ID: 1167512119

View in Genome Browser
Species Human (GRCh38)
Location 19:49900933-49900955
Sequence ACCTGGCCCTGGCCCCACTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 432
Summary {0: 1, 1: 0, 2: 6, 3: 47, 4: 378}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167512111_1167512119 29 Left 1167512111 19:49900881-49900903 CCACAATGATGGTTTCGATGAGG 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1167512119 19:49900933-49900955 ACCTGGCCCTGGCCCCACTGGGG 0: 1
1: 0
2: 6
3: 47
4: 378

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167512119 Original CRISPR ACCTGGCCCTGGCCCCACTG GGG Intronic
900001091 1:15233-15255 CCCTGGCCCTGGCCCCGAGGTGG - Intergenic
900020806 1:185754-185776 CCCTGGCCCTGGCCCCGAGGTGG - Intergenic
900291045 1:1923722-1923744 GCCCGGCCCTGGCCCCACGCAGG - Intronic
900292343 1:1928866-1928888 ACCTGGACCAGGCACCTCTGAGG + Exonic
900331037 1:2134767-2134789 GCCTGGCCCAGGCTCCACTGTGG + Intronic
900407190 1:2497924-2497946 CCCTGTGCCTGGCCCCTCTGTGG + Intronic
900438924 1:2643817-2643839 ATCCTGCCCAGGCCCCACTGGGG + Intronic
901732487 1:11290281-11290303 CCCTGGCTCTGGCCCCACAGAGG - Intronic
902335085 1:15749895-15749917 TCCTGGCCCTGTCCCTAATGGGG - Intergenic
902606899 1:17573906-17573928 ACTTGGCCCCTGCCCCAGTGAGG + Intronic
902613438 1:17610324-17610346 GCCTGGCCCTGGGACCTCTGGGG + Intronic
904207478 1:28864387-28864409 TCCTGTCCCAAGCCCCACTGTGG - Intergenic
905973057 1:42155485-42155507 ACCTGAACCTGGGCCCTCTGTGG - Intronic
906193013 1:43910839-43910861 ATCTGCCCTGGGCCCCACTGTGG + Intronic
907527531 1:55062722-55062744 ACTTGGCCCTGTCCCCTCTGAGG - Intronic
912442381 1:109709217-109709239 ACCTGGCCCTGGCAAATCTGTGG + Intronic
912451158 1:109768555-109768577 ACCTGGCCCTGGGGCTGCTGGGG + Intronic
912543441 1:110433948-110433970 GCCTGCCCCTGCCCCCACTGTGG - Intergenic
915584647 1:156837794-156837816 ACCTTGCCCTTGGCCCAGTGTGG - Intronic
915597778 1:156905251-156905273 GCCTCCCCCTGGCCACACTGTGG + Intronic
915646670 1:157277503-157277525 ACCAGGCCGTGCCCCCTCTGCGG - Intergenic
915994693 1:160550681-160550703 ACCTGGAGCCGGGCCCACTGTGG + Intronic
916443093 1:164846710-164846732 TCCTGCCCCTGCCCCAACTGGGG - Exonic
918005089 1:180534520-180534542 CCCAGGCCCTGGCACCAGTGAGG - Intergenic
920491034 1:206415497-206415519 ACCCTGCCCTGGCCCCTCGGTGG - Intronic
920627753 1:207619569-207619591 ATCTAGCCCTGGAGCCACTGGGG - Intronic
921925587 1:220707694-220707716 ACCTGTCCCTGCCCTCACAGAGG - Intergenic
922571271 1:226635881-226635903 GCCTTCCTCTGGCCCCACTGAGG - Intronic
922704534 1:227782234-227782256 ACCTTGCCCTGTCCCCTCTGGGG + Intergenic
922718919 1:227890511-227890533 AGCTGCCCCAGGGCCCACTGAGG + Intergenic
923147913 1:231210535-231210557 GCCTGGACTTGGCCCCTCTGTGG - Intronic
923400094 1:233608325-233608347 AACTGGACGTGGCACCACTGGGG + Intergenic
1062856363 10:781363-781385 ACCTGGGCCTGGGGCCTCTGTGG + Intergenic
1063623332 10:7667550-7667572 TCCTGTCCCTGTCCCCACCGAGG + Intergenic
1063909459 10:10814644-10814666 AGCTGGCCCTGGGCCAAATGAGG + Intergenic
1065972651 10:30817756-30817778 TCCTGGCCCTCTCCCCAGTGGGG - Intergenic
1067037728 10:42932343-42932365 ACCTGGCCGAGGCCTCACTGTGG + Intergenic
1068989214 10:63133642-63133664 GGCAGGCCCTGGCCCAACTGCGG + Intronic
1070149437 10:73796968-73796990 GGCTGGGCCAGGCCCCACTGAGG + Exonic
1070625715 10:78049683-78049705 ACCTTGCACTAGCACCACTGTGG - Intronic
1070782997 10:79148254-79148276 GCCTGGCCCTGGGCCCACCCTGG - Intronic
1072638112 10:97190291-97190313 TCCTGGCCCTGCCACCACAGGGG + Intronic
1073122545 10:101131520-101131542 TGCTGGCCCTGGCCCCACCGGGG - Exonic
1073454704 10:103629535-103629557 GCCTGACCTTGGCCCCAGTGTGG - Intronic
1074085730 10:110207931-110207953 ACCTGGGCTTGGCCCCAGCGGGG - Exonic
1075074470 10:119341588-119341610 TGCTGCCACTGGCCCCACTGTGG + Intronic
1075730115 10:124631010-124631032 ACCTGGCTCTGGCACCACCTGGG - Intronic
1076115249 10:127891113-127891135 ACCTGGCCCTGGGCCCCTTCAGG + Intronic
1076212253 10:128658018-128658040 ACCTGGGGCTGGCTCTACTGCGG + Intergenic
1076536486 10:131181176-131181198 TCCAGGCCTTGGCTCCACTGTGG - Intronic
1076597130 10:131630799-131630821 ACCAGGCACTGGCCACCCTGTGG - Intergenic
1076732686 10:132446415-132446437 CCCTCGCCCTGGCCCCACCACGG - Intronic
1076771730 10:132669820-132669842 CCGTGTCCCTGTCCCCACTGTGG + Intronic
1077114126 11:875412-875434 CCCTGCACCTGGCCCCATTGGGG + Intronic
1077473395 11:2775344-2775366 ACATGGCCCCAGCCCCACTGTGG + Intronic
1078003865 11:7517932-7517954 ACCAGGCCGTGCCCCCTCTGCGG - Intronic
1082878649 11:58015260-58015282 TCCTGAACCTGGCCTCACTGTGG - Intergenic
1083441167 11:62677584-62677606 ACCTGGCTCTGGTGCCACTGGGG + Exonic
1083740764 11:64710547-64710569 ACCGGTCCCTGGCCTCACTGTGG - Intronic
1083755423 11:64789422-64789444 CCCAGGCCCTGGCCCTGCTGGGG - Exonic
1083993841 11:66262501-66262523 AGCAGGCACTGGCCCCATTGTGG - Intronic
1084493114 11:69488934-69488956 AGGTGGCTTTGGCCCCACTGTGG - Intergenic
1084717028 11:70880567-70880589 ACATGCCCCTGGCCTCACAGAGG - Intronic
1086445383 11:86865685-86865707 TCCTGGCTTTGGTCCCACTGAGG + Intronic
1088282577 11:108150536-108150558 ACCTGACCCCGCCCCCAGTGGGG - Intergenic
1088480953 11:110296303-110296325 AGCTGGCCGAGGCGCCACTGTGG - Intronic
1088887574 11:114019848-114019870 ACTTGGCCTTGGCCACACAGTGG - Intergenic
1089697618 11:120225765-120225787 GCTTGGCCATGGCCTCACTGGGG - Exonic
1090831188 11:130421928-130421950 ACGGGGTCCTGGCCCCCCTGAGG + Intronic
1091374180 12:15348-15370 CCCTGGCCCTGGCCCCGAGGTGG - Intergenic
1093084164 12:14848201-14848223 ACCAGGCCCGGCTCCCACTGAGG + Intronic
1096298429 12:50404397-50404419 ACCTGGCCTTGGGCCCAATGTGG + Intronic
1096550733 12:52370072-52370094 CCCTGGCCCTGGACCACCTGGGG - Intergenic
1096834448 12:54340463-54340485 ACCTTCCCCTAGTCCCACTGGGG - Exonic
1096842070 12:54385708-54385730 GCCTGGCCCTGGCCCCCCAGGGG + Intronic
1097288930 12:57897721-57897743 ACCTGCACCTGGCCCCCCTACGG - Intergenic
1101570771 12:105951661-105951683 ACCTGGATCTGGCCCCAGTGAGG + Intergenic
1102179882 12:110904526-110904548 ACCTGGGCCTGGGGGCACTGTGG - Intronic
1102439274 12:112948989-112949011 CCCAGCTCCTGGCCCCACTGGGG + Exonic
1102454371 12:113062789-113062811 GCCAGGCTCTGGCCCCACAGGGG + Intronic
1102692229 12:114770324-114770346 ACTTGGGCCTAGCCCCTCTGGGG + Intergenic
1103716744 12:122949561-122949583 GCCTGGCCTGGGCCCCACAGAGG + Intronic
1104055248 12:125225114-125225136 AACTGGACCTCGCCACACTGTGG - Intronic
1104965032 12:132505171-132505193 ACCTGGCACAGACCTCACTGCGG + Intronic
1105017402 12:132794094-132794116 ACCTGCCCCTGGTCCCACAGCGG + Intronic
1107069709 13:36256735-36256757 TCTTGGCCCTGGCCTCTCTGTGG + Intronic
1108431143 13:50355036-50355058 TCCTGGCCCTGTGCCTACTGTGG + Intronic
1110117144 13:71833209-71833231 ACCTGCCCCAGGACCCACTGAGG + Intronic
1111255585 13:85663050-85663072 ACCTGGGCCCAGTCCCACTGGGG - Intergenic
1113752168 13:112784009-112784031 TCCAGGCTCTTGCCCCACTGTGG - Intronic
1113891042 13:113735816-113735838 CGCAGCCCCTGGCCCCACTGGGG + Exonic
1117766917 14:59093029-59093051 ACCTGGCCCTGGCCCAGTGGGGG - Intergenic
1119406786 14:74403894-74403916 ACCTGGCCCTGCCTGCGCTGTGG - Intergenic
1119728245 14:76935301-76935323 TCCTGGCTCTGGCCTCTCTGTGG - Intergenic
1121562695 14:94886753-94886775 TCCTGGCCCCTGCCTCACTGGGG - Intergenic
1121687195 14:95845316-95845338 CCCCAGCCCAGGCCCCACTGTGG + Intergenic
1122059067 14:99124625-99124647 CCCTGCCCCAGACCCCACTGTGG + Intergenic
1122156999 14:99755858-99755880 GCCTGGCCCTGGACCCACCCTGG + Intronic
1122165868 14:99823314-99823336 GCCTTGCCCTGGCCGCACTGTGG + Intronic
1122552980 14:102560190-102560212 CCCTGGCTCTGTCTCCACTGGGG - Intergenic
1122595467 14:102887356-102887378 CCCTGGCCCTAGCCCCACATGGG - Intronic
1122901697 14:104784726-104784748 ACGTGTCCCAGGCCACACTGTGG + Intronic
1123039825 14:105485954-105485976 TGCTGGCCCTGTCCCCGCTGGGG - Intergenic
1123115247 14:105891510-105891532 GCCTGGCCCTGGACCCCCTCAGG + Intergenic
1124134514 15:27022400-27022422 ATTTGGCCCTGGGCCCCCTGAGG - Intronic
1124550892 15:30680495-30680517 TCCTGGCCTTGGCCCCTCTTTGG + Intronic
1125745506 15:41994897-41994919 ACCTCACCCTGGCCTCCCTGTGG + Intronic
1127629716 15:60815596-60815618 ACCTGGCTCTGGCTGCAGTGGGG - Intronic
1127896372 15:63303257-63303279 ACCAGTCACTGCCCCCACTGAGG + Intronic
1127896490 15:63304252-63304274 ACCAGTCCCTGCCCCCACTGAGG - Intronic
1128750493 15:70145436-70145458 AGCTGCCCCTGGCCCCCTTGTGG - Intergenic
1128796845 15:70472495-70472517 ACCTGGCCCTGGGGTGACTGGGG - Intergenic
1129331523 15:74830293-74830315 ACAAGGCCCAGGCCACACTGGGG + Exonic
1129460304 15:75697080-75697102 ACCCGGCCCTGGCCTGGCTGGGG - Intronic
1131048886 15:89333698-89333720 AACCGGCCCTGGCCCGACGGTGG + Exonic
1131262347 15:90893874-90893896 GCCTCGCCCTGGCCCCAGGGAGG + Intronic
1132221736 15:100110129-100110151 GCCAGGTCCTGGGCCCACTGTGG - Intronic
1132286648 15:100668444-100668466 GCCTGGCCCTGAGCCCCCTGTGG + Intergenic
1132475940 16:138269-138291 CCCCGGCCCCGGCCCCACGGCGG - Exonic
1132549557 16:548703-548725 CTCTGGCCCTGGCCCTGCTGGGG - Intronic
1132655349 16:1039659-1039681 ACCTGGACATGGCCCCACCTTGG - Intergenic
1132676572 16:1123622-1123644 ACCCAGGCCTGGCCCCAGTGGGG + Intergenic
1132832480 16:1935568-1935590 ACCTGGCCCCTGCCCCCCAGGGG + Intergenic
1132934319 16:2473272-2473294 CCCTATCCCTGGACCCACTGAGG + Exonic
1133009930 16:2905263-2905285 ACCGTGCCCTGGGCTCACTGCGG - Intergenic
1133219835 16:4315435-4315457 ACCTTGGCCAGGCCCCCCTGCGG - Exonic
1134104396 16:11475648-11475670 ACATGTCCCTGGCCCTTCTGAGG - Exonic
1136481591 16:30545377-30545399 ACCAGGCCATGCCCCCTCTGTGG - Intronic
1136773535 16:32859833-32859855 CCCTGGCCCTGGCCCTGCTCTGG + Intergenic
1136897077 16:34001686-34001708 CCCTGGCCCTGGCCCTGCTCTGG - Intergenic
1137547740 16:49416040-49416062 ACCTGTCACTGGCCCCCCAGAGG + Intergenic
1137723146 16:50639538-50639560 ACCTGCCCCCTGCCCCACCGGGG + Exonic
1138248156 16:55482235-55482257 AACTGGCCCTGCCCAAACTGAGG - Intronic
1138580974 16:57940200-57940222 ACCAGGCACTGGCACCTCTGAGG - Intronic
1139923029 16:70471412-70471434 TCCTGGCCCCCACCCCACTGCGG + Intronic
1140879628 16:79186315-79186337 GCATGGCCCTGTCCACACTGTGG - Intronic
1141159787 16:81621645-81621667 ACAGGCCCCTGGCCCCACAGCGG + Intronic
1141392637 16:83677507-83677529 GCTGGGCCCTGGCCCAACTGAGG - Intronic
1141606122 16:85154308-85154330 ACCTACCCATGGCCCCACTTGGG - Intergenic
1141750385 16:85954466-85954488 ACCTGGCCCAGGCCACAGAGAGG + Intergenic
1141875169 16:86819300-86819322 ACTTGGCCCTGGCCACACTGGGG - Intergenic
1142149071 16:88504838-88504860 GCAAGGCCCTGGCCCCACAGGGG - Intronic
1142201371 16:88762565-88762587 CTCTGGCCGTGGCACCACTGGGG - Intronic
1142236543 16:88925155-88925177 ACCCGGCCCTCTGCCCACTGCGG - Intronic
1142270218 16:89085132-89085154 AGCTGGCCCTCCCCCGACTGCGG + Intergenic
1142382821 16:89743323-89743345 GCCTGGCTCTGGCCCCAGTGTGG + Intronic
1203075951 16_KI270728v1_random:1121944-1121966 CCCTGGCCCTGGCCCTGCTCTGG + Intergenic
1142805720 17:2370118-2370140 GCCTGGGCCGGGGCCCACTGTGG - Intronic
1143010112 17:3861670-3861692 CACTGGCCCTGTCCCCAGTGAGG + Intronic
1143287484 17:5801064-5801086 CCCTGACCCTGGCCTCAATGAGG + Intronic
1143628929 17:8126094-8126116 ACCTGGCCCTTCCCCCGCGGGGG - Intergenic
1143762089 17:9112177-9112199 TCCTGTCCTTGGCCCCACTGGGG - Intronic
1144670829 17:17131731-17131753 CCCAAGCCCTGGCTCCACTGAGG - Intronic
1146282274 17:31552368-31552390 ACCTACCCCTGGCTCCACAGGGG - Intergenic
1146681419 17:34811014-34811036 ACCTGGTCCTGGCCACAAGGAGG + Intergenic
1146692024 17:34883313-34883335 ACTTAGCCCTGTCCCCACCGGGG - Intergenic
1147156306 17:38546091-38546113 CCCTGGCCCTGGCCTCGGTGAGG + Intronic
1147254842 17:39175391-39175413 TCCAAGCCCTGGCCCCTCTGAGG + Exonic
1147585669 17:41652829-41652851 TCCTGGCCCTGGGCCCAGGGTGG - Intergenic
1148043832 17:44730000-44730022 CCCTAGCCCTAGCCCCAGTGAGG + Exonic
1148079711 17:44960896-44960918 ACCTGGCCCTGGTTCCAGGGTGG - Intronic
1148386553 17:47238526-47238548 GACTGGGCCTGGCCCCATTGCGG + Intergenic
1148478859 17:47946800-47946822 ACCTAGCCCTAGCTCCACTCTGG - Exonic
1148497129 17:48059704-48059726 ACCTGGACCTGGACCTACAGCGG + Exonic
1150338022 17:64344125-64344147 ACCTGCCCCAGCCCCCACTGTGG - Intronic
1151787412 17:76281811-76281833 AACTGGACATGGCCCCACAGAGG - Intronic
1152068130 17:78122536-78122558 GCCTGGCCCTGGGTCCACTTAGG - Intronic
1152084965 17:78212344-78212366 ACCGGGCCCTGGCACCACCATGG - Intergenic
1152347559 17:79762517-79762539 ACCTGACCCTGGCCTCCCAGCGG - Intergenic
1152390913 17:80003173-80003195 TCCTGGCCCTTGCCCACCTGTGG + Intronic
1152729426 17:81962189-81962211 ACCTGCCCCAGCCGCCACTGGGG + Intergenic
1152758515 17:82097102-82097124 AGGTGGCCCCTGCCCCACTGTGG + Intronic
1153280779 18:3412063-3412085 GCCTGGCCTTTGCCCCGCTGAGG - Intronic
1154125613 18:11689667-11689689 CCCCGGCCCTGGCCCCAGTCCGG + Exonic
1154175710 18:12086532-12086554 ACCCTGCCCTGGCCCCACCCTGG + Intergenic
1154251133 18:12746307-12746329 TCCTGGCCCTGGCTCCCCTCTGG + Intergenic
1157365242 18:47058612-47058634 ACTGGGCCCTGGCCCCACCCTGG - Intronic
1157986883 18:52448276-52448298 ACCATCCCCTGGCCCCTCTGTGG + Intronic
1160042858 18:75361136-75361158 ACCTGGACGGGGACCCACTGCGG - Intergenic
1161482164 19:4516676-4516698 ACCGGCCCCTGTCCCCACAGTGG - Exonic
1161501775 19:4620167-4620189 ACCTGGCCTGGGACCCCCTGCGG + Intergenic
1162110577 19:8397683-8397705 CCCTTCCCCTGGCCACACTGTGG - Intronic
1162349708 19:10141289-10141311 AATTGGTCATGGCCCCACTGAGG - Intronic
1162796084 19:13088365-13088387 CCCTGGCCCAGGCCCCTCTGGGG + Intronic
1163609101 19:18291996-18292018 GCCTGGCCCTGACCCCTCCGGGG - Intergenic
1163646101 19:18489962-18489984 AGCTGGCCCTGACCACGCTGTGG + Intronic
1164415920 19:28046436-28046458 ACCTGGGCTGGGCCCCAGTGAGG - Intergenic
1164509552 19:28886143-28886165 ACCTGGGGCTCTCCCCACTGTGG + Intergenic
1164680861 19:30132824-30132846 TCCTGGGCCAGGCCTCACTGAGG + Intergenic
1164919654 19:32079262-32079284 GCCTGGCCGTGGCCTCTCTGTGG - Intergenic
1164999354 19:32748325-32748347 ACCTGGCACTGGCCCTGCTCTGG - Intronic
1165076656 19:33283217-33283239 CCCTGACCCTAGCCCCTCTGAGG - Intergenic
1165898767 19:39158637-39158659 GCTTGGCCCTGGCATCACTGGGG + Intronic
1166313585 19:41976345-41976367 ACCAGGCCCCGGCCTCAGTGAGG + Intronic
1166346690 19:42170807-42170829 ATCTGGCCCTTTCCCCGCTGAGG + Intronic
1166943678 19:46384171-46384193 ACCTGGCACTGGCCACACTTGGG + Intronic
1166976075 19:46605724-46605746 ACGTGGAGCTGGCCTCACTGGGG + Intronic
1166998312 19:46730330-46730352 CCCTGGCCCTGGCCACTCTGGGG - Intronic
1167001148 19:46746340-46746362 CGCGGGCCCTGGCCCCACTGGGG - Exonic
1167093224 19:47359005-47359027 AACTGGCACTGCCCCCACTAGGG - Intronic
1167097302 19:47381222-47381244 TTCTGGACCTGCCCCCACTGTGG + Exonic
1167512119 19:49900933-49900955 ACCTGGCCCTGGCCCCACTGGGG + Intronic
1167571293 19:50290588-50290610 ACTTGGCCCTGGGGGCACTGGGG + Intronic
1168107630 19:54174137-54174159 TCCTGGCCCTGGCAGCCCTGGGG - Exonic
925425673 2:3747194-3747216 AACTGGCCCCGGCCCCTCTGAGG + Intronic
927826620 2:26313788-26313810 GCCTGGGCCTGGCTCCACTCAGG - Exonic
927886505 2:26721727-26721749 ACCAGGCCCAAGCCACACTGAGG + Intronic
928330120 2:30351321-30351343 GCCTGGCCCTGGCCCAGCTGGGG + Intergenic
928364665 2:30691806-30691828 AACAGGCCCAGGCCACACTGGGG + Intergenic
929073179 2:38055115-38055137 ACCTGGTCCTGGCCTCACTGAGG - Intronic
929602401 2:43212650-43212672 ACCCAACCCTGGCCCCACCGGGG - Intergenic
929775469 2:44928753-44928775 CCCTGGCCCCGGCCCCAGAGCGG + Intergenic
932462971 2:71895385-71895407 AACTGCCCCTGGCTCCTCTGTGG + Intergenic
933719962 2:85391460-85391482 TCCTTGCCCTACCCCCACTGAGG - Exonic
935535178 2:104285361-104285383 ACCACGCCCAGGCCCCACTGTGG + Intergenic
936434015 2:112487678-112487700 ACCTGCCCCTTGCCCCTCGGAGG + Intronic
936906609 2:117542706-117542728 ACCTGCCCCTTCCCCTACTGTGG - Intergenic
937460721 2:122083432-122083454 ACCTGGCACATGCCCCAATGGGG - Intergenic
937792527 2:125977748-125977770 TCCTTGCCATTGCCCCACTGAGG - Intergenic
937990076 2:127657297-127657319 ACCTGGCCCTGTCACCAGTCGGG + Intronic
938978523 2:136503510-136503532 ATCAGGACATGGCCCCACTGTGG - Intergenic
941705363 2:168652745-168652767 ATCTGGCCCTTTCCCCACTAAGG + Intronic
941874432 2:170418697-170418719 CCCTGGCCCTGGGCCACCTGGGG + Intronic
942128804 2:172856862-172856884 ATCTGACTCTGGCCACACTGTGG + Intronic
942448325 2:176092845-176092867 CCCTGGCCCTGGCCCCGCGCAGG - Intergenic
942451211 2:176108800-176108822 GCCAGGCCCTGGCCCCGTTGGGG - Intronic
943853815 2:192762881-192762903 ACCTGGCCCTGGGGCAACTGAGG + Intergenic
944348902 2:198703618-198703640 ACCTGGGCCTGGCATCACAGAGG + Intergenic
945190480 2:207182476-207182498 GCCAGGCCCAGGCCCCACAGAGG + Intergenic
946239445 2:218344888-218344910 GCCGGGGCCGGGCCCCACTGGGG + Exonic
946741431 2:222806167-222806189 ACCTCAAGCTGGCCCCACTGTGG - Intergenic
947727117 2:232407781-232407803 ACCTGGCCCTGACCCCACAGCGG - Intronic
947736279 2:232457086-232457108 GCCTGGTCCTGACCCCACAGCGG - Intronic
947748858 2:232522727-232522749 ACCTGGCCCTGGTGCAGCTGTGG + Exonic
948792227 2:240385053-240385075 ACCTGCGCCTGGCCCCACGGTGG + Intergenic
949021219 2:241742452-241742474 ACCTGGCCGTGAACCCACAGGGG + Exonic
949077999 2:242073602-242073624 CCCTGGCACTGGCCCCGCAGAGG - Intergenic
1168972873 20:1942755-1942777 CCCAGGGCCTGGCCCCAGTGAGG + Intergenic
1169111650 20:3037821-3037843 AGCTGACCCAGGCCCCACAGAGG - Intronic
1169746923 20:8952127-8952149 GCCTGACCCTGACCCCACAGGGG - Intronic
1170596656 20:17810939-17810961 CCCTGGGCTTGGCACCACTGTGG - Intergenic
1170854280 20:20036267-20036289 TCCTGGCCATGGCCAAACTGTGG - Exonic
1171213058 20:23331682-23331704 ACCTCAGCCTGGCCCCGCTGGGG + Intergenic
1171227125 20:23451232-23451254 ACCTGGCACTGGCCCATCTGTGG - Intronic
1171419517 20:25008560-25008582 TCCTGGCCCTGCCGCCTCTGAGG + Intronic
1171463062 20:25309643-25309665 TCCTGGCCCTGGGCCCCCTTGGG - Intronic
1172092823 20:32446018-32446040 ACTCGGCCCTGGCTCCCCTGGGG + Exonic
1172519860 20:35559532-35559554 ACCTCGGCCCGGCCCCATTGCGG + Intergenic
1172704491 20:36872996-36873018 CCCTGGCCCTGTGCCCACTCTGG - Intergenic
1173009108 20:39165289-39165311 TCCTGGCTCTGGCCCCAAAGGGG + Intergenic
1174105712 20:48161028-48161050 CCCTACCCCTGCCCCCACTGAGG + Intergenic
1174159584 20:48541388-48541410 ACCTGTCCCTGTCCCCCATGGGG + Intergenic
1174163098 20:48565496-48565518 ACCTGGCCCTGGCGTGACTAGGG - Intergenic
1174636230 20:52002052-52002074 ACCTGGCCATGGCCACATTATGG + Intergenic
1174863574 20:54114544-54114566 GTCTGGCCCTGGCCCCACCTTGG - Intergenic
1175824789 20:61930997-61931019 CCGTGGCCCCGGCCCCACTGCGG - Intronic
1176115277 20:63429388-63429410 ACCAGGACGTGGCCCCAGTGGGG - Intronic
1176180337 20:63746841-63746863 GCGTGGCCCTGGCCCCGCAGTGG + Exonic
1176369140 21:6052096-6052118 AGCTGGCCCCGGGCCCACTAGGG - Intergenic
1178405045 21:32316868-32316890 CCCTGGTCCTGACCCCACTCAGG - Exonic
1178704746 21:34864128-34864150 ACGTGGCCCTGCCCTCTCTGTGG + Intronic
1179039594 21:37790567-37790589 TCCTGACTCTGCCCCCACTGAGG - Intronic
1179258168 21:39736003-39736025 GCTTGGGCCTGGCCCCTCTGTGG + Intergenic
1179406752 21:41132604-41132626 ACCTGGGCCCAACCCCACTGGGG + Intergenic
1179732698 21:43376383-43376405 ACCTGGCCCTGGTGCCAGTAAGG + Intergenic
1179754379 21:43486445-43486467 AGCTGGCCCCGGGCCCACTAGGG + Intergenic
1180092259 21:45539206-45539228 ACCTGGCCCTGGTCCCCCACAGG + Intronic
1180167373 21:46036960-46036982 ACCTGCCCCCGCCCCCACTCTGG - Intergenic
1180275543 22:10635885-10635907 CCCTGGCCCTGACCCTTCTGTGG - Intergenic
1181046643 22:20217753-20217775 GCCTGACGCTGGCCTCACTGTGG - Intergenic
1181167940 22:20993286-20993308 AGCTGGCCCTGACCTCACTGTGG - Intronic
1181278722 22:21703526-21703548 ACCAGGCCCTGCCCCCTCAGCGG + Intronic
1181306972 22:21922624-21922646 ACCTGGCCCTGGCCGCAGAGAGG + Exonic
1181601338 22:23953573-23953595 TCCTGGCCCTGTCCACACTTTGG + Intergenic
1181745409 22:24952558-24952580 CCCAGGCCCAGGCGCCACTGCGG + Intergenic
1182445653 22:30387764-30387786 ACTTGGCCCTGGCCACCCCGTGG - Intronic
1182737603 22:32542029-32542051 ACCTGCCCTTTCCCCCACTGTGG - Intronic
1182759308 22:32709074-32709096 GCGTGGCTCTGGCCACACTGTGG + Intronic
1183538754 22:38417735-38417757 ACCTGGCCCAGCCCCCAGTACGG + Intergenic
1183546242 22:38455937-38455959 ACGTGACCCGCGCCCCACTGCGG + Intergenic
1183654060 22:39175029-39175051 ACCTGACCCTGGCCCCCCGGGGG + Intergenic
1183780296 22:39994998-39995020 CCCTGGCCCCGGCCCCGCCGCGG - Exonic
1184363012 22:44030219-44030241 CCCTGGCTCAGGCCCCACTCAGG + Intronic
1184468658 22:44683508-44683530 ACCTGGCCCTGGCCCCAAGGGGG - Intronic
1184473424 22:44708347-44708369 ACCTAGCCCTGGCCCCAGCTGGG - Intronic
1184602697 22:45552915-45552937 ATCAGGCGCCGGCCCCACTGAGG - Intronic
1184797513 22:46740619-46740641 TCATGGCCCTGGCCCCACACAGG - Intergenic
1185094901 22:48800833-48800855 ACGTGGCACTGGCCCCACTCAGG + Intronic
1185118633 22:48952471-48952493 ACCTGGCCCAGCCCCCACTCGGG + Intergenic
1185181605 22:49366620-49366642 TCCGGGCCCTGGACCCACCGTGG - Intergenic
1185248296 22:49785224-49785246 ACCGGGCCCTGCCCCAGCTGTGG - Intronic
1185249762 22:49794572-49794594 TCCTGGACCAGGACCCACTGAGG + Intronic
950591103 3:13936113-13936135 ACAAGGGCCTGGCCCCACTCTGG + Intergenic
950665082 3:14490423-14490445 GCCAGGGCCAGGCCCCACTGGGG - Exonic
954084374 3:48232618-48232640 AGTTGACTCTGGCCCCACTGTGG + Intergenic
954334378 3:49907741-49907763 CCCTGCCCTTGGCCCCACTGTGG - Intronic
954629474 3:52040252-52040274 AGCTGGCCCTGGCCCTAGGGAGG - Intergenic
956666101 3:71643323-71643345 ACCTGGCACTTGCTCCACGGGGG + Intergenic
956736969 3:72245548-72245570 CCCTTGCCCCAGCCCCACTGAGG + Intergenic
960594629 3:119397092-119397114 ACCTTGGCCTGGCCTCACAGAGG - Intronic
961661099 3:128469233-128469255 AGATCGCCCTGGCACCACTGGGG - Intergenic
962181460 3:133210165-133210187 AAGTGGGCCTGGCCTCACTGTGG + Intronic
962311628 3:134331076-134331098 AGTGGGCCCTGGCCTCACTGAGG + Intergenic
962891720 3:139678024-139678046 ACCCGGCCCTGGCCCCGCCCAGG + Intergenic
965610583 3:170539368-170539390 AAGTGGCCCTGGCCTCTCTGTGG + Intronic
965838325 3:172875755-172875777 ACACTGCCGTGGCCCCACTGTGG + Intergenic
967840916 3:194003803-194003825 TCCTAACCCAGGCCCCACTGCGG - Intergenic
968494865 4:910019-910041 AGCTGGCCCAGGCCCCTCTGCGG - Intronic
968500146 4:946106-946128 ACCTGGCCCTGATGCCACCGTGG - Intronic
968502675 4:958381-958403 GCCTGGCCCTGGCCACCCTGCGG + Exonic
968621149 4:1604041-1604063 ACCCTGCCCAGGCCACACTGGGG + Intergenic
968662337 4:1803962-1803984 TCCTGGCCCTGTGCCCAGTGTGG + Intronic
968733906 4:2285400-2285422 CCATGGCGCCGGCCCCACTGTGG + Intronic
968886466 4:3336609-3336631 ACATGGTCCTTGCCCCACTGGGG + Intronic
969021489 4:4142863-4142885 ACCTCGCCCCGCCCCCACTGGGG + Intergenic
969110386 4:4840658-4840680 CCCTGGCCCTAGCCCTACTGAGG + Intergenic
969312896 4:6364363-6364385 AGCTGGCCCTGGCCCCTCCCTGG - Intronic
969366026 4:6694667-6694689 AGCTGGTCCTGGCCGCCCTGAGG - Intronic
969447939 4:7256019-7256041 TCCTAGGTCTGGCCCCACTGGGG + Intronic
969604954 4:8197764-8197786 CCCGGGCCCTGGCCTCAGTGGGG + Intronic
969621524 4:8281187-8281209 CCCGGGCCCTGCCCCCACAGTGG + Intronic
969732377 4:8964554-8964576 ACCTCGCCCCGCCCCCAGTGGGG - Intergenic
970793795 4:19889628-19889650 ACCAGGCCATGACCCCTCTGCGG + Intergenic
976113534 4:81702084-81702106 ACCTGGCACTGTCCTCACAGGGG + Intronic
977559273 4:98516152-98516174 AACTGGCCCTGCCCCAACAGGGG + Intronic
980667056 4:135954002-135954024 ACTTGGCCCTTGCCACACAGGGG - Intergenic
984771873 4:183443933-183443955 AGCTGGCCCTGGCCCCGCAGCGG - Intergenic
985248841 4:188002870-188002892 GCCTGGGCTTAGCCCCACTGGGG - Exonic
985829894 5:2220582-2220604 ACCAAGCCCTGGCCCCACAAGGG + Intergenic
985838936 5:2291282-2291304 ACCAAGCACTGGCCGCACTGAGG - Intergenic
987084439 5:14455961-14455983 ACCATGCCCAAGCCCCACTGCGG - Intronic
988364013 5:30272517-30272539 ACCTGTCCCTGTCTCCACTGAGG - Intergenic
990496572 5:56354087-56354109 ACCAGGCCCTGGCCAGCCTGAGG + Intergenic
992127187 5:73654121-73654143 ACCAGCCCCTGGCTGCACTGGGG + Intronic
992398548 5:76390017-76390039 TCCTGGCGCTGGAGCCACTGCGG + Intergenic
993189316 5:84661171-84661193 CTCTGCTCCTGGCCCCACTGTGG + Intergenic
996978537 5:129461622-129461644 TCCCGGCCCCGGCCCCACGGGGG + Exonic
997457322 5:134026978-134027000 ACCTGGCCCTGGACTCCCAGGGG + Intergenic
998133303 5:139661846-139661868 ACCTGGCTCTGCCCTCTCTGGGG + Intronic
998376376 5:141693581-141693603 CCCTGCCCCTAGCTCCACTGAGG + Intergenic
999184024 5:149692008-149692030 CTTTGGCCCTGGCCACACTGTGG - Intergenic
999321616 5:150618733-150618755 CCCTGGCCCTGGGCCCAGAGTGG + Exonic
999437048 5:151571176-151571198 GCCTGGGGCTGGCCCCACTATGG - Intergenic
999715319 5:154355500-154355522 ACCTGGCCCTGGCCCTTCCTTGG - Intronic
1001546924 5:172576014-172576036 ACATGGCACTAGCCCCACAGGGG + Intergenic
1001643867 5:173265494-173265516 ACCTGGCAGGGGCCCCTCTGGGG + Intergenic
1002576635 5:180177616-180177638 ACATGGCCCTGGTGCCACTTGGG + Intronic
1002591438 5:180293459-180293481 CTCTGGCCCTGGCCACTCTGTGG - Intergenic
1002595309 5:180318210-180318232 GCCAGGCTTTGGCCCCACTGGGG + Intronic
1002645153 5:180649272-180649294 CCCTGGCCCTGACCCGGCTGCGG + Intronic
1003127012 6:3363556-3363578 GGCTGGCCCTGGGCCCAGTGTGG + Intronic
1003620669 6:7696642-7696664 TCCTGGCCCTGTACCCACTCTGG + Intergenic
1005221295 6:23591871-23591893 ACCAGGCCCTGCCAACACTGGGG - Intergenic
1006453963 6:34121638-34121660 CCCTGGCCCTGGCCCAGCAGAGG - Intronic
1006610493 6:35291662-35291684 ACCTGCCCGGAGCCCCACTGTGG + Exonic
1006735308 6:36269084-36269106 GCCTGGCCTTGCCCTCACTGTGG + Intronic
1010842233 6:80659734-80659756 TCCTGGCCCCAGCCACACTGTGG - Intergenic
1015684486 6:135844291-135844313 AACTGCCCCAGCCCCCACTGAGG + Intergenic
1018690733 6:166342358-166342380 CGCTGGCCCCGGCCGCACTGAGG - Intronic
1018903347 6:168062069-168062091 ACCTGGGCCTCGTCCCCCTGGGG - Intronic
1019282477 7:207452-207474 GGCTGGCCCCGGCCCCACAGAGG - Intronic
1019331702 7:463602-463624 CCGCGGCCCCGGCCCCACTGCGG + Intergenic
1019436611 7:1025485-1025507 ACTCTGCCCTGGCACCACTGGGG + Intronic
1019540301 7:1548235-1548257 GCCTGGCCCAGGGCCCAGTGGGG + Intronic
1019732270 7:2634682-2634704 ACCTGGCCCTGGTCCCTCCGGGG - Intronic
1019863893 7:3686892-3686914 GCCTGGCCCTGGAGCAACTGGGG + Intronic
1019932681 7:4234299-4234321 ACCTGGACCTGGACCCAGGGTGG - Intronic
1020171833 7:5851081-5851103 GCCCTGCCCTGGCCCCACAGTGG + Intergenic
1020308911 7:6854892-6854914 ACCTCGCCCCGCCCCCAGTGGGG + Intergenic
1022003243 7:26245421-26245443 ACCAGGCCATGCCCCCTCTGCGG + Intergenic
1023909021 7:44540933-44540955 TCCTGTCACTGGCCCTACTGTGG - Intronic
1029209873 7:98898246-98898268 ACAATGTCCTGGCCCCACTGGGG + Intronic
1029706228 7:102277802-102277824 AGCTGCCCCTTCCCCCACTGTGG - Intronic
1031992246 7:128206168-128206190 ACAGGGGCCTGCCCCCACTGAGG - Intergenic
1032426918 7:131829995-131830017 ACCTGCCCCCGGCCTCACAGCGG - Intergenic
1035053737 7:156019908-156019930 ACCTGGCACAGACCCCACTGAGG + Intergenic
1035627963 8:1088075-1088097 AGCTGGGCTTGGCCCCACAGGGG + Intergenic
1036280461 8:7395935-7395957 ACCAGGCACTGGCCCTTCTGAGG - Intergenic
1036341009 8:7915635-7915657 ACCAGGCACTGGCCCTTCTGAGG + Intergenic
1036658223 8:10691254-10691276 TCCTGGCCGATGCCCCACTGTGG - Intronic
1037802903 8:22044672-22044694 ACCTGCCCCTCGCCCCACCCTGG - Intronic
1037829544 8:22179571-22179593 ACCCGGCCCTGACCCTGCTGAGG + Intronic
1037837239 8:22221446-22221468 ACCTGTCCCTGGGCACCCTGGGG - Exonic
1038870690 8:31489967-31489989 ACCTGGCCCTGCCAGCCCTGGGG + Intergenic
1041299240 8:56393729-56393751 ACCTGGCCCTGGTGTAACTGTGG - Intergenic
1044888305 8:96803922-96803944 ACCTTGACCTGGGCACACTGTGG - Intronic
1046408234 8:113803255-113803277 ACCTGGCCCTGGCATAACTAAGG + Intergenic
1046970397 8:120216676-120216698 ATCTGGCCCTAACCTCACTGGGG - Intronic
1047210172 8:122834374-122834396 ACCAGGCCGTGCCCCCTCTGCGG - Intronic
1048330862 8:133469947-133469969 ACCTGGCCCTGCACTCACTCTGG - Intronic
1048402380 8:134083830-134083852 ACTAGGACCTGGCCCCACAGTGG - Intergenic
1049133582 8:140872528-140872550 ACCTGCCCCTGGACTGACTGGGG + Intronic
1049175883 8:141192587-141192609 ACCTGGCCCAGCCCCCGCAGAGG + Exonic
1049178372 8:141207685-141207707 ACGTGCCCCTGGCAGCACTGTGG + Intronic
1049193692 8:141303852-141303874 ACTGGGCCCAGGCCCCAGTGAGG - Intronic
1049197503 8:141323816-141323838 CCCTGGCCTGGGCCCCAGTGGGG + Intergenic
1049445338 8:142627894-142627916 ACCTGGCCCAGCCCCCACCGGGG + Intergenic
1049651231 8:143770974-143770996 GCCTCGCCCTCGCCCCACCGCGG - Intergenic
1049683454 8:143930026-143930048 ACCAGGCCCTGGTCACGCTGTGG - Exonic
1049686173 8:143940154-143940176 CCCTGGCCCTGGGGCCAGTGGGG + Intronic
1050018542 9:1260634-1260656 TCCTGGCACTGACCCCTCTGGGG + Intergenic
1052973267 9:34392859-34392881 ACCTGGCCCAGGACCCAGAGAGG + Intronic
1053868964 9:42470281-42470303 ACCTGGCCATGGCCACTGTGAGG + Intergenic
1056077768 9:83059057-83059079 AGCTGGCACTGGAACCACTGAGG - Intronic
1056791207 9:89626520-89626542 ACCTGGTCCCTGCCCTACTGGGG + Intergenic
1057111307 9:92473950-92473972 AGCTGAGACTGGCCCCACTGTGG - Intronic
1057140587 9:92724661-92724683 ACCAGGGCCGGGCCCCACAGTGG + Intronic
1057437726 9:95057863-95057885 AGCTGGCTCTGGCAGCACTGTGG + Intronic
1057463735 9:95292310-95292332 AGCTGGGCCTGGCCGCCCTGCGG + Intronic
1057757974 9:97852673-97852695 GACTTGCCATGGCCCCACTGCGG - Intergenic
1059115730 9:111599112-111599134 CCCGGGACCTGGCCCCTCTGCGG - Intronic
1059688771 9:116663311-116663333 ACCTCCCCCTGGCCCCAAAGTGG - Intronic
1060966526 9:127715045-127715067 ACCTCGCCCTGGCCCCGCTGGGG - Exonic
1061614892 9:131773189-131773211 ACCTGGCCCTGGGGCGATTGGGG - Intergenic
1061731208 9:132615508-132615530 GCCTAGCTCTGACCCCACTGAGG + Intronic
1061804278 9:133129315-133129337 ACCTGGCTCTCGCCCCACCATGG - Intronic
1062044350 9:134418194-134418216 ACCTGTCCCAGGCCCCACTGAGG + Intronic
1062264094 9:135678891-135678913 GCCTGGGCCTGGCCTGACTGCGG - Intergenic
1062451242 9:136616649-136616671 ACCTGGCCCTGGCCCTGGAGGGG - Intergenic
1062511785 9:136910164-136910186 ACCTGGCCCCCGGCCCACTCAGG - Intronic
1062623537 9:137433224-137433246 GCCTGGCCCCGGCCCCTGTGAGG + Exonic
1062638664 9:137505572-137505594 ACCTGGCCCTTGTCCCACCCAGG - Intronic
1185720068 X:2374316-2374338 CCCTGAGCCTGGCCTCACTGTGG - Intronic
1189609351 X:42715243-42715265 ACCTTGCCCGGTCCTCACTGTGG - Intergenic
1190255919 X:48762083-48762105 ACCTGTCCCTGGCTAAACTGGGG - Intronic
1190332909 X:49247036-49247058 GACAGGCCCTCGCCCCACTGTGG + Intronic
1192159063 X:68769318-68769340 GCCTGTCCCTGGCCCTTCTGGGG + Intergenic
1192282580 X:69701326-69701348 ACCAGGCCATGCCCCCTCTGCGG - Intronic
1197693055 X:129523139-129523161 TCCTGTGCCTGGCCCCTCTGAGG - Intronic
1200072003 X:153533837-153533859 CCCTGCCCCTGACCCCACAGCGG - Intronic
1200401915 X:156024815-156024837 CCCTGGCCCTGGCCCCGAGGTGG + Intergenic
1200832482 Y:7700481-7700503 CCCTGTCCCTGGTCCAACTGGGG - Intergenic