ID: 1167512587

View in Genome Browser
Species Human (GRCh38)
Location 19:49903607-49903629
Sequence AGTAAACCCCAAAAATGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 441
Summary {0: 1, 1: 0, 2: 5, 3: 43, 4: 392}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167512587_1167512591 -4 Left 1167512587 19:49903607-49903629 CCCTGACATTTTTGGGGTTTACT 0: 1
1: 0
2: 5
3: 43
4: 392
Right 1167512591 19:49903626-49903648 TACTGAAAACTTGGGAGCAGTGG 0: 1
1: 0
2: 3
3: 24
4: 243
1167512587_1167512592 21 Left 1167512587 19:49903607-49903629 CCCTGACATTTTTGGGGTTTACT 0: 1
1: 0
2: 5
3: 43
4: 392
Right 1167512592 19:49903651-49903673 TGCTGAAGCTGAGTCATACCAGG 0: 1
1: 0
2: 1
3: 12
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167512587 Original CRISPR AGTAAACCCCAAAAATGTCA GGG (reversed) Intronic
901214166 1:7545507-7545529 TGTAATCTTCAAAAATGTCAAGG - Intronic
901406205 1:9048054-9048076 AGCCAACCCCAAAATTGTCCTGG + Intronic
902456908 1:16539995-16540017 AGTCACCCCCAAAAATGTTTTGG + Intergenic
902495261 1:16867918-16867940 AGTCACCCCCAAAAATGTTTTGG - Intronic
904100622 1:28023612-28023634 AGTACTCCTCAAAACTGTCAAGG + Intronic
904432564 1:30474248-30474270 AGTAAACCCCATTAAAGTCCAGG + Intergenic
907063423 1:51454619-51454641 AGTATTCTTCAAAAATGTCAAGG + Intronic
908005353 1:59722101-59722123 AGTACTCCTCAAAAATGTCAAGG - Intronic
909288057 1:73846269-73846291 AGCAAACCCCAAAATTGTTCCGG - Intergenic
909340854 1:74529406-74529428 TGTCATCCTCAAAAATGTCACGG + Intronic
909484263 1:76156039-76156061 AGTACTCCTCAAAACTGTCAAGG - Intronic
909721597 1:78777422-78777444 AGTAAAAAGAAAAAATGTCAAGG - Intergenic
909877750 1:80830195-80830217 AATAAAACCCCAAAATATCAGGG + Intergenic
910570088 1:88690807-88690829 AGTAAACACCTTAAATGTGAAGG + Intronic
910683213 1:89889266-89889288 AGTACTCCTCAAAACTGTCAAGG + Intronic
910953811 1:92679712-92679734 AGTACTCCTCAAAACTGTCAAGG - Intronic
915253840 1:154610240-154610262 GGTAAACCCCAAGAAGTTCATGG + Intronic
915632885 1:157165528-157165550 AGTACTCCTCAAAACTGTCAAGG + Intergenic
915683057 1:157601196-157601218 AGTACTCCTCAAAACTGTCAAGG - Intergenic
916248997 1:162717626-162717648 AGTAATCCTCAAAACTGTCAAGG - Intronic
916256938 1:162798422-162798444 AGTACTCCTCAAAACTGTCAAGG - Intronic
917145931 1:171891631-171891653 AGTACTCCTCAAAACTGTCAAGG - Intronic
917466510 1:175282241-175282263 AGTAATCTTCAAAACTGTCAAGG + Intergenic
917611022 1:176689157-176689179 TTTACACCCCAAAATTGTCAGGG - Intronic
918201490 1:182271439-182271461 AGTACTCCTCAAAACTGTCAAGG + Intergenic
918279761 1:182992786-182992808 AGTAATTCTCAAAAATATCAAGG + Intergenic
918856907 1:189767520-189767542 AGTAAACCTCATCAATGTGATGG - Intergenic
921083572 1:211765609-211765631 GGTAAACCCCCAAAGAGTCAAGG + Intronic
921802371 1:219416304-219416326 AGTACTCCTCAAAACTGTCATGG - Intergenic
922235968 1:223722966-223722988 AATATTCCCCAAAACTGTCAAGG - Intronic
