ID: 1167512118

View in Genome Browser
Species Human (GRCh38)
Location 19:49900932-49900954
Sequence CACCTGGCCCTGGCCCCACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 416
Summary {0: 1, 1: 0, 2: 7, 3: 39, 4: 369}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167512111_1167512118 28 Left 1167512111 19:49900881-49900903 CCACAATGATGGTTTCGATGAGG 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1167512118 19:49900932-49900954 CACCTGGCCCTGGCCCCACTGGG 0: 1
1: 0
2: 7
3: 39
4: 369

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167512118 Original CRISPR CACCTGGCCCTGGCCCCACT GGG Intronic
900323828 1:2097684-2097706 CCCCTGGCACGGGCCCCACCAGG - Intronic
900370805 1:2331339-2331361 CGCCTGGACTTGGCCCCACGTGG + Intronic
900580811 1:3407821-3407843 CAACTGGCCCTGCCCCGCCTCGG + Intronic
900675932 1:3886265-3886287 CACCTTGCCCTGGACACACAGGG + Intergenic
900993937 1:6110207-6110229 GCTCTGGCCCTGGCCCCACTGGG - Intronic
901002522 1:6155667-6155689 CACGTCGTCCAGGCCCCACTCGG + Exonic
901029707 1:6299928-6299950 CAGCTGGTCCTGGCCCCCATTGG - Intronic
901067121 1:6499459-6499481 CCCCTGGTCCTGGCTCCCCTGGG + Intronic
902335086 1:15749896-15749918 CTCCTGGCCCTGTCCCTAATGGG - Intergenic
902944150 1:19822154-19822176 CACTTGGCCCAGGCTCCAGTGGG + Intergenic
904384300 1:30131515-30131537 CCTCTGGCCCTAGCCCCATTGGG + Intergenic
906240737 1:44240767-44240789 GACCAGGCCTAGGCCCCACTGGG - Intronic
906818083 1:48899592-48899614 AACCTGGATCTGGCCTCACTTGG + Intronic
912451157 1:109768554-109768576 CACCTGGCCCTGGGGCTGCTGGG + Intronic
913372654 1:118117758-118117780 AGCCTGCCCCTGGCACCACTAGG + Intronic
915905653 1:159875042-159875064 CACATGGCCCTGGAGACACTAGG + Intronic
916443094 1:164846711-164846733 CTCCTGCCCCTGCCCCAACTGGG - Exonic
917913635 1:179678017-179678039 CACCTGTCCCTGCCCCCACCTGG - Intronic
919824748 1:201495510-201495532 CACCTGGCCCAGGTACCAGTGGG + Intronic
920349472 1:205328492-205328514 CTCCTGGCCCTGCCTCCACTTGG + Intergenic
922334038 1:224604734-224604756 CACCTGGCCCAGGCGTCACTTGG + Intronic
922704533 1:227782233-227782255 GACCTTGCCCTGTCCCCTCTGGG + Intergenic
923400093 1:233608324-233608346 CAACTGGACGTGGCACCACTGGG + Intergenic
923654599 1:235904752-235904774 CAACTGTGCCTGGCCCCATTGGG + Intergenic
923838275 1:237639462-237639484 CACCTTGCCCTAGCTCCCCTAGG - Intronic
1063327816 10:5122491-5122513 CACCTGGACTTGACCACACTTGG + Intronic
1063330700 10:5156096-5156118 CACCTGGACATGTCCACACTTGG + Intergenic
1063561291 10:7130485-7130507 CACCTATCCCTGCCCCCACCTGG - Intergenic
1064741369 10:18438315-18438337 CACCGCGCCCTGCCCCCAGTTGG + Intronic
1065972652 10:30817757-30817779 CTCCTGGCCCTCTCCCCAGTGGG - Intergenic
1067398769 10:45951101-45951123 CACCTGGCCTTGGCCTCCCAAGG - Intergenic
1067867087 10:49920194-49920216 CACCTGGCCTTGGCCTCCCAAGG - Intronic
1067886238 10:50091995-50092017 CCCCTGGCCCTGCCCACAGTGGG - Intronic
1070646649 10:78206405-78206427 CACCAGTCCTGGGCCCCACTTGG - Intergenic
1070750589 10:78961863-78961885 GACCTGGCCCTGGCCACCTTTGG - Intergenic
1070811284 10:79299261-79299283 CCCCTGCCCAGGGCCCCACTCGG - Intronic
1071523778 10:86346697-86346719 CCCCAGGCATTGGCCCCACTAGG + Intronic
1071695090 10:87862509-87862531 CACCTAGCCCCGCCCCCCCTTGG - Exonic
1072295983 10:94009940-94009962 CACCTTTCCATGGCTCCACTAGG + Intronic
1072638111 10:97190290-97190312 CTCCTGGCCCTGCCACCACAGGG + Intronic
1072782097 10:98258114-98258136 CACCCGGCCCTCGCCCACCTGGG + Exonic
1073122546 10:101131521-101131543 ATGCTGGCCCTGGCCCCACCGGG - Exonic
1073136751 10:101224559-101224581 GCCCTGGGCCTGGCCCCGCTGGG - Intergenic
1074085731 10:110207932-110207954 CACCTGGGCTTGGCCCCAGCGGG - Exonic
1074776042 10:116769118-116769140 CCCCTGGCCCAGCCACCACTAGG + Intergenic
