 ACTTCTGTCCCCGGCCCCACTGG + Intronic
1166207309 19:41279576-41279598 CCAACTAGCCCTGGCCTCACTGG - Intronic
1166305152 19:41933092-41933114 CGGCCTGGCCCTGGCCCCGCCGG - Intergenic
1166546325 19:43636450-43636472 GCACCTGCCCCTTGCCCCACTGG + Intronic
1166669883 19:44703537-44703559 ACTCCTGGCCCGGCCCACACGGG + Exonic
1166687938 19:44807382-44807404 ATCCCTGGCCCTGCCCTCACAGG + Intergenic
1166750785 19:45163144-45163166 ACTGCTGCCCCTGGCCTCACCGG - Exonic
1166785533 19:45364597-45364619 ACCCCTACCCCTGGCCACACTGG + Intronic
1166841592 19:45700671-45700693 CCACCAGGCCCGGCCCCCACTGG - Intronic
1167512117 19:49900931-49900953 ACACCTGGCCCTGGCCCCACTGG + Intronic
1167613344 19:50517747-50517769 CCACCTGGCCCTGCCCGCCCTGG - Exonic
1168141513 19:54391094-54391116 ACACCTGTCCCTGGTCCTCCAGG + Intergenic
1168157240 19:54481557-54481579 ACACCTGTCCCTGGTCCTCCAGG - Intergenic
1168269599 19:55242279-55242301 ACCCCTGCCCCTGCCCCCGCAGG - Exonic
925023227 2:588019-588041 AAACCTGGCCCTGCCCCTCCTGG - Intergenic
925061089 2:890817-890839 AGACCTGGCCATGGACACACTGG - Intergenic
925317923 2:2939513-2939535 ACACCTGCCTCTGGCTCCCCTGG - Intergenic
925907751 2:8549448-8549470 CCACCTGGCCCTGGCCTCCGTGG + Intergenic
926428223 2:12759271-12759293 AGCCCTGGCCCTGGCTCCACCGG - Intergenic
927201948 2:20583460-20583482 ACACCTGGACCTGTCACCCCTGG + Intronic
927203265 2:20591476-20591498 ACACCTGGCCTTGGTGCCACGGG - Intronic
927656192 2:24948716-24948738 CCATCTGTCCCTGTCCCCACTGG + Intronic
927862373 2:26568192-26568214 CCTCTTGGCCCTGTCCCCACAGG + Intronic
928330118 2:30351319-30351341 AGGCCTGGCCCTGGCCCAGCTGG + Intergenic
928364663 2:30691804-30691826 ACAACAGGCCCAGGCCACACTGG + Intergenic
929454043 2:42054065-42054087 CCACCTGGCCCACTCCCCACTGG + Exonic
929602403 2:43212652-43212674 CCACCCAACCCTGGCCCCACCGG - Intergenic
931017647 2:58003380-58003402 ACACCTGGCTTTAGCACCACCGG + Intronic
933611371 2:84439472-84439494 ATACATGGATCTGGCCCCACTGG + Intronic
937910613 2:127073846-127073868 ACACCTGGCACAGGCCCTTCTGG - Intronic
940122409 2:150281479-150281501 TTGCCTGGCCCTGGCCCCTCAGG - Intergenic
940188531 2:151013849-151013871 CCCTCTGGGCCTGGCCCCACAGG + Intronic
946159237 2:217826038-217826060 CCACCTGGCCCTGCCCTCACCGG + Intronic
947796960 2:232900850-232900872 GGTCCTGGTCCTGGCCCCACGGG - Intronic
947953085 2:234164715-234164737 AGACCTGGCACTGGCCTCAGAGG - Intergenic
948128540 2:235583118-235583140 ACACCTGACCCTGGCCCACTTGG - Intronic
948403141 2:237699061-237699083 ACACCTGTGCCTGGCGTCACAGG + Intronic