922345677 1:224694350-224694372 AAGAAACCCTAAAACTGTCAGGG + Intronic
923644102 1:235798123-235798145 AGTACCCCTCAAAACTGTCAAGG + Intronic
1063026652 10:2185591-2185613 AGAAAAACACAAAAATGTCAGGG + Intergenic
1063640883 10:7829489-7829511 AATAATCCTCAAAACTGTCAAGG - Intronic
1064113083 10:12555073-12555095 TCCAAACCCCAAAAATTTCAAGG - Intronic
1065166022 10:22977939-22977961 AGTACTGCCCAAAAATGTCATGG - Intronic
1065288935 10:24210968-24210990 AGTATATCCCAAATATGGCATGG - Intronic
1065329189 10:24575760-24575782 AGTATAGTCTAAAAATGTCAAGG + Intergenic
1066295794 10:34053386-34053408 TGTAATCTTCAAAAATGTCAAGG + Intergenic
1066547807 10:36520073-36520095 AGTAATCTTCAGAAATGTCAAGG + Intergenic
1066723400 10:38364117-38364139 AGTACTCCTCAAAACTGTCAAGG - Intergenic
1068714189 10:60169305-60169327 AGTATACTGCAAAACTGTCAAGG - Intronic
1068867501 10:61909941-61909963 AGTCAACCCATAAAAAGTCAGGG + Intronic
1071175440 10:82921275-82921297 AGTAATTCTCAAAAGTGTCAAGG + Intronic
1071400205 10:85261373-85261395 AGTCAAACCCAAAGTTGTCATGG - Intergenic
1072315705 10:94200917-94200939 AGTAATTCTCAAAAATGTCAAGG + Intronic
1072707802 10:97694386-97694408 TGTATTCCTCAAAAATGTCAAGG + Intergenic
1073274259 10:102295225-102295247 ACTAAACTCAAAAACTGTCAAGG + Intronic
1073433881 10:103504362-103504384 AGTAATCCTCAAAACTGTCAAGG - Intronic
1073646221 10:105307080-105307102 AGTAAACCCAAAGAATGTATAGG - Intergenic
1074310735 10:112320948-112320970 AGTACTCCTCAAAAGTGTCAAGG + Intergenic
1074697067 10:116059173-116059195 AATAAAGCCCTTAAATGTCAAGG + Intronic
1074757515 10:116635894-116635916 AGTTCAACCCAAGAATGTCAAGG - Intronic
1074901772 10:117822931-117822953 AGTACACCTCAAAACTATCAAGG + Intergenic
1075703114 10:124482040-124482062 ACTGAATCCCAGAAATGTCAAGG - Intronic
1076368064 10:129935040-129935062 AGTACATCCCAAATATCTCATGG + Intronic
1076627227 10:131829520-131829542 AGTTATCACCAAAAATGTCATGG - Intergenic
1078494825 11:11806552-11806574 AGCAACTCCCAAATATGTCAGGG - Intergenic
1079990847 11:27245081-27245103 AGTACTCCTCAAAACTGTCAAGG + Intergenic
1084311842 11:68321555-68321577 AGCAAAACCCACAAATGTCAAGG - Intronic
1084577997 11:70002985-70003007 ACTAAACCCAAAAACTGTCGAGG + Intergenic
1085432946 11:76471580-76471602 AGTACTCCTCAAAATTGTCAAGG - Intronic
1085441529 11:76568278-76568300 AGTATTCCCCAAAACTGTCAAGG - Intergenic
1085810049 11:79671754-79671776 TGCAGACCCAAAAAATGTCAGGG - Intergenic
1085996673 11:81925069-81925091 AGTACTCCTCAAAACTGTCAAGG - Intergenic
1086128173 11:83371331-83371353 AGTACTCCTCAAAACTGTCAAGG - Intergenic
1087711946 11:101564366-101564388 AGTAAAGCTCAAAAATTCCATGG - Intronic
1088124122 11:106403616-106403638 AGTACTCTCCAAAACTGTCAAGG - Intergenic
1088925638 11:114298412-114298434 AGTAAACCCCCAAATTTTCCAGG + Intronic
1090448354 11:126784048-126784070 AGTACTCCCCAAAATTGTGAAGG + Intronic