1075730116 10:124631011-124631033 TACCTGGCTCTGGCACCACCTGG - Intronic
1076379560 10:130015769-130015791 CGCCTGGCCCCAGGCCCACTGGG - Intergenic
1076505297 10:130968714-130968736 CACCAGTCCCTGGCCCCAGCAGG - Intergenic
1076717752 10:132374966-132374988 CACATGGCCTGGGCCCCACGTGG + Intronic
1076780976 10:132724408-132724430 CACCTGCCCCAGTCCCCACGCGG - Intronic
1077152293 11:1077746-1077768 GACCTGGCCCTGACCCCCCCAGG + Intergenic
1078265627 11:9754389-9754411 CACCTGATCCTCACCCCACTAGG - Intergenic
1079129847 11:17741036-17741058 CCCCAGGCCAGGGCCCCACTTGG + Intronic
1081326743 11:41754448-41754470 CACCTAACCCTGCCCCCACCTGG - Intergenic
1081567882 11:44270866-44270888 CACCCCGCCCTGGCCCCAGATGG - Intronic
1081596965 11:44466243-44466265 AGCCTGGCCCTGGCCACATTTGG + Intergenic
1081868841 11:46374247-46374269 CACCCTGCCCTGGCCTCAGTGGG - Intronic
1083441166 11:62677583-62677605 GACCTGGCTCTGGTGCCACTGGG + Exonic
1084044072 11:66559185-66559207 CCCCTGCCCCTGCCGCCACTGGG + Intronic
1084175577 11:67420688-67420710 CTCCTCGCCCAGGCCGCACTGGG - Exonic
1084225158 11:67711103-67711125 CACCTCGCCCCGCCCCCAGTAGG + Intergenic
1084262978 11:67990946-67990968 CACCTCGCCCCGCCCCCAGTAGG + Intergenic
1084810415 11:71608170-71608192 CACCTCGCCCCGCCCCCAGTAGG - Intergenic
1085122072 11:73973685-73973707 CACCTGCCCCTGCCCCAGCTAGG - Intergenic
1085388302 11:76169636-76169658 CACCTTCCCCTGACCCCACTGGG - Intergenic
1087804330 11:102539339-102539361 CACCTAACCCTGCCCCCACCTGG + Intergenic
1089921484 11:122213399-122213421 CCCCTGGCACTAACCCCACTGGG + Intergenic
1091238793 11:134039038-134039060 CGCCTGGTCCTTGCCACACTGGG - Intergenic
1095962685 12:47845222-47845244 CACCTGGCCCTGTCCCTGCCTGG + Intronic
1095978152 12:47953964-47953986 GACCTGCCCCTGGCCCCACAGGG + Intergenic
1096465497 12:51846160-51846182 TCCCTGGCCCTGCCCCCAGTGGG - Intergenic
1096842069 12:54385707-54385729 GGCCTGGCCCTGGCCCCCCAGGG + Intronic
1101475562 12:105043863-105043885 CACCTGGACCAGACCACACTAGG + Intronic
1102205978 12:111091185-111091207 CACCTGGCCCTGGCTGGAGTGGG - Intronic
1102692228 12:114770323-114770345 CACTTGGGCCTAGCCCCTCTGGG + Intergenic
1102953739 12:117046467-117046489 CACCTGGCCCCTGCCCCATGAGG + Intronic
1103096448 12:118136413-118136435 CCCCTGGCCCTGTCTCCGCTGGG - Intronic
1103743751 12:123108461-123108483 CACCGGGCCCTGCCTCGACTTGG + Intronic
1105274558 13:18906961-18906983 CACCTGGCCCAGGCACCAGCAGG - Intergenic
1105302895 13:19151549-19151571 CACCTGCCCCTCTCCCCTCTCGG - Intergenic
1105708243 13:22981954-22981976 CTCCTGCCCCGGGCCCCCCTGGG - Intergenic
1105760985 13:23514266-23514288 ATCCTGGCCCTGTACCCACTGGG + Intergenic
1106344088 13:28859179-28859201 AACCTGGTTCTAGCCCCACTAGG - Intronic
1106400575 13:29426089-29426111 CACCTGGCTCTGTCCACAATAGG + Intronic
1109981375 13:69912906-69912928 CACCTGACCTTGTCCCCACAAGG - Intronic
1113044982 13:106146131-106146153 CACTTTACCCTGTCCCCACTAGG + Intergenic
1113891041 13:113735815-113735837 CCGCAGCCCCTGGCCCCACTGGG + Exonic
1117369410 14:55062919-55062941 TGCCGGGCCCTGGCCCCACAGGG + Exonic
1117766918 14:59093030-59093052 CACCTGGCCCTGGCCCAGTGGGG - Intergenic
1117818391 14:59622046-59622068 CCACTGGGCCTGGCCTCACTTGG - Intronic
1117993759 14:61459494-61459516 GGCCTGGCCCTGGCCCACCTCGG - Intronic
1119186565 14:72646950-72646972 CAGATGGCCCTGGACACACTTGG + Intronic
1119385457 14:74255484-74255506 CAGCTGGCACTGGCTCCCCTGGG + Intronic
1119645052 14:76341975-76341997 CTCCAGGCCATGGCCTCACTGGG - Intronic
1119675097 14:76547620-76547642 GGCCTGGGCCTGGTCCCACTTGG - Intergenic
1121324016 14:93009400-93009422 CTCCTGCCCCTGTCCCAACTGGG + Intronic
1121339696 14:93098028-93098050 CACCTGGCCCAGCCCACACTTGG - Intronic
1121514847 14:94542778-94542800 CACATGGCCCTGTCCCCCCGTGG + Intergenic
1121538968 14:94711060-94711082 CACCTGCCCCCGCCCCAACTGGG + Intergenic
1121562696 14:94886754-94886776 CTCCTGGCCCCTGCCTCACTGGG - Intergenic
1122548833 14:102539264-102539286 CTCCTGGCCCTGGCCCGGGTCGG - Intergenic
1122552982 14:102560191-102560213 CCCCTGGCTCTGTCTCCACTGGG - Intergenic
1122595469 14:102887357-102887379 TCCCTGGCCCTAGCCCCACATGG - Intronic
1122768739 14:104087611-104087633 CCCCAGGTCCTGTCCCCACTCGG - Intronic
1123853747 15:24385432-24385454 CACCTGGGCTTTGCTCCACTTGG - Intergenic
1125892986 15:43279782-43279804 CTGCAGGTCCTGGCCCCACTCGG + Exonic
1126698052 15:51342066-51342088 CACCTGGCCGGGGCGCCACGGGG - Intronic
1127629717 15:60815597-60815619 CACCTGGCTCTGGCTGCAGTGGG - Intronic
1128061653 15:64739260-64739282 CACCTGGCCCAGGCCAGCCTGGG + Intergenic
1128065409 15:64761505-64761527 TACCTTGGGCTGGCCCCACTGGG - Intronic
1130086035 15:80779210-80779232 CACAGGGCCCCCGCCCCACTTGG + Intergenic
1132619259 16:856599-856621 GACCAGGCCCTGGGCCCCCTAGG - Intronic
1132674973 16:1117722-1117744 CACCTGGCCCTGGACCACCGAGG + Intergenic
1132679462 16:1133816-1133838 CCCCCGGCCCTGGCCTCTCTGGG - Intergenic
1132832479 16:1935567-1935589 CACCTGGCCCCTGCCCCCCAGGG + Intergenic
1133025777 16:2988403-2988425 CATCTGGCCAGGGCCCCACTTGG - Intergenic
1134046761 16:11106896-11106918 CACTTGGCCCAGGCCCGGCTTGG + Intronic
1135934894 16:26771337-26771359 CACTTGGCCCTGCCACCACTTGG + Intergenic
1136107506 16:28040692-28040714 CACTGGGCTCTGGCCCCTCTGGG + Intronic
1136618524 16:31412935-31412957 CACCTGGCCCCGGGCCCCCACGG - Exonic
1137550137 16:49431865-49431887 CACAGTGCCCTGGCCACACTTGG + Intergenic
1137557224 16:49478307-49478329 CCCCTGCCCCTGTCCCCACGGGG + Intergenic
1137723145 16:50639537-50639559 CACCTGCCCCCTGCCCCACCGGG + Exonic
1138111490 16:54327786-54327808 CCTCAGGCCCAGGCCCCACTTGG - Intergenic
1138344497 16:56311732-56311754 CATCCAGCCCTGGCTCCACTGGG + Intronic
1139576811 16:67847112-67847134 CACATGGCCCGGGCCCCGCGCGG - Intronic
1140913577 16:79475042-79475064 CACATGGCCTTGGCCTCACCAGG + Intergenic
1141606123 16:85154309-85154331 CACCTACCCATGGCCCCACTTGG - Intergenic
1141875170 16:86819301-86819323 AACTTGGCCCTGGCCACACTGGG - Intergenic
1142201372 16:88762566-88762588 CCTCTGGCCGTGGCACCACTGGG - Intronic
1142253071 16:89001653-89001675 CACCTGGCTGTGACCCCTCTTGG - Intergenic
1142482226 17:226100-226122 CACCTGGCCTAGTCCCCATTTGG + Intronic
1142619129 17:1154004-1154026 CACATGGCTCTGCTCCCACTCGG + Intronic
1142850094 17:2700647-2700669 AACCTGGCCCTGCCCTCGCTGGG - Intronic
1143106521 17:4533110-4533132 CACCTGTCCTTGGCCCCACAGGG - Exonic
1143612470 17:8027127-8027149 CAACTGGCCCAGTCCCCACCAGG + Intergenic
1143762090 17:9112178-9112200 GTCCTGTCCTTGGCCCCACTGGG - Intronic
1144311048 17:14014719-14014741 CCCCAGGCCCTGGCCCCTTTAGG + Intergenic
1145274322 17:21420855-21420877 CATGAGGCCCTGGCCCCAGTTGG + Intergenic
1145312182 17:21706759-21706781 CATGAGGCCCTGGCCCCAGTTGG + Intergenic
1145711547 17:26983030-26983052 CATGAGGCCCTGGCCCCAGTTGG + Intergenic
1146692025 17:34883314-34883336 CACTTAGCCCTGTCCCCACCGGG - Intergenic
1147960907 17:44167109-44167131 CACCTGGCCCTGTTCCCTCCAGG + Intergenic
1148083007 17:44977784-44977806 CTCCTACCCCTGCCCCCACTAGG + Intergenic
1148455913 17:47811258-47811280 CACTTGGCCTTGTTCCCACTTGG + Intronic
1148699560 17:49579429-49579451 GACTTGGCCCTGGCCCCACTTGG - Exonic
1149790361 17:59471398-59471420 GACCTGGTTCTGTCCCCACTGGG - Intergenic
1151193475 17:72415506-72415528 TGCCTGGTCCTGGCCCCACATGG + Intergenic
1151711341 17:75808783-75808805 CCCCTGCCCCTGGCCCCAGAAGG - Intronic
1151746533 17:76014615-76014637 CACCTGCCCCTGTCCCCACGGGG - Intronic
1152063074 17:78093686-78093708 CTCCTGGCAGTGTCCCCACTGGG + Exonic
1152133110 17:78489117-78489139 CTCCTGGCCCTGTCCCCATAGGG + Intronic
1152192956 17:78899599-78899621 CAGCTCGCCCTGGCTCCCCTGGG + Intronic
1152582288 17:81171383-81171405 GACCTGCCCCTGGCCCGCCTGGG - Intergenic
1152705488 17:81841452-81841474 CACATGTCCTTGGCCCCACACGG - Intergenic
1153688309 18:7567592-7567614 CCCCTGTCCCTGGCCCCACTCGG - Exonic
1154268287 18:12897565-12897587 CACCACGCCCGGCCCCCACTGGG - Intronic
1154415331 18:14172898-14172920 CTCCTGGCCCTGGCCCTTCCTGG - Intergenic
1154466243 18:14644210-14644232 CACCTGGCCCAGGCACCAGCAGG - Intergenic
1155785884 18:29899027-29899049 CCCGTGGCCCTGGATCCACTAGG - Intergenic
1157236231 18:45967466-45967488 CCCCTAGCCCTGGCTCCACCCGG + Intergenic
1158971161 18:62667907-62667929 GTCCTGGCCCTGTCCTCACTAGG + Intergenic
1159714826 18:71808656-71808678 CAGGTTCCCCTGGCCCCACTGGG + Intergenic
1159832702 18:73296958-73296980 GCCCTGGCCCAGGCCACACTTGG - Intergenic
1160006386 18:75072082-75072104 CGCCTGGCCCTGGGGCCACCAGG + Intergenic
1160086048 18:75778324-75778346 CTCCTGCCCCTGCCCCCACCTGG - Intergenic
1160543576 18:79638480-79638502 CACGTGGCCAAGGCCCCACCCGG - Intergenic
1160995603 19:1880762-1880784 CACCTGCTCCTGGCACCACCTGG - Intronic
1161296342 19:3522479-3522501 TACCTGGGCCTGGACCCACGTGG + Intronic
1161687077 19:5708175-5708197 CACCTGCCCCATGCCCCAGTGGG + Intronic
1161800916 19:6416374-6416396 CACCTGGGCCTGGTCCAACTGGG + Exonic
1162796082 19:13088364-13088386 CCCCTGGCCCAGGCCCCTCTGGG + Intronic
1162964847 19:14150908-14150930 CATCGGGCCCTGGCCCCTCAAGG + Exonic
1162976166 19:14207920-14207942 AACCTGCCCCTCGCCTCACTTGG - Intergenic
1163177367 19:15573679-15573701 CACCTTCCCCTGGCCCCAGAAGG - Intergenic
1163573511 19:18097641-18097663 CACAGGGCCCCGCCCCCACTGGG - Intronic
1163607588 19:18283543-18283565 CACCTGGCTCTGCCCCCAACTGG + Intergenic
1164417712 19:28060248-28060270 CACCTGGGCCTGTCCACATTAGG - Intergenic
1164722791 19:30444539-30444561 GCCCTGGCCCTGGGCCGACTCGG - Exonic
1164837476 19:31366610-31366632 CACCTGGTGCTGGGCACACTAGG + Intergenic
1165076273 19:33281525-33281547 CACCTGCAACTGGCACCACTTGG - Intergenic
1165763705 19:38337031-38337053 CTCCTGGCCCTGCCCCCGCACGG - Intronic
1166048807 19:40245872-40245894 GCCCTGGCCCTGGGGCCACTTGG - Intronic
1166104148 19:40589404-40589426 AACCTGGCCCTGCCTGCACTGGG - Intronic
1166137776 19:40787614-40787636 ACCCTGGCCCTGACCCCCCTGGG - Intronic
1166546326 19:43636451-43636473 CACCTGCCCCTTGCCCCACTGGG + Intronic
1166694391 19:44844595-44844617 CTCCTGGCCCTGGACGAACTTGG + Intergenic
1166768151 19:45264803-45264825 CACCTGACCCTGACCCCGCTCGG + Intronic
1166854868 19:45778405-45778427 CTCCAGGCCCTGGCCTCTCTGGG + Intronic
1166943677 19:46384170-46384192 CACCTGGCACTGGCCACACTTGG + Intronic
1166976074 19:46605723-46605745 CACGTGGAGCTGGCCTCACTGGG + Intronic
1166998314 19:46730331-46730353 TCCCTGGCCCTGGCCACTCTGGG - Intronic
1167001149 19:46746341-46746363 GCGCGGGCCCTGGCCCCACTGGG - Exonic
1167036930 19:47000264-47000286 CACCTGGCCCTGGGCGCTCATGG - Intronic
1167093225 19:47359006-47359028 AAACTGGCACTGCCCCCACTAGG - Intronic
1167423554 19:49417554-49417576 CCCCTGGCCCTCTCTCCACTGGG + Exonic
1167512118 19:49900932-49900954 CACCTGGCCCTGGCCCCACTGGG + Intronic
1168407526 19:56118705-56118727 CACCTGGCACAGTCCTCACTAGG + Intronic
925907752 2:8549449-8549471 CACCTGGCCCTGGCCTCCGTGGG + Intergenic
927862374 2:26568193-26568215 CTCTTGGCCCTGTCCCCACAGGG + Intronic
928300874 2:30122586-30122608 CACCCCTCCCTGTCCCCACTAGG + Intergenic
928330119 2:30351320-30351342 GGCCTGGCCCTGGCCCAGCTGGG + Intergenic
928364664 2:30691805-30691827 CAACAGGCCCAGGCCACACTGGG + Intergenic