948709936 2:239819206-239819228 AGACGTGGCCCTGGCTCCTCTGG + Intergenic
948895782 2:240926264-240926286 GCACCTGGCCGTGGCCCCCCAGG + Intronic
948896215 2:240928998-240929020 ACACCTGGCCATGCACCCGCTGG - Intronic
948915729 2:241034335-241034357 ATACTTGCCCCTGGCCCCAGGGG + Intronic
948981807 2:241498376-241498398 CCTCCTGGCCCTCTCCCCACTGG - Intronic
1169189807 20:3651366-3651388 AGATCTGTCCCTGCCCCCACGGG - Intergenic
1169674221 20:8135548-8135570 ACGCCTGGCCCTGGTACAACAGG - Intronic
1170654859 20:18276945-18276967 AAGCCTTGCCCTGGCTCCACGGG - Intergenic
1170889228 20:20364827-20364849 ACAGGAGGCCCTGGCCTCACGGG - Intergenic
1171213056 20:23331680-23331702 ACACCTCAGCCTGGCCCCGCTGG + Intergenic
1171438455 20:25141952-25141974 ACACAACTCCCTGGCCCCACAGG + Intergenic
1173009106 20:39165287-39165309 CCTCCTGGCTCTGGCCCCAAAGG + Intergenic
1173836326 20:46128540-46128562 AGAACTGCCCCTGGCACCACTGG + Intronic
1173874134 20:46359105-46359127 TCTCCAGGACCTGGCCCCACTGG + Intronic
1175036739 20:56006427-56006449 ACACCTGATACTGGCCCCACTGG - Intergenic
1175042708 20:56070591-56070613 ACACTTGGCCCCGCCCCCAAGGG + Intergenic
1175280132 20:57798376-57798398 ACAGCAGGGCCTGGCCCCCCTGG - Intergenic
1175573342 20:60040690-60040712 GCACCTGGCCCAGGACTCACTGG + Intergenic
1175582714 20:60112868-60112890 ACACCATCCCCTGGCTCCACTGG - Intergenic
1175753277 20:61513798-61513820 ACACCTGTCCCAGGCACCACGGG + Intronic
1176380923 21:6111664-6111686 ACACCTGGCCCTGCCACCCGAGG - Intronic
1178663831 21:34529409-34529431 ACACCTGTCCCTGTACCCATAGG + Intronic
1179197864 21:39183060-39183082 ACACCTGGGGCTGGCGCCGCTGG + Intronic
1179742549 21:43426576-43426598 ACACCTGGCCCTGCCACCCGAGG + Intronic
1180041269 21:45281526-45281548 ACAGCTGCCGCTGGCCCCAGCGG - Intronic
1180833495 22:18918491-18918513 ACTTTTGGCCCTGGCCCCACAGG - Exonic
1180979513 22:19872071-19872093 AGACCTGGCCCAGGCCCATCTGG + Intergenic
1180991738 22:19941360-19941382 TCACCAGGCACCGGCCCCACTGG - Intronic
1181066332 22:20307764-20307786 ACTTTTGGCCCTGGCCCCACAGG + Intergenic
1181558547 22:23686269-23686291 ACACCTGGCCCTGCCCATTCTGG - Intergenic
1182123884 22:27802554-27802576 ACACCTTGCCCTGGGCCACCCGG + Intergenic
1183463453 22:37967077-37967099 ACACCTGTCCCTATCCCTACAGG + Exonic
1183617857 22:38956055-38956077 CCAGCTGGCCCAAGCCCCACTGG - Intronic
1183654058 22:39175027-39175049 TTACCTGACCCTGGCCCCCCGGG + Intergenic
1183695808 22:39421518-39421540 ACACCCTGCCCTGCCACCACCGG + Intronic
1184097687 22:42325397-42325419 TCACGTGGGCCTGGCCCCAAGGG - Intronic