1090940118 11:131380053-131380075 AGGAAACCCCAAAGAGGCCATGG - Intronic
1091092666 11:132787154-132787176 AATAAACCTCAAATATGTCCTGG + Intronic
1091855294 12:3734399-3734421 ACTAAACCCTGAAAATGGCATGG + Intronic
1094300880 12:28964072-28964094 AGTTTACCTCAAAACTGTCAAGG + Intergenic
1096017266 12:48288278-48288300 AGTAATCCTCAAAACTCTCAAGG - Intergenic
1097062494 12:56296004-56296026 TGTAAATCCCTAAAGTGTCAGGG - Intronic
1097063162 12:56300620-56300642 AGATAACCCCAAAAGTGTTAAGG - Intronic
1097537116 12:60886131-60886153 AGTTACCCCCAAAAAAGTCCAGG - Intergenic
1097723453 12:63048722-63048744 AGTACTCCTCAAAACTGTCAAGG - Intergenic
1098888562 12:75984440-75984462 AGTATGCCCCAAATATGGCATGG + Intergenic
1098902964 12:76131903-76131925 AGTAAAACCCCAAAAGGACAGGG - Intergenic
1099349219 12:81543921-81543943 AGTATACTTCAAAACTGTCAAGG + Intronic
1099380063 12:81941914-81941936 ATTAGACCCCAAAAATGCTAAGG - Intergenic
1099909650 12:88813932-88813954 AGCACACCCCAAAAGGGTCAAGG - Intergenic
1100083890 12:90883635-90883657 AGTGCACCTCAAAATTGTCAAGG + Intergenic
1100752264 12:97711569-97711591 AGTACTCCTCAAAACTGTCACGG + Intergenic
1101177764 12:102173471-102173493 AGAAAACTCCAAGAATGTAAAGG + Intronic
1104332115 12:127856642-127856664 AGTATATCCCAAATATTTCATGG - Intergenic
1105330156 13:19408648-19408670 AGTACACCCCAAAATTATCTGGG - Intergenic
1105548934 13:21374383-21374405 AAAAAACCCCAAAACTGTCCAGG - Exonic
1105786056 13:23750410-23750432 AGTACTCCTCAAAACTGTCAAGG - Intronic
1105949355 13:25215517-25215539 AGGACTCCCCAAAACTGTCAAGG + Intergenic
1106672368 13:31920281-31920303 CGAAAACCCTAAAAAAGTCATGG - Intergenic
1106867101 13:33977095-33977117 AGTATTCCTCAAAACTGTCAAGG + Intergenic
1107250822 13:38360338-38360360 AATTGACCCCAAATATGTCAGGG + Intronic
1107699485 13:43033611-43033633 AGTAAGCCTCAAACCTGTCAAGG - Intronic
1109699155 13:66002947-66002969 AGCAAAACCCCAAAATGTTAAGG + Intergenic
1110205086 13:72902525-72902547 AGTAAACCCCCAAAATAAAATGG + Intronic
1112550628 13:100417378-100417400 TGTAAACTCCAAAAAAGACATGG - Intronic
1112918841 13:104584974-104584996 ACTAAAACCCTAAAATGTTAGGG - Intergenic
1113980743 13:114273021-114273043 AGTACTCCTCAAAACTGTCAAGG - Intergenic
1115875363 14:37855034-37855056 TATAATCACCAAAAATGTCAAGG - Intronic
1116056556 14:39871491-39871513 AATAGACCCCAAAGATGTCTGGG + Intergenic
1116994183 14:51305135-51305157 AGTCAAAACCACAAATGTCAGGG - Intergenic
1117466369 14:55998907-55998929 AGTAAAACACAAAGATGTGATGG - Intergenic
1117858106 14:60056923-60056945 ACTAAACCCCCAAAATGTTTTGG - Intronic
1118231793 14:63958373-63958395 AGTAATCTCTAAAACTGTCAAGG - Intronic
1118722441 14:68604071-68604093 TGTAACTCCCAAAAATGTGAAGG + Intronic
1118905721 14:70021841-70021863 AGCAAACCCCAGAGAAGTCAGGG + Intronic
1118906205 14:70025317-70025339 AGTAAACCCAAAGAATAGCATGG + Intronic
1119221719 14:72914045-72914067 TGTAATCTCCAAAAATGTGAAGG - Intergenic
1120224968 14:81780449-81780471 AGTACTCCCCAAAACTGTCAAGG - Intergenic
1121560093 14:94868284-94868306 AGTAAAACCCATAAATGGCTTGG + Intergenic
1121677205 14:95763196-95763218 AGTAATCATCAAAACTGTCAAGG + Intergenic
1121891508 14:97596233-97596255 AGTAAAACTAAAAAATCTCATGG + Intergenic
1121976772 14:98411907-98411929 AGTAAACAAGAAAAATGTGAAGG + Intergenic
1122029777 14:98903665-98903687 ATTAAACCCCAAGCATGGCAAGG - Intergenic
1123909019 15:24948690-24948712 AGTAATCCCCAAAACTGTCAAGG - Intronic
1124162938 15:27290644-27290666 AGTACCCCTCAAAACTGTCAAGG + Intronic
1124172874 15:27392354-27392376 AGTCATCCCCAAAAATGTCAGGG - Intronic
1124656516 15:31513553-31513575 TGTAATCTTCAAAAATGTCAAGG - Intronic
1125445646 15:39752620-39752642 AGTACTCCTCAAAACTGTCAAGG + Intronic
1125909034 15:43419780-43419802 AGGACTCCCCAAAACTGTCAAGG + Intronic
1126212033 15:46110946-46110968 AGTACTCCTCAAAACTGTCAAGG - Intergenic
1126232858 15:46347389-46347411 ATTAATCCTCAAAACTGTCAAGG - Intergenic
1126506187 15:49406774-49406796 AGCAAACCCCAAACATGTACCGG - Intronic
1127048321 15:55051652-55051674 AGTAAACGTTAAGAATGTCATGG - Intergenic
1127405375 15:58638842-58638864 AGTACTCCTCAAAACTGTCAGGG + Intronic
1127953202 15:63830403-63830425 AGTACTCATCAAAAATGTCAAGG + Intronic
1128361720 15:66966422-66966444 AATACACCTCAAAACTGTCAAGG - Intergenic
1128505951 15:68272867-68272889 AGTAAGCCCCTAATAAGTCATGG - Intergenic
1129634583 15:77301503-77301525 AGTAATCCTCAGAACTGTCAAGG - Intronic
1130180192 15:81619196-81619218 AGTACACCCCAAAACTGTCAAGG - Intergenic
1130426810 15:83809658-83809680 AATAAACACATAAAATGTCATGG - Intronic
1132174046 15:99694171-99694193 AGTACTCCTCAAAACTGTCAAGG - Intronic
1135023539 16:18982237-18982259 AGTATTCCTCAAAACTGTCAAGG - Intergenic
1135482447 16:22832419-22832441 TGTGAACCCCCAAAATGTGAGGG - Intronic
1137223436 16:46479242-46479264 AGTAAACCTCAAAAGTCACATGG - Intergenic
1138221341 16:55253958-55253980 AGTATTCCTCAAAATTGTCAAGG + Intergenic
1139060881 16:63250140-63250162 AGTAATCCTCAAAAATGTCAAGG + Intergenic
1139240484 16:65386738-65386760 AATAAACCTCAAAAACTTCAGGG + Intergenic
1141423731 16:83932611-83932633 AGTAACCCCCAAACGTGTCCTGG + Intronic
1141576703 16:84968590-84968612 AGTAAACCCCAAGGAGGTGAGGG - Intergenic
1143945361 17:10586985-10587007 AGTACTCCTCAAAACTGTCAAGG - Intergenic
1144232127 17:13218104-13218126 AGTATTCCTCAAAACTGTCAAGG + Intergenic
1145085020 17:19930418-19930440 AAAAAACCCAAAAAAGGTCAAGG + Intronic
1146007862 17:29172752-29172774 AGTAAAGCCCAAAGAAGTGAAGG + Intronic
1146556466 17:33829019-33829041 AGTAAACCACACACATCTCAGGG - Intronic
1146588697 17:34107811-34107833 ATTAAAGCCGAAAAATGTAAAGG - Intronic
1147905494 17:43820026-43820048 AGTTGAGCCCAAAAAGGTCAAGG - Intronic
1148532892 17:48411814-48411836 AGTACTCCTCAAAACTGTCAAGG + Intronic
1151179320 17:72314551-72314573 AGTACTCCTCAAAACTGTCAAGG - Intergenic
1151409316 17:73910958-73910980 AGCATGCCCCAAAACTGTCAAGG + Intergenic
1153738591 18:8099025-8099047 AATAAACCCACAAAATGGCATGG - Intronic
1155640838 18:28012159-28012181 AGTATAACCCAAAAATTTTATGG - Intronic
1155647646 18:28099204-28099226 TGTAAACACCAAAATTGTAAAGG - Intronic
1157157400 18:45281222-45281244 AGTAAACTCCAAGAATAGCAGGG - Intronic
1158639401 18:59190505-59190527 AATAAACCCCACACATTTCAAGG - Intergenic
1158988266 18:62841654-62841676 AGTATTCCTCAAAACTGTCAAGG - Intronic
1159391327 18:67796214-67796236 TGGAAACACAAAAAATGTCATGG - Intergenic
1159822639 18:73165588-73165610 AGTAAACCCCCAAACTGCCAGGG + Intronic
1160380401 18:78450400-78450422 AGTACATCTCAAAACTGTCAAGG + Intergenic
1160556077 18:79726276-79726298 ACTAAAACCAAAAAATGTCCTGG - Intronic
1161655021 19:5508939-5508961 AGTATACCCCAAATATTGCATGG - Intergenic
1162305987 19:9874273-9874295 AGTAATCCTCAAAACTGTCAAGG - Intronic
1164775161 19:30847198-30847220 AGTACTCCTCAAAATTGTCAAGG + Intergenic
1166039623 19:40193854-40193876 AGTTAAGCCCCAAAATGTGAAGG + Intronic
1166797271 19:45434406-45434428 ACTTGAGCCCAAAAATGTCAAGG + Intronic
1167198317 19:48046196-48046218 TGTAAGCTTCAAAAATGTCAAGG + Intergenic
1167512587 19:49903607-49903629 AGTAAACCCCAAAAATGTCAGGG - Intronic
1168504507 19:56921870-56921892 ATAAAACCCCAAAAAGGACAGGG + Intergenic
925660749 2:6199744-6199766 AGTATATCTCAAAATTGTCAGGG - Intergenic
927350294 2:22104328-22104350 AGTGCCCCCCAAAACTGTCAAGG + Intergenic
928183378 2:29086932-29086954 AGTATTCCTCAAAACTGTCAAGG - Intergenic
929162099 2:38842237-38842259 AATAATCTTCAAAAATGTCAAGG + Intronic
929504673 2:42519280-42519302 AGTACTCCTCAAAACTGTCAAGG + Intronic
929767684 2:44861615-44861637 AATAATCCCCTTAAATGTCAAGG + Intergenic
930667081 2:54110046-54110068 AGTAATCCTCAAAACTGTCAAGG - Intronic
930963922 2:57296493-57296515 AGTTTTCGCCAAAAATGTCAAGG + Intergenic
932210772 2:69928051-69928073 ATTAATCCCTTAAAATGTCAAGG - Intronic
932858590 2:75265320-75265342 ATCAAACTCCAAAAAGGTCAAGG - Intergenic
933068666 2:77831876-77831898 AGGAAACCCCAGACATTTCATGG - Intergenic
933481050 2:82857665-82857687 TGAAAAGCCCGAAAATGTCAAGG - Intergenic
935304438 2:101723193-101723215 TGTAATCCCCATAAATTTCAAGG - Intronic
936226025 2:110653133-110653155 AGTACTCCTCAAAACTGTCAAGG - Intronic
937778932 2:125814278-125814300 TGAAAACCCCAAAAAGTTCATGG + Intergenic
937943491 2:127309672-127309694 AGTACTCCTCAGAAATGTCATGG - Intronic
938704407 2:133910338-133910360 ATTAAACCCCAAAAAAGAAAAGG + Intergenic
939161296 2:138592853-138592875 AGTAATCTTCAAAAATGTCAAGG - Intergenic
939605475 2:144249768-144249790 ACTCAAAACCAAAAATGTCAGGG + Intronic
939681284 2:145136886-145136908 AGTACACCTCAAAATTGTCAAGG + Intergenic
940294331 2:152106614-152106636 AGTACTCCTCAAAATTGTCAAGG + Intergenic
941270750 2:163424753-163424775 AATAATCCTCAAAACTGTCAGGG + Intergenic
941543190 2:166812671-166812693 AGTACTCCTCAAAACTGTCAAGG + Intergenic
941763926 2:169275488-169275510 AGTAAATTCCAAAAAAGTCTAGG - Intronic
941774065 2:169372756-169372778 AGTACTCCTCAAAACTGTCAAGG - Intergenic
941977181 2:171418311-171418333 AGTATACCTCAAAACTGTCAAGG - Intronic
942655587 2:178211290-178211312 ACGAAAACCCAAAAAAGTCAAGG + Intronic
943430556 2:187795850-187795872 AGAAAATACCAAAAATGGCAAGG + Intergenic
943896338 2:193366548-193366570 AGAAAAACAGAAAAATGTCAAGG + Intergenic
943994386 2:194740708-194740730 AGTAACACTCAAAACTGTCAAGG + Intergenic
944293477 2:198034864-198034886 TGTACACTTCAAAAATGTCAAGG - Intronic
944692722 2:202172116-202172138 AGTAAATGCCAAAAATGGCCAGG - Intronic
944757967 2:202783548-202783570 TGTACACTGCAAAAATGTCAAGG + Intronic
945729903 2:213520945-213520967 AGAAAGACCCAAAAATGTCAAGG - Intronic
946575957 2:221075776-221075798 AGTAAAACCAAAAAAGCTCAAGG - Intergenic
946867168 2:224052333-224052355 AGTACACCTCAGAACTGTCAAGG - Intergenic
1168991519 20:2100326-2100348 AGTATTCTTCAAAAATGTCAAGG + Intergenic
1169808322 20:9582334-9582356 AGTACTCCTCAAAACTGTCAAGG - Intronic
1170089728 20:12577393-12577415 AGTAGTCCCCAAAACTGTCAAGG + Intergenic
1170605010 20:17869337-17869359 AGTAAATACCCAAAGTGTCATGG - Intergenic
1171326620 20:24300032-24300054 AGAAAACCACCAAAATTTCATGG - Intergenic
1172763569 20:37338606-37338628 AGTATTCCTCAAAACTGTCAGGG - Intergenic
1172980035 20:38934270-38934292 AGCAAAACCCAAAAATGTAGTGG + Intronic
1173714026 20:45186227-45186249 AGTACTCCTCAAAACTGTCAAGG - Intergenic
1174954149 20:55077743-55077765 AGTATACCTCAAAACTGTCAAGG - Intergenic
1177529806 21:22344441-22344463 AGATAACAGCAAAAATGTCATGG - Intergenic
1177845187 21:26280677-26280699 ACTAAAGCATAAAAATGTCATGG + Intergenic
1178171380 21:30044092-30044114 AGTAATATCCAAAAATGGCATGG + Intergenic
1178412158 21:32373646-32373668 TGTGAACCCAGAAAATGTCAAGG - Exonic
1180686650 22:17672816-17672838 AGCAAATGACAAAAATGTCATGG - Intronic
1181809720 22:25396003-25396025 AGCAAAACCCACAAATGTCAAGG + Intronic
1183250069 22:36724194-36724216 AGTAAACCACAAAAAAGGCCAGG + Intergenic
1183804804 22:40199533-40199555 TGTAATCCTCAAAAATTTCAGGG + Intronic
1184312297 22:43654604-43654626 AGTAATCCTCAGAACTGTCAAGG + Intronic
1184376341 22:44116156-44116178 AGTAATCCTCAAAACTGTCAAGG - Intronic
949697867 3:6720179-6720201 AGTACTCCTCAAAACTGTCAAGG + Intergenic
949868184 3:8563948-8563970 AGTACTCCTCAAAACTGTCATGG + Intronic
950236878 3:11329977-11329999 AGTACTCCTCAAAAATGTCAAGG - Intronic
952014889 3:28944739-28944761 ACTAATCCTCAAAACTGTCAAGG - Intergenic
952280860 3:31922013-31922035 AGTAGTCCTCAAAACTGTCAAGG + Intronic
952611778 3:35218447-35218469 AGTATACCTGAAAACTGTCAAGG - Intergenic
953567015 3:44041424-44041446 GGTAAACCCCAAAATTGTAGTGG + Intergenic
955240755 3:57176053-57176075 AGTATACCTCAAAACTGTCAAGG - