ID: 1167512121

View in Genome Browser
Species Human (GRCh38)
Location 19:49900934-49900956
Sequence CCTGGCCCTGGCCCCACTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 567
Summary {0: 1, 1: 0, 2: 4, 3: 68, 4: 494}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167512111_1167512121 30 Left 1167512111 19:49900881-49900903 CCACAATGATGGTTTCGATGAGG 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1167512121 19:49900934-49900956 CCTGGCCCTGGCCCCACTGGGGG 0: 1
1: 0
2: 4
3: 68
4: 494

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167512121 Original CRISPR CCTGGCCCTGGCCCCACTGG GGG Intronic
900291043 1:1923721-1923743 CCCGGCCCTGGCCCCACGCAGGG - Intronic
900379681 1:2377705-2377727 CCTGCCTCTGGCCCTCCTGGGGG + Intronic
900401497 1:2474686-2474708 CCTGGGCCTGGCCCCAGCTGGGG - Intronic
900407192 1:2497925-2497947 CCTGTGCCTGGCCCCTCTGTGGG + Intronic
900409266 1:2505388-2505410 GCTGGCCCGGGGCCCACAGGAGG + Exonic
900409758 1:2507283-2507305 CCTGGCCCCACCCTCACTGGTGG - Intergenic
900557877 1:3289178-3289200 CTTGCCCGTGGCCACACTGGTGG - Intronic
900578014 1:3393941-3393963 CCTGGCCCTGGACCTGCAGGAGG - Intronic
900604707 1:3518809-3518831 CCTGGCCCTGTCCCCAACAGAGG - Intronic
901040059 1:6358358-6358380 CCTGCCCCTGGCCAAAATGGAGG - Intronic
901201358 1:7469189-7469211 CCTGGCTCTGCCTCCCCTGGAGG + Intronic
901668211 1:10838433-10838455 TCAGGCCCTGAACCCACTGGTGG - Intergenic
901772975 1:11540085-11540107 CCTGGCCGTGGCCCCGCTCCTGG - Intergenic
902197139 1:14806110-14806132 CAGGGCCCTGGGACCACTGGAGG + Intronic
902593843 1:17494476-17494498 GTTGGCTGTGGCCCCACTGGAGG - Intergenic
902613440 1:17610325-17610347 CCTGGCCCTGGGACCTCTGGGGG + Intronic
902819952 1:18937754-18937776 CCTGGCCCAGCCGCCACTGGAGG + Intronic
903009198 1:20318442-20318464 CCTGGCCATGGTCACACTGCAGG + Intronic
904348778 1:29891470-29891492 CCAGGCCCTGGGCCCACTAATGG + Intergenic
904399752 1:30248305-30248327 GTTGGCCCTGGAACCACTGGGGG - Intergenic
904755207 1:32765213-32765235 ACTGGCCCCTGCCCCTCTGGGGG + Intronic
904882939 1:33714440-33714462 CCTGCCCCGGGTCCCACTGCAGG + Intronic
904922315 1:34018278-34018300 CCTGGCCATGCCCCTACTGTTGG + Intronic
905021121 1:34813053-34813075 CCTTGCCCTAGCCCCACTGTAGG + Intronic
905105396 1:35560730-35560752 CCAGGCCCTGGCACTCCTGGTGG + Exonic
905212759 1:36385789-36385811 CCCGGCCCCGGCCCCCCGGGAGG - Exonic
905300189 1:36981665-36981687 CCCGACCCTGGCCCTCCTGGAGG - Intronic
905653019 1:39669011-39669033 CCTGGGCCTGGCCGCAGAGGTGG + Intronic
905881708 1:41468283-41468305 CCTGGCCCTTGCCCCGGAGGAGG - Intergenic
906129647 1:43448409-43448431 CCTGGCCCTGGCAGAGCTGGAGG + Exonic
906431873 1:45761700-45761722 CCATGCCCGGTCCCCACTGGAGG + Intergenic
908582030 1:65525965-65525987 CCGGGCGCTGGCCCCTCTGGTGG - Intronic
910237356 1:85048790-85048812 CCTGGCCAAGGCCCCTCAGGTGG + Intronic
912543439 1:110433947-110433969 CCTGCCCCTGCCCCCACTGTGGG - Intergenic
913077503 1:115353422-115353444 CCTGGCCCAGGGACCACTGCTGG - Intergenic
914052279 1:144146205-144146227 CCTGGCCCCAGCCCCATTGCTGG - Intergenic
914126918 1:144820336-144820358 CCTGGCCCCAGCCCCATTGCTGG + Intergenic
915273500 1:154772412-154772434 CCTGGTCCTGGCCACACTAATGG - Intronic
915937839 1:160099112-160099134 CCTGGCCCTGGCTCCGCCCGAGG + Intergenic
918005087 1:180534519-180534541 CCAGGCCCTGGCACCAGTGAGGG - Intergenic
920173248 1:204084474-204084496 CCTGGTCCTGGCAGCCCTGGAGG - Intronic
920243827 1:204573286-204573308 CCTGGCCCAGGCCACAGAGGAGG - Intergenic
922205000 1:223438466-223438488 GCTGGCCCAGACCCCACTTGCGG + Intergenic
922241928 1:223760973-223760995 CCTGGCCCTGGACACAGGGGCGG + Intronic
922811173 1:228416484-228416506 CGTGGCCCAGGCGCCACAGGAGG + Intronic
923147911 1:231210534-231210556 CCTGGACTTGGCCCCTCTGTGGG - Intronic
923354141 1:233137148-233137170 CCTGGCCAGGACCCCACTGTCGG + Intronic
923500442 1:234559714-234559736 CCTGGTCCTGGCCCCAGGGCTGG - Intergenic
1062814792 10:491531-491553 CCTGCCCCTGTCCCCAGTGCAGG - Intronic
1062826782 10:575758-575780 CCTGGCTCTGGCCCTGCTTGCGG - Intronic
1063288139 10:4712493-4712515 CCTGGCCATGGCATCTCTGGTGG + Intergenic
1063313792 10:4982577-4982599 CCTAACCCTGGACCCACTGGTGG + Exonic
1063314116 10:4984815-4984837 CCTAACCCTAGACCCACTGGTGG - Intronic
1063973476 10:11397306-11397328 CCTGGCCATATCCCCACTGCTGG - Intergenic
1064031554 10:11886167-11886189 CTATGCCCTGTCCCCACTGGGGG - Intergenic
1064183910 10:13143755-13143777 CATGGCACTGGCTCCAGTGGTGG - Intergenic
1065871223 10:29957969-29957991 CCTGACCCTGGCCTCCCTAGGGG - Intergenic
1065972649 10:30817755-30817777 CCTGGCCCTCTCCCCAGTGGGGG - Intergenic
1067105295 10:43362376-43362398 CTGGGCCCTCGCCTCACTGGCGG + Intergenic
1067351113 10:45475851-45475873 CCTGTCCTTGGTCCCAGTGGTGG - Intronic
1067552413 10:47245144-47245166 CCTGTCCCTGTGCCCTCTGGTGG + Intergenic
1067809862 10:49418127-49418149 CCTGGGCCTGGGGGCACTGGTGG - Intergenic
1067842441 10:49691749-49691771 CCTGCCCCTGGCCCTCCTGCAGG - Intronic
1068955774 10:62817874-62817896 CCTGTCCGGGGCCCCACAGGAGG + Intronic
1070149438 10:73796969-73796991 GCTGGGCCAGGCCCCACTGAGGG + Exonic
1070399046 10:76036651-76036673 CCTGGCTATGCCCTCACTGGGGG + Intronic
1072070297 10:91908833-91908855 CCGGTCCCCGGGCCCACTGGCGG - Exonic
1072780449 10:98247612-98247634 CCAGGCCCTGGCTCCATGGGAGG + Intergenic
1073122544 10:101131519-101131541 GCTGGCCCTGGCCCCACCGGGGG - Exonic
1073300923 10:102470582-102470604 CCTTGCCCAGGCCCCAGGGGAGG - Intronic
1073454702 10:103629534-103629556 CCTGACCTTGGCCCCAGTGTGGG - Intronic
1074129376 10:110559696-110559718 CAAGGCTCTGGCCCCCCTGGAGG + Intergenic
1074187401 10:111108697-111108719 CCAGCCCCTGCCCCTACTGGCGG - Intergenic
1075484483 10:122811071-122811093 CCTAGTCTTGGCCCCAGTGGTGG - Intergenic
1076356424 10:129857021-129857043 CCAGGCCCTTCCCCCACTGCTGG - Intronic
1076536484 10:131181175-131181197 CCAGGCCTTGGCTCCACTGTGGG - Intronic
1076627216 10:131829458-131829480 GCTGGCACTGTCCCCAGTGGAGG - Intergenic
1076716245 10:132365496-132365518 CCATGGCCAGGCCCCACTGGAGG + Exonic
1076732684 10:132446414-132446436 CCTCGCCCTGGCCCCACCACGGG - Intronic
1076746576 10:132517616-132517638 CCCTGCCCTGCCCCCACCGGAGG - Intergenic
1076753643 10:132556374-132556396 TCTGGCCCTGGTCCCCGTGGAGG - Intronic
1076868190 10:133179678-133179700 CCAGGCCCTGTCCCCACTCGAGG + Intronic
1077108280 11:851194-851216 CCTGTCCCTGGCTCCTGTGGAGG + Intronic
1077214135 11:1388355-1388377 CCCTCCCCTGCCCCCACTGGTGG + Intergenic
1077325924 11:1964066-1964088 CCTTGGCCTGGGCCCACTGAAGG + Intronic
1077473396 11:2775345-2775367 CATGGCCCCAGCCCCACTGTGGG + Intronic
1080550557 11:33370885-33370907 ACTGAGCCTGGCCCCCCTGGAGG + Intergenic
1080583763 11:33664276-33664298 CCTGGAGGTGGACCCACTGGAGG - Intronic
1081614420 11:44582131-44582153 ACTGGCCCTGGTCACACAGGGGG - Intronic
1082030647 11:47601001-47601023 GCTGGCCCTGGCCCCAGCTGCGG + Intergenic
1082174459 11:49045770-49045792 CTATGCCCTGGCCCCACAGGTGG + Intergenic
1083201364 11:61122959-61122981 CCTGGCCCTGGTGCTCCTGGTGG + Exonic
1083212267 11:61195567-61195589 ACTGCCCCTGGCACCAATGGTGG + Intergenic
1083303053 11:61748740-61748762 CCTGGCCCTGCTCCCACTCAAGG + Intergenic
1083441169 11:62677585-62677607 CCTGGCTCTGGTGCCACTGGGGG + Exonic
1083890667 11:65594250-65594272 CCAGGCCCTGCCCCTTCTGGTGG + Intronic
1083945468 11:65920457-65920479 CCAGGCCCTGGCCCCACCTGCGG - Exonic
1084013449 11:66365324-66365346 CTTGGCCCAGGCCCCAGTGCTGG - Intronic
1084037271 11:66519761-66519783 TCTGGCCCTGGGCCCGCTGGAGG + Intronic
1084175726 11:67421249-67421271 CCAGGTCCTGGCCCGAGTGGTGG + Intronic
1084324190 11:68389989-68390011 CCTGGCCCTGGACCTGCAGGAGG + Exonic
1084395158 11:68904477-68904499 GCCGGCCCTGGACGCACTGGAGG - Intronic
1084427867 11:69095430-69095452 CGTGCCCCCGGCCACACTGGCGG + Intergenic
1084533908 11:69745780-69745802 CCTGGCCCTGGCTTCCCTGGTGG - Intergenic
1084981106 11:72829227-72829249 CCTGGCTCTGCCCCGACTGCTGG - Intronic
1085273416 11:75283558-75283580 CCTGGGACGGGCCCCACTGGAGG + Intronic
1085388756 11:76171616-76171638 ACAGGACCTGGCACCACTGGCGG - Intergenic
1087181272 11:95144775-95144797 CCAGCCCCTTTCCCCACTGGGGG - Intergenic
1087381517 11:97409598-97409620 CCTGGACCTGGTACTACTGGAGG - Intergenic
1087773675 11:102238434-102238456 CCTACCTCTGGCCCCACTGCAGG + Intergenic
1089185288 11:116610715-116610737 CCTGGCCCTGGGCCCACACGTGG - Intergenic
1089662377 11:119993929-119993951 CTTGTCCCTGCCCCCACAGGGGG - Intergenic
1091284127 11:134398702-134398724 CCTGGCCCTGGGTCCACTGCTGG + Intronic
1202808904 11_KI270721v1_random:19245-19267 CCTTGGCCTGGGCCCACTGAAGG + Intergenic
1092159602 12:6308933-6308955 CCTGCTCCTGGCCCAGCTGGTGG - Intergenic
1092182134 12:6453157-6453179 CCTTGCCCTGTCCTCACTGCTGG - Exonic
1093116797 12:15221493-15221515 CCTGCCCCTGCCCCCAGTAGGGG - Intronic
1093646511 12:21590756-21590778 CCAGTCCTTGGCCCCAGTGGTGG - Intronic
1095297424 12:40542797-40542819 ACTGGCACTGGACCCACTGCAGG + Exonic
1095533667 12:43221279-43221301 TCTGCCCCTGTGCCCACTGGTGG + Intergenic
1096788147 12:54029493-54029515 CCTTGCCCCACCCCCACTGGGGG - Intronic
1097188005 12:57205833-57205855 CCAGGACCTGCCCCCACTGCTGG - Intronic
1100025368 12:90121892-90121914 CCTGTCCTTAGGCCCACTGGTGG + Intergenic
1102483397 12:113239591-113239613 CCAGCCCCTGGAGCCACTGGAGG + Intronic
1103464699 12:121132787-121132809 CCTGGCAGTGGCCCCACATGTGG - Intergenic
1103506633 12:121445469-121445491 CCTTGAACTGGCCCCCCTGGGGG - Intronic
1103986716 12:124772303-124772325 CCTGGCCCTGGACCCACCCACGG + Intergenic
1104854686 12:131896131-131896153 GCTGGCCCTGGCAGCACTGCCGG + Intronic
1104981174 12:132573709-132573731 CCTTTCCCTGGCGCCCCTGGTGG + Intronic
1105796245 13:23856430-23856452 CCTGGCTCTGGGCGCACTGTAGG - Intronic
1106229870 13:27813485-27813507 CCTGGCACTGTCCACACTTGGGG + Intergenic
1106432702 13:29695983-29696005 CACTGCCCTTGCCCCACTGGAGG + Intergenic
1106515035 13:30445802-30445824 GCCGGCCCTGGCCCCTGTGGTGG + Intergenic
1107837552 13:44423784-44423806 CCTTGCCCTTACCCCACTGCTGG + Intergenic
1110117146 13:71833210-71833232 CCTGCCCCAGGACCCACTGAGGG + Intronic
1113349368 13:109513526-109513548 CCAGGCCCTGAGCCCACAGGAGG - Intergenic
1113349379 13:109513576-109513598 CCAGGCCCTGAGCCCACAGGTGG - Intergenic
1113349390 13:109513626-109513648 CCAGGCCCTGAGCCCACAGGAGG - Intergenic
1113349401 13:109513676-109513698 CCAGGCCCTGAGCCCACAGGAGG - Intergenic
1113349412 13:109513726-109513748 CCAGGCCCTGAGCCCACAGGAGG - Intergenic
1113752166 13:112784008-112784030 CCAGGCTCTTGCCCCACTGTGGG - Intronic
1113915923 13:113874292-113874314 CCTGGCTCTGCCCCCACTCGAGG + Intergenic
1113962262 13:114132615-114132637 CCTCGCCCTCGGCCAACTGGCGG - Intergenic
1113981450 13:114280657-114280679 CCAGCCCCTGGCCCCGCTTGTGG + Intergenic
1114189621 14:20430429-20430451 CCTGGCCCTGTTCCCCATGGCGG - Exonic
1117092910 14:52268249-52268271 CCTGCGCCTGGGCGCACTGGTGG + Exonic
1117766915 14:59093028-59093050 CCTGGCCCTGGCCCAGTGGGGGG - Intergenic
1118616552 14:67578082-67578104 CCTGGCCCAGACCGCACTGCAGG + Exonic
1119574027 14:75702200-75702222 CCTGGCCTAGGCCACTCTGGAGG + Intronic
1119931518 14:78552005-78552027 CCAGGCCCTGCCTCCAGTGGTGG + Intronic
1121011373 14:90522165-90522187 GCTTCTCCTGGCCCCACTGGAGG - Intergenic
1121476876 14:94216954-94216976 TCTTGCCCTATCCCCACTGGTGG - Intronic
1121667860 14:95686326-95686348 ACTGGCCCCGCCCCCACTGCCGG + Intergenic
1121953739 14:98195532-98195554 ACTGCCCCAGGCTCCACTGGGGG + Intergenic
1122037956 14:98962063-98962085 GCTGGGGCTGGCCCCACTGCTGG - Intergenic
1122059069 14:99124626-99124648 CCTGCCCCAGACCCCACTGTGGG + Intergenic
1122552978 14:102560189-102560211 CCTGGCTCTGTCTCCACTGGGGG - Intergenic
1122602871 14:102930049-102930071 GCTGGCCCGGGCCCTCCTGGCGG + Exonic
1122623750 14:103073918-103073940 CATGGCCCTGGCCCCACCTGCGG - Intergenic
1122768735 14:104087609-104087631 CCAGGTCCTGTCCCCACTCGGGG - Intronic
1122828377 14:104383353-104383375 CCTGGGCTGGGCACCACTGGTGG - Intergenic
1122865418 14:104601819-104601841 CATGGCCTTGACCCCACTGGAGG - Intronic
1122879198 14:104682456-104682478 CCTGCCCCGCGCCCCACTGCAGG - Intergenic
1123039824 14:105485953-105485975 GCTGGCCCTGTCCCCGCTGGGGG - Intergenic
1123044566 14:105505045-105505067 ACTGTGCCTGGCCCCACTGCTGG + Intergenic
1202930413 14_KI270725v1_random:29227-29249 CCTGGCCCTAGCCCCGTTGCTGG + Intergenic
1123421937 15:20142183-20142205 CCTGGCCCCAGCCCCATTGCTGG - Intergenic
1123442535 15:20302253-20302275 CCAGGCCCTGGCCCTGCTGCTGG + Intergenic
1123531165 15:21148723-21148745 CCTGGCCCCAGCCCCATTGCTGG - Intergenic
1124619856 15:31267417-31267439 CCTGGCTCCTGCCCCACTGATGG - Intergenic
1124620788 15:31272756-31272778 CGTGGCCCTGCCCCCACAGGTGG + Intergenic
1127149626 15:56060154-56060176 CTTGGCACTGGCTCCAGTGGTGG - Intergenic
1127629714 15:60815595-60815617 CCTGGCTCTGGCTGCAGTGGGGG - Intronic
1127896488 15:63304251-63304273 CCAGTCCCTGCCCCCACTGAGGG - Intronic
1128182026 15:65612496-65612518 CAGGGCCCTGGCCCCAGTGCTGG - Intronic
1128247517 15:66143323-66143345 CCTGGCCTAGCCCCCACCGGAGG - Intronic
1128252191 15:66171335-66171357 CCTTGCCCTGGCACCACTGGTGG - Intronic
1128338228 15:66802262-66802284 CCTGCCCCCCGCCACACTGGTGG - Intergenic
1129256822 15:74338515-74338537 GCTGGCCCTGGCCCTAATGAAGG - Intronic
1129274396 15:74435451-74435473 CCTGGGCCAGGCTCCACTGCTGG - Intergenic
1129331524 15:74830294-74830316 CAAGGCCCAGGCCACACTGGGGG + Exonic
1129352238 15:74962851-74962873 GCTGGCTCTGGCCCCACAGATGG + Intronic
1129707379 15:77802469-77802491 CCTGCTCCTGGCCCCTCTGCAGG - Intronic
1129753843 15:78084138-78084160 ACTAGGCCTGGCCCCACTGCAGG + Intronic
1130254529 15:82319803-82319825 CCTGCCCCCAGCCCCACTGGCGG + Intergenic
1130600436 15:85270167-85270189 CCTGCCCCCAGCCCCACTGGCGG - Intergenic
1131262349 15:90893875-90893897 CCTCGCCCTGGCCCCAGGGAGGG + Intronic
1132055722 15:98649176-98649198 CCCGGCCCTGGCCGCGCGGGAGG - Exonic
1132221734 15:100110128-100110150 CCAGGTCCTGGGCCCACTGTGGG - Intronic
1132475938 16:138268-138290 CCCGGCCCCGGCCCCACGGCGGG - Exonic
1132559851 16:588673-588695 CCTGGTCGGGGCCCCTCTGGAGG + Intergenic
1132604118 16:786567-786589 CCTGGCCCTGTCCTCACCAGTGG - Intronic
1132732211 16:1368000-1368022 CCTGCCCCTTGCCCCACTCCTGG + Intronic
1132890610 16:2202597-2202619 CCTGGCCCTGGCCCATCCTGTGG - Intergenic
1132924606 16:2422489-2422511 CCAGGCCCTTGCCTCATTGGAGG + Intergenic
1133055082 16:3141791-3141813 ACTGGCCTTGGCCCCCCAGGGGG + Exonic
1133659258 16:7899844-7899866 CCTGGCCCTGACCCTACTCATGG - Intergenic
1134322868 16:13179616-13179638 CCTGGCCTTGGCTCCAATGATGG + Intronic
1135002749 16:18790495-18790517 CCTCTCCCAGGCCCCACCGGGGG - Intronic
1135057000 16:19240093-19240115 CCTGGGCCTGGGCCCTCTGAAGG + Intronic
1135077999 16:19410788-19410810 CCGGGCGCTGGCCCCACTCCTGG - Exonic
1136142029 16:28293853-28293875 CCCGACCCAGGCCACACTGGCGG + Intronic
1136469041 16:30466182-30466204 ACTGCCCCTGGCTACACTGGAGG + Intergenic
1136718115 16:32301230-32301252 CCTGGCCCTAGCCCCGTTGCTGG - Intergenic
1136723097 16:32339507-32339529 CCTGGCCCTAGCCCCATTGCTGG - Intergenic
1136773863 16:32860916-32860938 CCTGGCCCTAGCCCCATTGCTGG + Intergenic
1136836490 16:33507500-33507522 CCTGGCCCTAGCCCCGTTGCTGG - Intergenic
1136841419 16:33545506-33545528 CCTGGCCCTAGCCCCATTGCTGG - Intergenic
1136862904 16:33713501-33713523 CCTGGCCCTAGCCCCGTTGCTGG + Intergenic
1136896748 16:34000603-34000625 CCTGGCCCTAGCCCCATTGCTGG - Intergenic
1137010631 16:35316686-35316708 CCTGACCCTGGCGGCCCTGGAGG + Intergenic
1137028700 16:35502505-35502527 CCTGACCCTGGCGGCCCTGGTGG + Intergenic
1137521519 16:49199255-49199277 CCTTGCCCTGGCCTGACGGGAGG + Intergenic
1137531373 16:49280882-49280904 CCGGGCCCTGGCCCCGTAGGGGG - Intronic
1137578560 16:49620271-49620293 ACTGGCCCTGGCCAACCTGGAGG - Intronic
1138546401 16:57722276-57722298 CCAGGCCCTAGCCCCAGTGCTGG - Intronic
1139352873 16:66348218-66348240 ACTTGGTCTGGCCCCACTGGGGG - Intergenic
1139923031 16:70471413-70471435 CCTGGCCCCCACCCCACTGCGGG + Intronic
1140958652 16:79891635-79891657 CCTGACCCTTGCCCCAGTAGAGG + Intergenic
1141254293 16:82386416-82386438 CCTGTCCCTCTCCCCACTGGTGG + Intergenic
1141392636 16:83677506-83677528 CTGGGCCCTGGCCCAACTGAGGG - Intronic
1141606120 16:85154307-85154329 CCTACCCATGGCCCCACTTGGGG - Intergenic
1141727379 16:85799082-85799104 CCTGGCCCTCGCCCCCATGCTGG - Exonic
1141768602 16:86074962-86074984 CCTGTCCCTGGCCCCAGAGATGG + Intergenic
1142201370 16:88762564-88762586 TCTGGCCGTGGCACCACTGGGGG - Intronic
1142279460 16:89140186-89140208 CCTGTGCCTGGCCGCAATGGAGG + Intronic
1142418098 16:89954040-89954062 CCTGCCCAGGCCCCCACTGGTGG - Intronic
1142420052 16:89964459-89964481 CCTTGGCCTGGCACCGCTGGGGG - Exonic
1203003334 16_KI270728v1_random:178257-178279 CCTGGCCCTAGCCCCATTGCTGG + Intergenic
1203008313 16_KI270728v1_random:216535-216557 CCTGGCCCTAGCCCCGTTGCTGG + Intergenic
1203076283 16_KI270728v1_random:1123027-1123049 CCTGGCCCTAGCCCCATTGCTGG + Intergenic
1203124378 16_KI270728v1_random:1561642-1561664 CCTGGCCCTAGCCCCGTTGCTGG + Intergenic
1203134942 16_KI270728v1_random:1714664-1714686 CCTGGCCCTAGCCCCATTGCTGG + Intergenic
1203151584 16_KI270728v1_random:1845803-1845825 CCTGGCCCTAGCCCCATTGCTGG - Intergenic
1142644116 17:1301057-1301079 CCTGACCCTGGGGCCACAGGCGG - Intergenic
1142809065 17:2386859-2386881 CCCCTCCCTGTCCCCACTGGGGG + Exonic
1143010113 17:3861671-3861693 ACTGGCCCTGTCCCCAGTGAGGG + Intronic
1143499484 17:7330438-7330460 CTTCTCCATGGCCCCACTGGGGG - Intergenic
1143628927 17:8126093-8126115 CCTGGCCCTTCCCCCGCGGGGGG - Intergenic
1144670827 17:17131730-17131752 CCAAGCCCTGGCTCCACTGAGGG - Intronic
1145281135 17:21467902-21467924 CCTGCCCCTGCCCCCTCTTGTGG + Intergenic
1145957006 17:28861603-28861625 CCCAGCCAGGGCCCCACTGGGGG + Intergenic
1146179108 17:30685979-30686001 CCAGGCCCTGACCTCTCTGGGGG - Intergenic
1146379079 17:32315192-32315214 CCTGGCCCAGGCCCAGCTCGGGG - Intronic
1146909909 17:36641835-36641857 CCTGGCCCAGGCCCGGCTCGCGG + Intergenic
1146950183 17:36900201-36900223 GCCAGCCCTGGCCCCGCTGGGGG - Intergenic
1147048063 17:37769449-37769471 CGGGGCCCTGGCCACACAGGGGG + Intergenic
1147156308 17:38546092-38546114 CCTGGCCCTGGCCTCGGTGAGGG + Intronic
1147254844 17:39175392-39175414 CCAAGCCCTGGCCCCTCTGAGGG + Exonic
1147324975 17:39665758-39665780 CCTGGCACTGCCCCTGCTGGTGG - Exonic
1147585667 17:41652828-41652850 CCTGGCCCTGGGCCCAGGGTGGG - Intergenic
1147586625 17:41656872-41656894 CTTTGCCCTGGCCCTGCTGGTGG + Intergenic
1148000586 17:44385050-44385072 CCTGGCCCAGGCTCCAGTTGCGG - Exonic
1148695358 17:49555335-49555357 CCTTGCCCTGACCCTGCTGGGGG + Intergenic
1150217970 17:63480770-63480792 TCTGGCCCTGGGTCCAGTGGGGG + Intergenic
1150338020 17:64344124-64344146 CCTGCCCCAGCCCCCACTGTGGG - Intronic
1151475281 17:74341663-74341685 CAGGGCCCAGGTCCCACTGGAGG - Intronic
1152238570 17:79150629-79150651 CCTGGCCTTGCCCCCAGAGGTGG - Intronic
1152270933 17:79324528-79324550 CCTGGCAGTAGCCCCTCTGGTGG + Intronic
1152695239 17:81740928-81740950 CCTGGCCCTGGACAGTCTGGAGG + Intergenic
1152729428 17:81962190-81962212 CCTGCCCCAGCCGCCACTGGGGG + Intergenic
1152920277 17:83063098-83063120 CCTGTCCCTGCCCCAACAGGAGG - Intergenic
1152941309 17:83174091-83174113 CCTGGGACTGGCCTCACTGTCGG - Intergenic
1153497123 18:5710845-5710867 CCTGGCCATGGCCCTAATGATGG - Intergenic
1153880410 18:9417412-9417434 CCTGCCACTGGCCCCAGGGGTGG - Intergenic
1154125615 18:11689668-11689690 CCCGGCCCTGGCCCCAGTCCGGG + Exonic
1154132550 18:11749917-11749939 CCTGGGCCTGGTCCTTCTGGTGG - Intronic
1154147076 18:11875209-11875231 CTGGGCCCTGGCCTCCCTGGGGG - Intronic
1154310669 18:13264082-13264104 CCCGGCCCTGTCCCCTCTGGTGG + Intronic
1157501525 18:48194097-48194119 CTTGGCCCAGGCCCCACTGTTGG - Intronic
1157552915 18:48593853-48593875 CCTGGCCCTAACCCCACCTGAGG - Intronic
1160400253 18:78605431-78605453 CCGGGCCCTGACACCACGGGCGG - Intergenic
1160510581 18:79451320-79451342 CCTGGCGCTGGCTCCTCTGATGG + Intronic
1160537986 18:79605532-79605554 CCTGGCTCTGGGCACACAGGTGG - Intergenic
1160793252 19:932647-932669 CCTGGCCCTGCCCACCCCGGAGG + Exonic
1160865433 19:1253954-1253976 CCCGGCCCGGGCGCCGCTGGGGG - Intronic
1161031490 19:2059817-2059839 CCACTCCCTGCCCCCACTGGAGG - Intergenic
1161043062 19:2120389-2120411 CCTGCGCCAGGCCCCTCTGGAGG - Intronic
1161077106 19:2291134-2291156 CCTGGCCATCGCCTCCCTGGAGG - Exonic
1161156240 19:2733119-2733141 CCTGGCCCTGGGCCTGCAGGAGG - Exonic
1161237707 19:3206092-3206114 CCTGGCCCCAGCCCCACTGCAGG + Intronic
1161793820 19:6375425-6375447 CCTGGCGCTGGCCCGGCTGCAGG - Exonic
1162044117 19:7987498-7987520 CCTGGCCCTGGTCCCTATGTTGG - Intronic
1162110575 19:8397682-8397704 CCTTCCCCTGGCCACACTGTGGG - Intronic
1162303332 19:9856770-9856792 CCAGGCCCTGACCCCAGGGGTGG + Intronic
1162490280 19:10987442-10987464 CCTGGGGCTGGCCCCAGTGGAGG + Intronic
1162796086 19:13088366-13088388 CCTGGCCCAGGCCCCTCTGGGGG + Intronic
1162979514 19:14229595-14229617 CCAGGCCCTGACCTCTCTGGGGG + Intergenic
1163578611 19:18124752-18124774 CCTGGCCAAGGACCCCCTGGAGG + Exonic
1163826730 19:19528323-19528345 GCTGCCCCTGGATCCACTGGCGG + Intronic
1164874185 19:31671583-31671605 CTGGTCCCTAGCCCCACTGGAGG + Intergenic
1165422130 19:35727544-35727566 CCTGGCGCAGGCCCCCCTGGAGG - Exonic
1165424237 19:35737189-35737211 CCTGGCCCTCTCCCTGCTGGTGG - Exonic
1165425107 19:35741120-35741142 TCTGGCCCTGGCGCCACCGCCGG - Exonic
1165898768 19:39158638-39158660 CTTGGCCCTGGCATCACTGGGGG + Intronic
1166046336 19:40233052-40233074 GCCTGGCCTGGCCCCACTGGGGG - Exonic
1166517672 19:43459761-43459783 CCTGGCCCTAGAGGCACTGGAGG - Intergenic
1166651039 19:44575390-44575412 CCTGACCCTGCCCCCAGTGTTGG - Intergenic
1166656871 19:44618638-44618660 CCTGGCCATGGACCAGCTGGTGG + Intronic
1166828080 19:45621637-45621659 CCTGCCCCTGGCCACCCTGCAGG - Exonic
1167093223 19:47359004-47359026 ACTGGCACTGCCCCCACTAGGGG - Intronic
1167512121 19:49900934-49900956 CCTGGCCCTGGCCCCACTGGGGG + Intronic
1167513371 19:49908846-49908868 CCTGGCCCTGGCGCAGCTGCAGG - Exonic
1167518937 19:49940483-49940505 CCTGCCTCTGTCACCACTGGAGG + Intronic
1167551307 19:50162883-50162905 CCTGGCCCCGACCCCTCTTGGGG + Intronic
1167749761 19:51372502-51372524 CCGGTCCCTGGCCCTGCTGGGGG - Exonic
1168099094 19:54131529-54131551 CCTGCCACTGGCCCCATTGCTGG + Exonic
1202691676 1_KI270712v1_random:98629-98651 CCTGGCCCCAGCCCCATTGCTGG - Intergenic
925064111 2:915669-915691 TCTGTCACTGGCCCCTCTGGTGG - Intergenic
926113726 2:10197954-10197976 CCTGGACCCTGCCCCATTGGAGG - Intronic
926757053 2:16244737-16244759 CCTGGCCCAGGCCCCAAAGCAGG - Intergenic
926944454 2:18171601-18171623 CCTGGCTCTTGACCCACTTGTGG + Intronic
927133688 2:20081269-20081291 GCAGGCCCTGCCCTCACTGGGGG - Intergenic
927201950 2:20583463-20583485 CCTGGACCTGTCACCCCTGGAGG + Intronic
927461765 2:23305423-23305445 TCTGCCCCTGGGCTCACTGGAGG - Intergenic
927471341 2:23379731-23379753 CCTTCCTCTGGCCCAACTGGGGG + Intergenic
927826618 2:26313787-26313809 CCTGGGCCTGGCTCCACTCAGGG - Exonic
928364666 2:30691807-30691829 ACAGGCCCAGGCCACACTGGGGG + Intergenic
929033699 2:37671784-37671806 CCTGGCCCGGGGCCAACCGGTGG + Exonic
929828031 2:45325237-45325259 CTTGGCTCTGGCCACCCTGGAGG - Intergenic
929965144 2:46529019-46529041 CCTACCCTTGGCCCCTCTGGAGG - Intronic
932471277 2:71961049-71961071 CCTGGCCCTGGTTCCCTTGGAGG + Intergenic
932715789 2:74100179-74100201 CCCAGCCCCAGCCCCACTGGGGG - Intronic
933954712 2:87355321-87355343 CCTGGCCCCAGCCCCATTGCTGG + Intergenic
934238909 2:90251547-90251569 CCTGGCCCCAGCCCCATTGCTGG + Intergenic
934274286 2:91565163-91565185 CCTGGCCCCAGCCCCATTGCTGG - Intergenic
934323032 2:91984098-91984120 CCTGGCCCTAGCCCCGTTGCTGG + Intergenic
934533081 2:95108174-95108196 CCTGACCCTGGTCCCTGTGGAGG - Exonic
934751512 2:96797079-96797101 CCTGGGCCTGGTCACCCTGGAGG + Exonic
934755984 2:96825125-96825147 CCTGGGCCTGGTCACCCTGGAGG + Exonic
936143588 2:109963250-109963272 TCTGGACCTGGTCCCACTGCAGG + Intergenic
936180271 2:110261213-110261235 TCTGGACCTGGTCCCACTGCAGG + Intergenic
936201100 2:110408216-110408238 TCTGGACCTGGTCCCACTGCAGG - Intronic
937296411 2:120812355-120812377 CTGGGTCCTGGCCCCACTTGTGG + Intronic
937972990 2:127564639-127564661 GCTGGCCCTGACCCCTCTGGTGG - Intronic
939157646 2:138544312-138544334 CTTAGCCCTGCCCCCACAGGTGG + Intronic
941481656 2:166023333-166023355 CCTGGCCCAGGCCACAGTAGTGG + Intronic
941874434 2:170418698-170418720 CCTGGCCCTGGGCCACCTGGGGG + Intronic
942326128 2:174778539-174778561 CCTGCCCCTCGCCCCAGTGATGG + Intergenic
942965910 2:181892053-181892075 CCGGTCCATGGCCGCACTGGGGG - Exonic
943428653 2:187769942-187769964 CCTGGCCCCAGCCCCAATGCTGG - Intergenic
944888441 2:204089774-204089796 CCTGGCGCTGACCTCATTGGAGG - Intergenic
946200280 2:218067550-218067572 CCTGACTCTGGCTCCAGTGGGGG - Intronic
946339411 2:219058353-219058375 CCTGGCCCTGTCATCTCTGGCGG - Intronic
947122954 2:226836207-226836229 CCTCGCCCTAGCCCCCCGGGAGG - Intronic
947593564 2:231397758-231397780 CCTGGCCCTGGCCCTGCTCGTGG + Exonic
947632929 2:231665494-231665516 CCAGGCCTTGGCCCTGCTGGTGG - Intergenic
947727115 2:232407780-232407802 CCTGGCCCTGACCCCACAGCGGG - Intronic
947736277 2:232457085-232457107 CCTGGTCCTGACCCCACAGCGGG - Intronic
948128538 2:235583115-235583137 CCTGACCCTGGCCCACTTGGAGG - Intronic
948190523 2:236054845-236054867 CCTGCCCCTGCCGCCACTGCCGG + Intronic
948469494 2:238167985-238168007 CCAGGCCCTGGCACCCCTGGTGG - Intronic
948792229 2:240385054-240385076 CCTGCGCCTGGCCCCACGGTGGG + Intergenic
948826164 2:240574343-240574365 CCCGGCCCTGGCCGCACCGTAGG - Exonic
948896213 2:240928995-240929017 CCTGGCCATGCACCCGCTGGAGG - Intronic
948915730 2:241034338-241034360 CTTGCCCCTGGCCCCAGGGGAGG + Intronic
949021221 2:241742453-241742475 CCTGGCCGTGAACCCACAGGGGG + Exonic
1168972875 20:1942756-1942778 CCAGGGCCTGGCCCCAGTGAGGG + Intergenic
1170596654 20:17810938-17810960 CCTGGGCTTGGCACCACTGTGGG - Intergenic
1170930977 20:20768871-20768893 CCTGGCCCGGGATCCACTAGGGG + Intergenic
1171213060 20:23331683-23331705 CCTCAGCCTGGCCCCGCTGGGGG + Intergenic
1171227123 20:23451231-23451253 CCTGGCACTGGCCCATCTGTGGG - Intronic
1171419519 20:25008561-25008583 CCTGGCCCTGCCGCCTCTGAGGG + Intronic
1171463060 20:25309642-25309664 CCTGGCCCTGGGCCCCCTTGGGG - Intronic
1171824083 20:29878716-29878738 CCTAGATCTGGCGCCACTGGGGG - Intergenic
1172317466 20:33967307-33967329 CCAGTCCTTGGCCCCAGTGGCGG - Intergenic
1172701351 20:36855461-36855483 GCTGACCCTGGCATCACTGGAGG - Intronic
1172759832 20:37314250-37314272 CCCGGCCCTCCTCCCACTGGTGG - Intronic
1173247822 20:41348455-41348477 CCTGGCCCTGTAGCCACTGCTGG - Intronic
1174105714 20:48161029-48161051 CCTACCCCTGCCCCCACTGAGGG + Intergenic
1175150041 20:56926291-56926313 CTTTGCCCTTCCCCCACTGGTGG + Intergenic
1175256999 20:57653454-57653476 CCTGGGCCTGGGCCCCCTGCTGG + Intronic
1175399445 20:58692506-58692528 GTCGGCCCAGGCCCCACTGGAGG + Intronic
1175456458 20:59118732-59118754 CCTGGCCCTGTCTCCACAAGAGG + Intergenic
1175470091 20:59221459-59221481 ACTGGCCCTCACCCCACTGCTGG + Intronic
1175490306 20:59376086-59376108 CATGGCCCTGCCCTCCCTGGCGG - Intergenic
1175852354 20:62100338-62100360 CCTGGCCCTGACTCCCCAGGCGG + Intergenic
1175941309 20:62538752-62538774 GCTGGCCCTGCCCTCACTCGGGG + Intergenic
1176146633 20:63568407-63568429 GCTGGCCATGGCCTCCCTGGAGG - Exonic
1176229473 20:64024675-64024697 CCTGGCCCTGGCCTTCCAGGTGG + Exonic
1176287854 21:5028259-5028281 GCCAGCCCTGGCCCCACTGTCGG - Intronic
1176369139 21:6052095-6052117 GCTGGCCCCGGGCCCACTAGGGG - Intergenic
1176592426 21:8657823-8657845 CCTGGCCCTAGCCCCGTTGCTGG + Intergenic
1179258169 21:39736004-39736026 CTTGGGCCTGGCCCCTCTGTGGG + Intergenic
1179581067 21:42344282-42344304 GCCAGCCCTGGCCACACTGGCGG - Intergenic
1179754380 21:43486446-43486468 GCTGGCCCCGGGCCCACTAGGGG + Intergenic
1179869327 21:44235216-44235238 GCCAGCCCTGGCCCCACTGTCGG + Intronic
1179883821 21:44305027-44305049 CTTGGCTCTGGCCCCCCTGTTGG + Intronic
1179982858 21:44905595-44905617 CCTGGCCCTGTGGCCCCTGGAGG - Intronic
1180275285 22:10634970-10634992 CCTGGCCCTAGCCCCGTTGCTGG + Intergenic
1180549787 22:16529998-16530020 CCTGGCCCTAGCCCCATTGCTGG + Intergenic
1180842907 22:18967589-18967611 GCAGCCCCTGGCCTCACTGGAGG + Intergenic
1180936053 22:19625944-19625966 CTTGGCCCTGGCCCAGGTGGCGG - Intergenic
1181036570 22:20172521-20172543 CCTGCCCCGGCCCCCACTGCAGG - Intergenic
1181395631 22:22619134-22619156 CCTGGCCTGGGCCCCACTAATGG - Intergenic
1181582189 22:23834565-23834587 CCAGGCCCCGGCCCCACTCCTGG - Exonic
1181638751 22:24186154-24186176 CCTAGCCCTGGCCTCACCGTTGG - Exonic
1181712149 22:24697397-24697419 CCTGGCTCAGGCCCCTCTGAAGG + Intergenic
1181745907 22:24954719-24954741 GCTGCCCCTACCCCCACTGGAGG + Intronic
1182285021 22:29241193-29241215 CCTGGCCCTGGTTCCTCTGGAGG + Intronic
1183284132 22:36952032-36952054 CCAGGCCCAGGCCCCAGTGGTGG + Intergenic
1183784051 22:40019069-40019091 CCTCGCCCTGGGGTCACTGGTGG - Intronic
1184344956 22:43907528-43907550 CCTGGGCCAGCCCCCACAGGAGG - Intergenic
1184797512 22:46740618-46740640 CATGGCCCTGGCCCCACACAGGG - Intergenic
1184837034 22:47029868-47029890 CCCGGCCCAGGCCACTCTGGGGG - Intronic
1185009457 22:48305101-48305123 CCTGCCCCTGGCCCCAGCAGTGG - Intergenic
1185094902 22:48800834-48800856 CGTGGCACTGGCCCCACTCAGGG + Intronic
1185227307 22:49660404-49660426 CCTGGGCCTGGGCACCCTGGGGG + Intergenic
949906861 3:8864928-8864950 CCTGACTCTGGCCTCGCTGGTGG - Intronic
950199745 3:11034590-11034612 CCACACCCTGGCCCCACTTGGGG - Exonic
950625659 3:14244793-14244815 CCTGGCCCTGGCACCCCTCTAGG + Intergenic
952888978 3:38028889-38028911 CCTGGCCCTGTCCCCCGAGGAGG + Intronic
953311729 3:41887145-41887167 CCTGGCCCTGGCCCCACCACTGG + Intronic
953493718 3:43369529-43369551 CATGGCCGTGGCCCAACTTGGGG - Intronic
953753845 3:45630316-45630338 CCAGACCCTGCCACCACTGGTGG - Intronic
953793036 3:45962840-45962862 CATGGCCCTGGGCCCACAGCAGG + Intronic
953868921 3:46609450-46609472 ACTGTTCCTGCCCCCACTGGGGG + Intronic
954256731 3:49412403-49412425 ACTGGCCCTCGCCCCACCCGGGG - Exonic
954305110 3:49721532-49721554 CCTGGCCCTGGCCCTTCTTGAGG + Exonic
954305950 3:49725444-49725466 CCCAGCCCTGGTGCCACTGGTGG - Exonic
954638619 3:52085116-52085138 GCTGTCCCAGGCCCCCCTGGCGG + Intronic
956666103 3:71643324-71643346 CCTGGCACTTGCTCCACGGGGGG + Intergenic
961389508 3:126543920-126543942 CTGGGCCCTTCCCCCACTGGAGG + Intronic
961741570 3:129036343-129036365 CCTTCCCCTGGCACCAATGGAGG - Intronic
961780933 3:129319677-129319699 CCTGGGCCTGGCCAGTCTGGAGG + Intergenic
963537277 3:146544385-146544407 CCCGGCCCTGGCCCCAGCGCAGG + Intronic
966214729 3:177490639-177490661 CCTGTCCCTGTCCCCACAAGGGG - Intergenic
967329497 3:188276438-188276460 CGTGGCCCTGGGGCCTCTGGGGG + Intronic
968502677 4:958382-958404 CCTGGCCCTGGCCACCCTGCGGG + Exonic
968555906 4:1246366-1246388 CCTGGCCCAGGGCCCAGGGGTGG - Intronic
968579207 4:1381995-1382017 CCTGGCCCTGGCCCGAAGTGGGG + Intronic
968662339 4:1803963-1803985 CCTGGCCCTGTGCCCAGTGTGGG + Intronic
968708154 4:2093267-2093289 CCCGGCCTTGTCCCCAGTGGGGG - Intronic
968734996 4:2290687-2290709 CCTGGCCCCTGCCCCACAGCAGG - Intronic
969110388 4:4840659-4840681 CCTGGCCCTAGCCCTACTGAGGG + Intergenic
969314269 4:6372091-6372113 CCTGGCCGGGGCCCCAGTGCTGG + Intronic
971154597 4:24067941-24067963 TTTTGCCCTGGCCCCTCTGGGGG - Intergenic
972694726 4:41434240-41434262 GCTGGCTGTGGCACCACTGGAGG + Intronic
974950976 4:68582644-68582666 CCTGGACCTGGCCCACCTGGTGG + Intronic
975115220 4:70672845-70672867 CCAGGCCATGGCTTCACTGGAGG - Intronic
975666976 4:76741802-76741824 CCCGGCCCTGGCCCCCCAGGAGG - Exonic
979764093 4:124444815-124444837 CCTGTTCTTGGCCCCAGTGGTGG + Intergenic
979920522 4:126490342-126490364 CCTGGCACAGGATCCACTGGGGG + Intergenic
980667055 4:135954001-135954023 CTTGGCCCTTGCCACACAGGGGG - Intergenic
982060410 4:151598966-151598988 GCTGCCCCCAGCCCCACTGGGGG + Intronic
982203847 4:152982431-152982453 CACGGCCCTGGCCACACAGGTGG - Intergenic
983205059 4:164902891-164902913 CCTGACCCTGTTCCCACTGCAGG - Intergenic
985248839 4:188002869-188002891 CCTGGGCTTAGCCCCACTGGGGG - Exonic
985954157 5:3250115-3250137 CATGGCCCTGGCTCCCGTGGTGG + Intergenic
991564557 5:67991248-67991270 CCTCGCCCAGCCGCCACTGGAGG + Intergenic
993360447 5:86968373-86968395 CCTGCCCATGGCCCCACGGCAGG + Intergenic
998159152 5:139803365-139803387 CCTGGGCATGGCACCCCTGGGGG + Intronic
999309334 5:150541737-150541759 CCTTGCCCTGGCCCCACTCCCGG + Intronic
999313738 5:150570465-150570487 ATGGGCCCTGGCCACACTGGGGG - Intergenic
999437046 5:151571175-151571197 CCTGGGGCTGGCCCCACTATGGG - Intergenic
1001111910 5:168903664-168903686 CCTGTCTCTGGCCCTCCTGGAGG + Intronic
1001399323 5:171437369-171437391 CCTGGCCCAGCCCCCAGTGACGG - Intronic
1001546925 5:172576015-172576037 CATGGCACTAGCCCCACAGGGGG + Intergenic
1002541465 5:179908744-179908766 ACTGGCCCTGGGCCCAGTGGCGG + Intergenic
1002576636 5:180177617-180177639 CATGGCCCTGGTGCCACTTGGGG + Intronic
1002927642 6:1614276-1614298 CACGGCCCTGTCCCCACGGGCGG + Intergenic
1003127013 6:3363557-3363579 GCTGGCCCTGGGCCCAGTGTGGG + Intronic
1006793548 6:36718386-36718408 CCTGGCCCAGGCACCCCAGGTGG + Intronic
1007384267 6:41510129-41510151 CCTGGCCTTGGGCCCAGTGCTGG - Intergenic
1007729892 6:43939440-43939462 CCTGCCCCTTGCCCCACCAGAGG + Intergenic
1008687721 6:53943639-53943661 CCAGGGCCAGGCCTCACTGGAGG + Intronic
1009952601 6:70413857-70413879 CCTGGCCCCGGCCCCGTTGAAGG + Intronic
1013417955 6:109941180-109941202 CCTGGCCCTGGCCCCAAGAATGG - Intergenic
1013459181 6:110358506-110358528 CCGGGCCCTGGCACCTCCGGAGG - Intergenic
1015301350 6:131656143-131656165 CCTAGCTCTGCCCCTACTGGCGG + Intronic
1017975397 6:159352700-159352722 CTTTGCCCTGCCCCCACTGTAGG + Intergenic
1018208560 6:161458417-161458439 CCTGGCCCTCGCCGCGGTGGAGG + Intronic
1018392242 6:163349537-163349559 CCAGGCCCTGGTCTCTCTGGGGG + Intergenic
1018903345 6:168062068-168062090 CCTGGGCCTCGTCCCCCTGGGGG - Intronic
1018950126 6:168373616-168373638 CCTGTCCCTGGCACCTCCGGAGG + Intergenic
1019289956 7:245521-245543 CCGGCCCCTGCCTCCACTGGAGG - Intronic
1019331703 7:463603-463625 CGCGGCCCCGGCCCCACTGCGGG + Intergenic
1019388227 7:770647-770669 CCTGGCCCAGGCCCCAGCTGGGG - Intronic
1019405955 7:884211-884233 TCTGCCCGTGGCCCCACTGGCGG + Intronic
1019447652 7:1079734-1079756 CAGGGCCCTGGACCCTCTGGAGG - Intronic
1019515917 7:1440126-1440148 CCAGGGCCTGGCCCACCTGGAGG + Intronic
1019523780 7:1471814-1471836 CCCGGCCCTGCCCCTACTAGTGG + Intronic
1019540303 7:1548236-1548258 CCTGGCCCAGGGCCCAGTGGGGG + Intronic
1019609307 7:1928912-1928934 GCTGGCGCTGGCCCCACAGGTGG - Intronic
1019732268 7:2634681-2634703 CCTGGCCCTGGTCCCTCCGGGGG - Intronic
1020283710 7:6664309-6664331 CCTGGCACGGGCCCCACGCGAGG - Intergenic
1022475383 7:30706479-30706501 GCCTTCCCTGGCCCCACTGGCGG - Intronic
1023834366 7:44059666-44059688 CCTGGCCCCAGCCCCAGTGTAGG - Intronic
1023909019 7:44540932-44540954 CCTGTCACTGGCCCTACTGTGGG - Intronic
1023982021 7:45075918-45075940 CGTGGCCCTGTTCCCATTGGTGG - Exonic
1024000250 7:45184891-45184913 CCTGAGCCTGACCCCATTGGGGG + Intronic
1024556197 7:50605260-50605282 CCCGGCCCTGGCCAGCCTGGAGG - Intronic
1024965615 7:55019970-55019992 CCTGGCCCCGGCCCCTCTCCAGG + Intronic
1025264498 7:57443580-57443602 CCTGACCCTGGTGGCACTGGTGG - Intergenic
1026000528 7:66556979-66557001 TCTGGCCCAGGCGGCACTGGCGG - Intergenic
1026911405 7:74093712-74093734 CCATGCCCTGGCCCCACTCCAGG - Intronic
1027232388 7:76280452-76280474 GCTGGCCCTGGCCCCGCTCCCGG + Intronic
1028364662 7:90013359-90013381 CCTGACCCTGGCTCCAGAGGAGG + Intergenic
1029422713 7:100479328-100479350 CCTGGCCCCGGGCCAGCTGGCGG - Intergenic
1029481996 7:100819033-100819055 TCTGGCCCCAGTCCCACTGGGGG + Intronic
1030086051 7:105816643-105816665 CCTGTTCCTGGCCCAAGTGGAGG + Intronic
1032988567 7:137364938-137364960 CCTGGTCATGACCCCACTGATGG - Intergenic
1034935109 7:155193979-155194001 GCAGGCCCAGGCCCCACTAGAGG - Intergenic
1035024822 7:155818611-155818633 CGTGGCCCCGCCCACACTGGAGG + Intergenic
1035053739 7:156019909-156019931 CCTGGCACAGACCCCACTGAGGG + Intergenic
1035473929 7:159129079-159129101 CCTGGCCCTGACCCCCCAGGCGG - Intronic
1035474010 7:159129387-159129409 CCTGGCCCTGTCCCCGCCAGAGG - Intronic
1035474023 7:159129443-159129465 CCTGGCCCTGTCCCCGCCAGAGG - Intronic
1035474062 7:159129611-159129633 CCTGGCCCTGTCCCCCCCAGAGG - Intronic
1035474089 7:159129723-159129745 CCTGGCCCTGTCCCCGCCAGAGG - Intronic
1035474104 7:159129779-159129801 CCTGGCCCTGTCCCCCCCAGAGG - Intronic
1035474151 7:159129961-159129983 CCTGGCCCTGTCCCCGCCAGAGG - Intronic
1035474166 7:159130017-159130039 CCTGGCCCTGTCCCCCCCAGAGG - Intronic
1035555212 8:562672-562694 CCTGGCCCTAGCCCCACTCCTGG + Intergenic
1037609600 8:20464999-20465021 ACTGTCCCTGTCTCCACTGGAGG - Intergenic
1037759391 8:21732051-21732073 CCAGGCCCTGGGCCCAATGCAGG + Intronic
1037803878 8:22049061-22049083 CCCGGCCCCGGCCCCTCCGGGGG - Intronic
1037837237 8:22221445-22221467 CCTGTCCCTGGGCACCCTGGGGG - Exonic
1037991136 8:23321944-23321966 CCTGGCCCTGGCCCGGCAGCAGG - Intronic
1038674660 8:29612852-29612874 CCTGGCCCTGGCCCTGCATGAGG - Intergenic
1042218857 8:66453613-66453635 CCTCCCACTGGACCCACTGGGGG - Intronic
1042642515 8:70951827-70951849 CCTGGCCCCGGCTCCACTACAGG + Intergenic
1045249810 8:100474031-100474053 GCTGCCCCTGGGCACACTGGCGG - Intergenic
1048009208 8:130443159-130443181 CCCGTCCCCGGCCCCACTGCAGG + Intronic
1049197505 8:141323817-141323839 CCTGGCCTGGGCCCCAGTGGGGG + Intergenic
1049366250 8:142238241-142238263 ACTGGGCCTGGCCCCTCTGCAGG + Intronic
1049392860 8:142381098-142381120 CCTTGCCCTGGCCCAACTGCTGG + Intronic
1049671133 8:143870358-143870380 GGTGGCCCTGGCCCTGCTGGAGG - Exonic
1049797224 8:144502392-144502414 CTAGGCCCTGGCCCCCATGGAGG - Intergenic
1052859527 9:33428456-33428478 CCTGCCTCTGGCCACACTGCTGG - Intergenic
1056931368 9:90880720-90880742 CCTGGCCCTGCCCACACAGCAGG - Intronic
1057167519 9:92940612-92940634 CCTGGCCAAGGGCCCAGTGGAGG - Intergenic
1057194945 9:93111625-93111647 CCAAGCCTTGGCCCCACTGGAGG + Intronic
1057755423 9:97831404-97831426 CCTGGCCTTGGCCTCACCGGTGG + Intergenic
1060106694 9:120877191-120877213 CCCGACCCCGGCCCCACGGGCGG - Exonic
1060481894 9:124021298-124021320 CCTGGCCCTGGCTGACCTGGAGG - Exonic
1060523749 9:124309024-124309046 CCTGGCCCTGGTGCACCTGGGGG - Intronic
1060966524 9:127715044-127715066 CCTCGCCCTGGCCCCGCTGGGGG - Exonic
1061119841 9:128635844-128635866 CCTGGCCCTGGCCCTGTAGGTGG - Intronic
1061618232 9:131794043-131794065 CCTGGCAGCGGCCCCATTGGTGG + Intergenic
1061709373 9:132477138-132477160 CCTCATCCTGGCCCCACTGTTGG - Intronic
1061731210 9:132615509-132615531 CCTAGCTCTGACCCCACTGAGGG + Intronic
1061916169 9:133755628-133755650 CCTCTCCCTCTCCCCACTGGTGG - Intergenic
1062044352 9:134418195-134418217 CCTGTCCCAGGCCCCACTGAGGG + Intronic
1062069790 9:134549495-134549517 CCTGGCCCTGTGCCCACCTGAGG - Intergenic
1062076405 9:134592393-134592415 ACTGGCCCTGGGCCCATGGGTGG + Intergenic
1062109088 9:134772390-134772412 GTTGGCCCTGTCCCCACTCGTGG + Intronic
1062264092 9:135678890-135678912 CCTGGGCCTGGCCTGACTGCGGG - Intergenic
1062382551 9:136294495-136294517 GCTGGCCCTGGCCCCCATGAAGG + Intronic
1062451240 9:136616648-136616670 CCTGGCCCTGGCCCTGGAGGGGG - Intergenic
1062460282 9:136660056-136660078 CCCTGCCCTGGCCGCTCTGGTGG - Intronic
1062474163 9:136719286-136719308 CCTGGCCCTTTGCCCAGTGGGGG + Intronic
1203622479 Un_KI270749v1:136656-136678 CCTGGCCCTAGCCCCGTTGCTGG + Intergenic
1185706413 X:2270574-2270596 CACGTCCCTGGCCCCAGTGGAGG + Intronic
1186355384 X:8784268-8784290 TCTTGCCCGGGCCCCGCTGGCGG + Intergenic
1187115574 X:16346848-16346870 CCTGGCACTGGTCCCTGTGGCGG + Intergenic
1187238183 X:17487818-17487840 CCTGGCACTCCCCACACTGGGGG - Intronic
1189062486 X:37769158-37769180 CCATGCCCTGCCCCCAGTGGTGG - Intronic
1190036500 X:47030033-47030055 ATTGCCCCTGGTCCCACTGGGGG + Intronic
1190255917 X:48762082-48762104 CCTGTCCCTGGCTAAACTGGGGG - Intronic
1190332910 X:49247037-49247059 ACAGGCCCTCGCCCCACTGTGGG + Intronic
1190783949 X:53625785-53625807 CCTGGCCCTGGCCCCCGTCCTGG - Intronic
1197693053 X:129523138-129523160 CCTGTGCCTGGCCCCTCTGAGGG - Intronic
1198214230 X:134542574-134542596 CATGGCCTTGGCTCCACTGCTGG - Intergenic
1200158218 X:153989549-153989571 GCTAGCCCAGGCCCCAGTGGAGG - Intergenic
1200215827 X:154367857-154367879 CCGGGCCCTGGGCGCCCTGGTGG - Exonic
1202583140 Y:26402794-26402816 CCTGGCCCTAGCCCCGTTGCTGG - Intergenic