1184101898 22:42345149-42345171 AGACCTGGCTGTGGCCTCACAGG - Intergenic
1184468660 22:44683510-44683532 CCACCTGGCCCTGGCCCCAAGGG - Intronic
1184560455 22:45260088-45260110 ACAGCTGGCCCTGTCCCCCTGGG - Intergenic
1184606068 22:45575562-45575584 TCACCTGGCCCTGGATCAACAGG - Intronic
1184637785 22:45848902-45848924 CCACCAGGCACTGGGCCCACTGG - Intergenic
1185215618 22:49598528-49598550 ACACCCAGCCATGGCCCCGCAGG + Intronic
1203283580 22_KI270734v1_random:143789-143811 ACTTTTGGCCCTGGCCCCACAGG - Intergenic
949608203 3:5677108-5677130 ACAGCTGACCCCGCCCCCACAGG + Intergenic
950098909 3:10345575-10345597 CCTCCTGTCCCTGTCCCCACAGG - Exonic
951476557 3:23112687-23112709 TCTCCTGGCCCTGCCCCTACTGG - Intergenic
952832009 3:37573085-37573107 GAACCTGGCCCAGGCTCCACAGG + Intronic
952888976 3:38028886-38028908 AGACCTGGCCCTGTCCCCCGAGG + Intronic
953735161 3:45487816-45487838 ACAGCAGGCCTTGGCCCCCCTGG + Intronic
953979658 3:47407287-47407309 ACCCCTGTCCCTAACCCCACAGG + Exonic
954405110 3:50341155-50341177 ACATCCGGCCCTGGCCCTCCTGG + Exonic
954712833 3:52513475-52513497 ACACCCGCCCCTGTCACCACGGG + Intronic
954797010 3:53166724-53166746 ACACCTGGAACTTGCCCCTCAGG - Intronic
954848459 3:53579924-53579946 AAGCCCTGCCCTGGCCCCACTGG - Intronic
954880885 3:53835425-53835447 ACACCTGTCACTGTGCCCACAGG + Intronic
955922338 3:63970731-63970753 ACGCCTGTCCCTTCCCCCACTGG + Intronic
956020198 3:64925821-64925843 TCACCTGGGCCTGGCCCCTGAGG + Intergenic
956666099 3:71643321-71643343 AAACCTGGCACTTGCTCCACGGG + Intergenic
957078409 3:75618887-75618909 ACACCTCGCCCCGCCCCCAGTGG + Intergenic
957193274 3:77038694-77038716 ACACGTGGGCCCGGCCGCACCGG + Intronic
960995091 3:123335477-123335499 TCACCTGGCCAAGGCCACACAGG + Intronic
963041320 3:141072046-141072068 ACATCTGGACTTGGCCCCTCTGG + Intronic
966553277 3:181229793-181229815 ACAGCTGGGGCTGCCCCCACAGG - Intergenic
966962598 3:184954940-184954962 ACACCTGACCCTATACCCACCGG - Intronic
968489571 4:882819-882841 CCACCGTGCCCTGTCCCCACAGG - Exonic
969021487 4:4142861-4142883 ACACCTCGCCCCGCCCCCACTGG + Intergenic
969732379 4:8964556-8964578 ACACCTCGCCCCGCCCCCAGTGG - Intergenic
973333448 4:48932927-48932949 CCACCTCGCCCGGCCCCCACAGG - Intergenic
973983703 4:56328653-56328675 ATTCCTGGCCCAGTCCCCACAGG - Intergenic
974950974 4:68582641-68582663 ACGCCTGGACCTGGCCCACCTGG + Intronic
976037960 4:80847243-80847265 AGACCAGGCTCTGGCCCCAGTGG + Intronic
976113532 4:81702082-81702104 GCACCTGGCACTGTCCTCACAGG + Intronic
977559271 4:98516150-98516172 AAAACTGGCCCTGCCCCAACAGG + Intronic
980667058 4:135954004-135954026 CCACTTGGCCCTTGCCACACAGG - Intergenic
984707994 4:182861779-182861801 ACACCTGGCCATGCCTCCAGGGG - Intergenic
985539702 5:482237-482259 CCACCTGCCCCGGGGCCCACAGG + Intronic
985545735 5:508085-508107 ACCCCTTCCCCTGGCTCCACTGG - Intronic
986311084 5:6551642-6551664 ACATCTTGCCCAAGCCCCACTGG + Intergenic
986507264 5:8465003-8465025 ACACCTGGCCCTGGACACATGGG - Intergenic
987132536 5:14872179-14872201 ACCCCGGCCCCCGGCCCCACGGG - Intergenic
991943043 5:71873278-71873300 ACATCTGGCCTTAGCCCAACTGG - Intergenic
994240095 5:97408654-97408676 TCACCTGTTCCTGCCCCCACTGG + Intergenic
995903268 5:117094053-117094075 ACACCTGGACCTGCCTCCAAAGG + Intergenic
996978535 5:129461620-129461642 AATCCCGGCCCCGGCCCCACGGG + Exonic
997311276 5:132885596-132885618 ACTCCTTACCCTGGCCCCAAGGG - Intronic
997434921 5:133867121-133867143 ACACCTTGCTCTGGCCTCTCAGG + Intergenic
998316610 5:141188806-141188828 ACACCTGCCCCTCGCCTCCCTGG + Exonic
999300318 5:150486454-150486476 ACGCCGGGCTCGGGCCCCACCGG - Intronic
1000020227 5:157311810-157311832 CCTTCTGGCCCTGGGCCCACGGG - Intronic
1001387638 5:171353184-171353206 ACACCTGGCCCAGGCCCCAGAGG + Intergenic
1001546922 5:172576012-172576034 GCACATGGCACTAGCCCCACAGG + Intergenic
1002789509 6:426979-427001 ACACTTGGCTCTGGCCCCTGGGG - Intergenic
1002860502 6:1075490-1075512 GCACCTGCCCCTGGTCCCAGAGG + Intergenic
1002927641 6:1614273-1614295 ACTCACGGCCCTGTCCCCACGGG + Intergenic
1002968316 6:1989842-1989864 AGAGCTGGGCCTGGCCCCAAGGG - Intronic
1004043272 6:12003519-12003541 ACAACTAGACCTGGCCTCACAGG - Intergenic
1005255589 6:23999456-23999478 ACACCTGGCTGTGGCCACTCAGG + Intergenic
1005283884 6:24303427-24303449 ACACCTTGCCTTTGCCCCTCTGG + Intronic
1006184196 6:32171070-32171092 ACCCCTTGCCATGACCCCACAGG - Exonic
1006378769 6:33685844-33685866 ACACCTGCCCCTTCCCCCGCTGG + Intronic
1006615082 6:35320862-35320884 CCCACTGGCCCTGTCCCCACAGG + Exonic
1006899228 6:37489497-37489519 CAACCTGGCCCTGGCTCCAGAGG - Intronic
1007356296 6:41320110-41320132 GCACCTGGCCCTGACCCCGGAGG - Intergenic
1007390418 6:41547099-41547121 GCCCCTGGCCCGGGCCCCAGCGG + Intronic
1011443028 6:87407941-87407963 CCACCTGGCCCCGCCCCCTCTGG + Intergenic
1015493504 6:133855067-133855089 CCACCTGCTCCTGGCCCCAGGGG + Intergenic
1016498242 6:144689246-144689268 ACACCTGGGGCTGCTCCCACAGG - Intronic
1017798401 6:157869149-157869171 ACACCTCTCCCCGGCCTCACTGG + Intronic
1018133715 6:160757558-160757580 ACAGCTGGGCCTTCCCCCACAGG + Intergenic
1018733969 6:166673524-166673546 GCACCTGGCCCTGAGCCCATGGG + Intronic
1019327166 7:444165-444187 TCACCTGTCCCTGGAGCCACTGG - Intergenic
1019382351 7:730642-730664 ACACCTGGAGCCGGCCCTACGGG - Intronic
1019701197 7:2475707-2475729 ACACCTGCTCCGGGCCCCAGCGG + Exonic
1019732272 7:2634684-2634706 GGACCTGGCCCTGGTCCCTCCGG - Intronic
1020308909 7:6854890-6854912 ACACCTCGCCCCGCCCCCAGTGG + Intergenic
1023145033 7:37142497-37142519 ACACCTGGCTGTGGCATCACAGG + Intronic
1024456506 7:49614680-49614702 GCACCTGACCCTGTACCCACCGG - Intergenic
1025085613 7:56020812-56020834 ACACTTGGACCTCGCCCCCCAGG + Intronic
1026923643 7:74174192-74174214 GCGCCCGGCCCTGGGCCCACCGG - Intergenic
1029488408 7:100857083-100857105 ACTCCTAGGCCTGGCCCCAATGG + Exonic
1029849160 7:103445296-103445318 GCACCTGGGCCGGGCCCCGCCGG - Intronic
1032475986 7:132211807-132211829 ACACTTAGCCCTGGAGCCACAGG + Intronic
1032642302 7:133783286-133783308 ACAGCTGGCCTTGGCAACACGGG - Intronic
1032736324 7:134695806-134695828 CAGCCTGGTCCTGGCCCCACTGG + Intergenic
1035473931 7:159129082-159129104 TCACCTGGCCCTGACCCCCCAGG - Intronic
1035606549 8:933675-933697 ACACCTGGCCGTGGGCACAAGGG + Intergenic
1035627961 8:1088073-1088095 CCAGCTGGGCTTGGCCCCACAGG + Intergenic
1036424703 8:8633709-8633731 GCCCCTGGCCCTGGCCCACCAGG + Intergenic
1037476371 8:19261946-19261968 CCACCTGGCCCGGCCCCCACTGG + Intergenic
1037609601 8:20465002-20465024 ACAACTGTCCCTGTCTCCACTGG - Intergenic
1038283137 8:26183500-26183522 ACACCTCGCCCTGGCCACACAGG + Intergenic
1045249811 8:100474034-100474056 ACAGCTGCCCCTGGGCACACTGG - Intergenic
1047200010 8:122757233-122757255 CAAGCTGGCCCTGGCCACACTGG + Intergenic
1047720204 8:127632022-127632044 ACACATGGCCCTGGCCTCTTTGG - Intergenic
1048205774 8:132414218-132414240 TCACCAGCCCCTGGTCCCACAGG + Intronic
1048600041 8:135910129-135910151 ACTCCTGGCCCTGGTCCATCTGG + Intergenic
1048801424 8:138197707-138197729 GCACCTGGCCCAGGCAGCACAGG + Intronic
1048844195 8:138591345-138591367 ACCCCTGCCCGTGGCCCCACAGG - Intronic
1049203239 8:141351845-141351867 ACTCCTGGCCCCCGCCCCACTGG - Intergenic
1049351368 8:142166491-142166513 ACACCTGGCCAAGAACCCACAGG - Intergenic
1049445336 8:142627892-142627914 GCACCTGGCCCAGCCCCCACCGG + Intergenic
1049751854 8:144288690-144288712 CCAGCTGGGCCTGACCCCACAGG - Intronic
1052317406 9:27129813-27129835 AGACCAGGCTCTGGCCACACTGG + Intronic
1053072067 9:35107568-35107590 CCCCCTGGCCCTGGACCCCCAGG - Exonic
1056842224 9:90007580-90007602 CCACCTGGCCCTGCCCGCAGAGG - Intergenic
1059609594 9:115878270-115878292 ACACCTAGCACTGCCCCTACTGG - Intergenic