929454044 2:42054066-42054088 CACCTGGCCCACTCCCCACTGGG + Exonic
929602402 2:43212651-43212673 CACCCAACCCTGGCCCCACCGGG - Intergenic
932046646 2:68356824-68356846 CCCCAGGCCCATGCCCCACTAGG - Intergenic
932189725 2:69730620-69730642 CACCTGGGCCTGCCTCCACATGG + Intronic
932790959 2:74654293-74654315 CTACTGGCCTCGGCCCCACTCGG - Exonic
933184064 2:79259477-79259499 CACATGGCCCTACCCACACTAGG - Intronic
935823017 2:106913424-106913446 CACTTGGCCCTTGCCACCCTGGG - Intergenic
936083214 2:109449258-109449280 CACCAGCCTCAGGCCCCACTCGG + Exonic
936093435 2:109515152-109515174 CTCCTGGCCCTGGCCGCCATTGG - Intergenic
937086222 2:119173723-119173745 CACTTGGGCCAGGCCTCACTAGG + Intergenic
937936474 2:127249399-127249421 CACTTGGACCTGCCCCCGCTGGG + Intergenic
937990075 2:127657296-127657318 GACCTGGCCCTGTCACCAGTCGG + Intronic
940188533 2:151013850-151013872 CCTCTGGGCCTGGCCCCACAGGG + Intronic
940798609 2:158107567-158107589 CACCTGCCTCTTGACCCACTGGG - Intronic
941874430 2:170418696-170418718 CCCCTGGCCCTGGGCCACCTGGG + Intronic
946159238 2:217826039-217826061 CACCTGGCCCTGCCCTCACCGGG + Intronic
946516313 2:220415090-220415112 CACCTTGTCCTGGTCCCAATTGG + Intergenic
946707869 2:222476375-222476397 CAACTGCCCCTGGCTCCACCTGG + Intronic
947733059 2:232441588-232441610 GACCTGGGCCGGGCCCCCCTGGG + Intergenic
948832122 2:240603254-240603276 CGTCAGGCCCTGGCCCCCCTTGG - Intronic
949059984 2:241951200-241951222 CACACGGCCCTAACCCCACTCGG - Intergenic
1168893637 20:1309538-1309560 CACCTCCCCCTGCCCCCACATGG + Intergenic
1170714969 20:18823651-18823673 CACCAGGCCCTGCCCGCAGTAGG - Intronic
1170727251 20:18941228-18941250 CACCTGGCAGGGGCCCCTCTGGG - Intergenic
1171198532 20:23222933-23222955 CATATGGCCCTGCCCCTACTTGG + Intergenic
1171213057 20:23331681-23331703 CACCTCAGCCTGGCCCCGCTGGG + Intergenic
1171463063 20:25309644-25309666 CTCCTGGCCCTGGGCCCCCTTGG - Intronic
1172092822 20:32446017-32446039 CACTCGGCCCTGGCTCCCCTGGG + Exonic
1173009107 20:39165288-39165310 CTCCTGGCTCTGGCCCCAAAGGG + Intergenic
1173874135 20:46359106-46359128 CTCCAGGACCTGGCCCCACTGGG + Intronic
1174159583 20:48541387-48541409 CACCTGTCCCTGTCCCCCATGGG + Intergenic
1174163099 20:48565497-48565519 CACCTGGCCCTGGCGTGACTAGG - Intergenic
1175317864 20:58064315-58064337 TACATGACCCTGGCACCACTGGG - Intergenic
1175545028 20:59772667-59772689 CCCCTGGGGGTGGCCCCACTCGG - Intronic
1175941307 20:62538750-62538772 CTGCTGGCCCTGCCCTCACTCGG + Intergenic
1176059311 20:63165375-63165397 CACCTGGGCCTGGCCCTCATGGG + Intergenic
1176234512 20:64048263-64048285 CACGTGGCACTGGCCAAACTGGG - Exonic
1176330595 21:5545746-5545768 AGCCTGGCCCTGCCCTCACTGGG + Intergenic
1176369141 21:6052097-6052119 CAGCTGGCCCCGGGCCCACTAGG - Intergenic
1176397162 21:6275205-6275227 AGCCTGGCCCTGCCCTCACTGGG - Intergenic
1176423288 21:6532985-6533007 CAGCTGGCAGTTGCCCCACTGGG - Intergenic
1176439995 21:6713899-6713921 AGCCTGGCCCTGCCCTCACTGGG + Intergenic
1176464257 21:7040968-7040990 AGCCTGGCCCTGCCCTCACTGGG + Intergenic
1176487818 21:7422747-7422769 AGCCTGGCCCTGCCCTCACTGGG + Intergenic
1176808345 21:13514386-13514408 CACCTGGCCCAGGCACCAGCAGG + Intergenic
1177174431 21:17689147-17689169 CACCCAGCCCTGCCCCCACCTGG - Intergenic
1177445037 21:21183565-21183587 CACCTGGCCATGGCAGTACTTGG + Intronic
1179238158 21:39565559-39565581 CACCTGTGCCTGGTCTCACTTGG + Intronic
1179406751 21:41132603-41132625 CACCTGGGCCCAACCCCACTGGG + Intergenic
1179698781 21:43141301-43141323 CAGCTGGCAGTTGCCCCACTGGG - Intergenic
1179754378 21:43486444-43486466 CAGCTGGCCCCGGGCCCACTAGG + Intergenic
1180146059 21:45919705-45919727 CACCAGTGCCTGACCCCACTAGG + Intronic
1180676537 22:17590295-17590317 CACCTGCCCTTGCCCCCTCTAGG - Exonic
1180868548 22:19133445-19133467 CTGCTGGCCCTGGCCTCACCTGG - Exonic
1181061328 22:20283459-20283481 AGCCTGGCCATGGCCCCACCTGG - Intergenic
1181121551 22:20670836-20670858 CACCAGGCCCCGGCCCCACCAGG + Intergenic
1182198676 22:28546243-28546265 CACTTGGGCCTGGCCCAACATGG + Intronic
1183201303 22:36387436-36387458 CGCCTCGCCCAGGCCCGACTCGG - Intronic
1183414571 22:37675115-37675137 CCACAGGCCCTGGCCCCACCCGG - Intergenic
1183654059 22:39175028-39175050 TACCTGACCCTGGCCCCCCGGGG + Intergenic
1183811746 22:40263455-40263477 CACCTAGGCCTGGCTACACTCGG - Intronic
1184164335 22:42718985-42719007 CACCTGGCCACGGGGCCACTGGG - Intronic
1184216370 22:43070033-43070055 CTCCTGGCCCTCACACCACTTGG - Intronic
1184468659 22:44683509-44683531 CACCTGGCCCTGGCCCCAAGGGG - Intronic
1184473425 22:44708348-44708370 CACCTAGCCCTGGCCCCAGCTGG - Intronic
1184507047 22:44910172-44910194 CACCCCGCCCTGGACCCCCTGGG - Intronic
1185118632 22:48952470-48952492 CACCTGGCCCAGCCCCCACTCGG + Intergenic
1185149121 22:49154193-49154215 CCCCAGGCCCTGGCCTTACTGGG - Intergenic
1185299153 22:50070467-50070489 GGCCAGGCCCTGGCCCCGCTCGG + Intronic
1185301149 22:50081795-50081817 CGCCCAGCCTTGGCCCCACTCGG - Intronic
950098908 3:10345574-10345596 CTCCTGTCCCTGTCCCCACAGGG - Exonic
950678772 3:14570419-14570441 CCCCTGGTCCTGGCCCCAGCTGG - Intergenic
952957662 3:38567032-38567054 CCCGTGGCACAGGCCCCACTTGG - Intronic
953493721 3:43369531-43369553 CCCATGGCCGTGGCCCAACTTGG - Intronic
953735162 3:45487817-45487839 CAGCAGGCCTTGGCCCCCCTGGG + Intronic
954041755 3:47893303-47893325 CGCCTGTCCCTGCCCCCACTTGG + Intronic
954752213 3:52820028-52820050 CACCTTCCTGTGGCCCCACTTGG + Intronic
955175622 3:56611184-56611206 CACCTAGCCCCGCCCCCACCTGG - Intronic
955552093 3:60096075-60096097 CACCCTGCCCAGGCCTCACTCGG + Intronic
956195480 3:66649882-66649904 CTCCTGGCCCAGGCCCCATCTGG - Intergenic
956454537 3:69407878-69407900 CAGCTAGCCCTGGCTCCACGAGG - Intronic
956681322 3:71784814-71784836 CACCTGCCCCTGTCGCCCCTTGG - Intronic
959279786 3:104323504-104323526 TGCCTAGCCCTGCCCCCACTTGG + Intergenic
960064367 3:113354663-113354685 CACCTATCCCTGCCCCCACCTGG + Intronic
960973563 3:123155855-123155877 CAGCCTGCCCTGGCCCCACCTGG - Intronic
961356558 3:126343387-126343409 GACCTGGCCCTTCTCCCACTGGG - Exonic
961490565 3:127254255-127254277 CACCAGGACCTGCCCCCACGTGG + Intergenic
961514203 3:127422787-127422809 GACCTGGTCCTGGCCCCCTTGGG - Intergenic
961827590 3:129606893-129606915 CGCCTGCCCCTGGCCGCCCTGGG + Intergenic
961953038 3:130770655-130770677 TGCCTAGCCCTGGCCCCACCAGG + Intergenic
962530718 3:136277531-136277553 CACCTGACCCAGCCCCCACCTGG - Intronic
963041321 3:141072047-141072069 CATCTGGACTTGGCCCCTCTGGG + Intronic
964256113 3:154776391-154776413 TACCTGTCCCTCTCCCCACTAGG - Intergenic
965296646 3:166955609-166955631 CACCTATCCCTGCCCCCACCTGG - Intergenic
965515743 3:169619420-169619442 CACCTGGCCCTTCCCCTCCTGGG + Intronic
965602616 3:170469945-170469967 GACCTGTCCCTGCCCCCACAAGG + Intronic
966553414 3:181230627-181230649 CACCTAGCCCTGCCCCCAGCTGG - Intergenic
968120827 3:196124703-196124725 CATCTGGCAGTGGCCCCATTAGG + Intergenic
968886465 4:3336608-3336630 GACATGGTCCTTGCCCCACTGGG + Intronic
969021488 4:4142862-4142884 CACCTCGCCCCGCCCCCACTGGG + Intergenic
969732378 4:8964555-8964577 CACCTCGCCCCGCCCCCAGTGGG - Intergenic
969849247 4:9943485-9943507 CCCCTGTCCCTGGCCCTCCTGGG - Intronic
972818046 4:42666532-42666554 CACCTAGTCCTGGCCCCTTTTGG + Intergenic
974474438 4:62361513-62361535 CACCTAGCCCTGCTCCCACCTGG - Intergenic
976037961 4:80847244-80847266 GACCAGGCTCTGGCCCCAGTGGG + Intronic
976113533 4:81702083-81702105 CACCTGGCACTGTCCTCACAGGG + Intronic
978681737 4:111389100-111389122 CACCTGGCCCTTCCTCCATTTGG + Intergenic
979553049 4:122012956-122012978 CAGCCAGCCCTGCCCCCACTAGG - Intergenic
980667057 4:135954003-135954025 CACTTGGCCCTTGCCACACAGGG - Intergenic
981599165 4:146466381-146466403 CCCCTGGAAGTGGCCCCACTTGG + Intronic
983737314 4:171078081-171078103 CACCTTGACCTGGGCACACTGGG + Intergenic
984700106 4:182813783-182813805 CACCCGGCCCTGGCCCACCCTGG - Intergenic
985510011 5:308119-308141 CACGTGGCCCTGGCCGCAATCGG - Intronic
985558428 5:569472-569494 CCCCGGGGCCTGGCCCCACCTGG - Intergenic
985727519 5:1523889-1523911 CAGCTAGCCCCGGCCCCGCTCGG - Exonic
985829893 5:2220581-2220603 GACCAAGCCCTGGCCCCACAAGG + Intergenic
987005982 5:13709838-13709860 CACCTAGCCTTGCCCCTACTTGG + Intronic
988889466 5:35599073-35599095 CACCTAACCCTGCCCCCACCTGG + Intergenic
991488196 5:67159671-67159693 CACCTGCCCTGGGCCCCCCTCGG + Intronic
991943042 5:71873277-71873299 CATCTGGCCTTAGCCCAACTGGG - Intergenic
994145268 5:96387857-96387879 CACCTGTCACTGGGGCCACTAGG + Intergenic
996141334 5:119913315-119913337 CACCTAAACCTGCCCCCACTTGG - Intergenic
996407438 5:123119540-123119562 TGCCTGGCCCTGCCCCCTCTTGG + Intronic
997233039 5:132257611-132257633 CGCCCGCCCCTGTCCCCACTCGG - Intronic
997442260 5:133917136-133917158 CAGCAGGCCCTGGCCCACCTAGG + Intergenic
999194909 5:149775198-149775220 CAGCTGCCTCTGCCCCCACTGGG - Intronic
1001048042 5:168390718-168390740 CACCTGGCCTTGGCTGCTCTGGG + Intronic
1001387639 5:171353185-171353207 CACCTGGCCCAGGCCCCAGAGGG + Intergenic
1001546923 5:172576013-172576035 CACATGGCACTAGCCCCACAGGG + Intergenic
1001643866 5:173265493-173265515 CACCTGGCAGGGGCCCCTCTGGG + Intergenic
1002576634 5:180177615-180177637 GACATGGCCCTGGTGCCACTTGG + Intronic
1002606940 5:180389256-180389278 CAGCTGGCCCTTCCCCCACCTGG + Intergenic
1003107425 6:3227332-3227354 CTCCTAGCCCAGGCCACACTCGG + Intronic
1005221296 6:23591872-23591894 CACCAGGCCCTGCCAACACTGGG - Intergenic
1006084755 6:31587821-31587843 TGCCTGGCCCTGGAGCCACTGGG + Intronic
1007242426 6:40436647-40436669 CACCTTACCCAGGCCCCACCAGG + Intronic
1007274659 6:40664388-40664410 CACCTGCCTCTGGCCCCAGACGG - Intergenic
1007390420 6:41547100-41547122 CCCCTGGCCCGGGCCCCAGCGGG + Intronic
1007848461 6:44780444-44780466 GTCCTGCCCCTGGCCCAACTGGG - Intergenic
1009610291 6:65931602-65931624 CACCTGCCCCTGGACCCCCAAGG + Intergenic
1011770123 6:90666380-90666402 CACCTGGCCCTGTCCCAGCAAGG + Intergenic
1013652213 6:112207025-112207047 CCCCTGTCCCCTGCCCCACTTGG - Exonic
1015493505 6:133855068-133855090 CACCTGCTCCTGGCCCCAGGGGG + Intergenic
1018733970 6:166673525-166673547 CACCTGGCCCTGAGCCCATGGGG + Intronic
1019327165 7:444164-444186 CACCTGTCCCTGGAGCCACTGGG - Intergenic
1019340053 7:504631-504653 CACCTGCCCCATGCCTCACTTGG - Intronic
1019388231 7:770649-770671 CCCCTGGCCCAGGCCCCAGCTGG - Intronic
1019412861 7:914217-914239 CACCTGGCCCAGGCCTCACCTGG + Intronic
1019509911 7:1412643-1412665 CACCTGGCCCATAGCCCACTTGG - Intergenic
1019732271 7:2634683-2634705 GACCTGGCCCTGGTCCCTCCGGG - Intronic
1020308910 7:6854891-6854913 CACCTCGCCCCGCCCCCAGTGGG + Intergenic
1021321920 7:19223062-19223084 CCCCTGCACCTGGCCCCAGTAGG + Intergenic
1023768892 7:43536743-43536765 CACCAGGCCCTGGCTGCCCTAGG + Intronic
1025007025 7:55363206-55363228 CTCCTGTCTCAGGCCCCACTTGG + Intergenic
1025143433 7:56484237-56484259 CACCTCGCCCTTGTCCAACTCGG + Intergenic
1025259067 7:57405066-57405088 CACCTCGCCCTTGTCCAACTCGG + Intergenic
1026494504 7:70890757-70890779 CACCTGGCTTGGGCCTCACTCGG - Intergenic
1026878498 7:73893589-73893611 CACCTGGCCCTGGCCCAGCCTGG + Intergenic
1028240137 7:88410080-88410102 CACCGCGCCCGGCCCCCACTGGG - Intergenic
1029125852 7:98294885-98294907 CACCTGGCCCTGGCTCGCCCTGG - Intronic
1029381930 7:100220461-100220483 CCCCTCGCCCCGGCCCCACCTGG - Exonic
1029849159 7:103445295-103445317 CACCTGGGCCGGGCCCCGCCGGG - Intronic
1030127443 7:106168144-106168166 CACCTGGCCCTGGGCCCTGGTGG + Intergenic
1032013176 7:128359981-128360003 TGCCTGGCCATGGCCCCACCTGG + Exonic
1032081079 7:128858757-128858779 CCCCTGAGCCTGGCCCCAGTCGG - Exonic
1032196199 7:129790002-129790024 CAGCTGGCCCTGGCCTATCTTGG + Intergenic
1034489276 7:151384730-151384752 CACATGGCTTTGGCCTCACTTGG - Intronic
1034490094 7:151388570-151388592 CTCCTGGCTCTGTCCCCACCTGG + Intronic
1035627962 8:1088074-1088096 CAGCTGGGCTTGGCCCCACAGGG + Intergenic
1035735148 8:1882207-1882229 CAGCTGGCCATGCCCCCACATGG + Intronic
1037820984 8:22134395-22134417 GTCCTGGCCCCTGCCCCACTTGG - Intergenic
1038870689 8:31489966-31489988 CACCTGGCCCTGCCAGCCCTGGG + Intergenic
1039671229 8:39601291-39601313 CACCTGGCCCCTGCCACATTGGG - Intronic
1047200011 8:122757234-122757256 AAGCTGGCCCTGGCCACACTGGG + Intergenic
1047720203 8:127632021-127632043 CACATGGCCCTGGCCTCTTTGGG - Intergenic
1048801425 8:138197708-138197730 CACCTGGCCCAGGCAGCACAGGG + Intronic
1049133581 8:140872527-140872549 CACCTGCCCCTGGACTGACTGGG + Intronic
1049445337 8:142627893-142627915 CACCTGGCCCAGCCCCCACCGGG + Intergenic
1049751853 8:144288689-144288711 CAGCTGGGCCTGACCCCACAGGG - Intronic
1049949188 9:627845-627867 CATCTGGCCCTAGCCCTATTTGG - Intronic
1050924108 9:11241527-11241549 GCACTGGCCCTGGCCCCACCTGG - Intergenic
1053009208 9:34623845-34623867 CTCCCGCCCCTGGCCTCACTGGG + Exonic
1055969823 9:81900615-81900637 CACCTGGTCCTGCCCCCACACGG - Intergenic
1057005408 9:91553327-91553349 CACCTTGCCCTGTCCCAGCTGGG - Intergenic
1057548860 9:96037640-96037662 TCCCTGGCCCTGCTCCCACTTGG - Intergenic
1058959513 9:109979432-109979454 CACCTGTCTCTTACCCCACTGGG + Intronic
1060157437 9:121329402-121329424 CACCTGGCACTGCCCCCTTTAGG - Intronic
1060966527 9:127715046-127715068 GACCTCGCCCTGGCCCCGCTGGG - Exonic
1061493221 9:130957538-130957560 CACCGGGACCTGGCCCCATAGGG - Intergenic
1061856295 9:133443558-133443580 CACCTAGCCCTGGGCTCACCTGG - Exonic
1062026004 9:134341093-134341115 CACCTCTCCCTGTCCCCACCAGG - Intronic
1062041280 9:134405364-134405386 CACCGGGCCCTGGGCTCACTGGG + Intronic
1062242940 9:135549618-135549640 CCCCTGCACCTGTCCCCACTCGG + Exonic
1062361266 9:136189417-136189439 CACCGAGCCCTGACCCCACCGGG - Intergenic
1062451243 9:136616650-136616672 CACCTGGCCCTGGCCCTGGAGGG - Intergenic
1062467678 9:136688201-136688223 CACCTGGCCCGGCCCCCACCCGG + Intergenic
1062570548 9:137183092-137183114 CAGCTGGCCCAGGAGCCACTGGG - Intronic
1203431500 Un_GL000195v1:94580-94602 AGCCTGGCCCTGCCCTCACTGGG - Intergenic
1186473277 X:9837649-9837671 CACCTGGTGCTGTCTCCACTTGG - Intronic
1186622100 X:11252388-11252410 CTCTTGGCCCGGGCCCCACATGG + Intronic
1188311737 X:28625568-28625590 CACCTGGCTCTCTGCCCACTGGG - Intronic
1190255920 X:48762084-48762106 CACCTGTCCCTGGCTAAACTGGG - Intronic
1190323040 X:49189434-49189456 TACCTGACCTTGCCCCCACTGGG + Intronic
1192454101 X:71263174-71263196 CACCATGCCCAGCCCCCACTGGG - Intergenic
1194011820 X:88570692-88570714 CACCTGGCCCTGGACCCAATGGG + Intergenic
1197184411 X:123570513-123570535 CACCTAACCCTGCCCCCACCTGG + Intergenic
1198105017 X:133453909-133453931 CACCGCGCCCTGCCCCCAATAGG + Intergenic
1198604539 X:138322408-138322430 CACCTATCCTTGCCCCCACTTGG - Intergenic
1199952820 X:152718897-152718919 AATCTGGCCCTGGACCCACCGGG - Intergenic
1199956863 X:152749551-152749573 AATCTGGCCCTGGACCCACCGGG + Intergenic
1200067290 X:153509934-153509956 CACCCTGCCCTGGCTCCATTGGG - Intergenic
1200951452 Y:8903051-8903073 AACCTGTCCCTGGCCCCAGGAGG - Intergenic
1201904585 Y:19076638-19076660 CACCTGCCCAGGGCCCCCCTCGG + Intergenic