1060818214 9:126646600-126646622 CAACCTGGCTCTGGCCCCACGGG - Intronic
1060856851 9:126920927-126920949 ACACCTGCCCATGGTCACACAGG - Intronic
1060966528 9:127715047-127715069 CGACCTCGCCCTGGCCCCGCTGG - Exonic
1061163149 9:128907429-128907451 ACCCCTGACACGGGCCCCACAGG + Exonic
1061301079 9:129705349-129705371 GCATCTGGCCTTGGCCCCCCTGG + Intronic
1061417293 9:130454036-130454058 GAGCCTGGCCCTGGCCACACAGG - Intronic
1061493222 9:130957539-130957561 CCACCGGGACCTGGCCCCATAGG - Intergenic
1062041279 9:134405363-134405385 TCACCGGGCCCTGGGCTCACTGG + Intronic
1062078528 9:134605779-134605801 AGACCTGGCACAGGCCACACTGG - Intergenic
1062361267 9:136189418-136189440 ACACCGAGCCCTGACCCCACCGG - Intergenic
1062451244 9:136616651-136616673 CCACCTGGCCCTGGCCCTGGAGG - Intergenic
1062520350 9:136955115-136955137 TCACCTGTCCCTGTCCCCATGGG - Intronic
1186194281 X:7095842-7095864 ACAGCTGGCCCTGAAGCCACTGG + Intronic
1187045905 X:15647234-15647256 ACACCAGCCACCGGCCCCACCGG + Intronic
1187051883 X:15703535-15703557 ACACCAGCCACCGGCCCCACCGG + Intronic
1187400030 X:18951152-18951174 CCACCTGGAGGTGGCCCCACTGG + Exonic
1187737430 X:22319304-22319326 TCACTTTGCCCTGGCCACACTGG + Intergenic
1188311738 X:28625569-28625591 ACACCTGGCTCTCTGCCCACTGG - Intronic
1190323039 X:49189433-49189455 ATACCTGACCTTGCCCCCACTGG + Intronic
1191223242 X:58014173-58014195 ACACCTTTCCCTGACCCTACTGG - Intergenic
1194011819 X:88570691-88570713 TCACCTGGCCCTGGACCCAATGG + Intergenic
1196757027 X:119166996-119167018 ACACATGGTCCTGGCCCCCATGG - Intergenic
1197725276 X:129772164-129772186 AGTCCTTGCTCTGGCCCCACTGG - Intergenic
1198790269 X:140337633-140337655 TCACCTGGCCATGGCCTCACAGG - Intergenic
1199106315 X:143873294-143873316 CCATCTGGCCCTGGGACCACAGG - Intergenic
1199159047 X:144586433-144586455 ACAACTGGGCCTGCTCCCACAGG - Intergenic
1199952821 X:152718898-152718920 GAATCTGGCCCTGGACCCACCGG - Intergenic
1199956862 X:152749550-152749572 GAATCTGGCCCTGGACCCACCGG + Intergenic
1199975800 X:152894315-152894337 ACACAAGGGCCTGGCCTCACGGG + Intergenic
1200049250 X:153420035-153420057 CCACCTGGCCCTGGACGCGCAGG + Intronic
1200180516 X:154147573-154147595 ATACCTGGCACTGGCTCCCCAGG - Intronic
1200186344 X:154185968-154185990 ATACCTGGCACTGGCTCCCCAGG - Intergenic
1200191996 X:154223106-154223128 ATACCTGGCACTGGCTCCCCAGG - Intronic
1200197751 X:154260910-154260932 ATACCTGGCACTGGCTCCCCAGG - Intronic
1201566164 Y:15367162-15367184 ACAGCTGGCCCTGAAGCCACTGG + Intergenic
1202584020 Y:26406069-26406091 ACACAGGGCCCTGTCCCCAGTGG + Intergenic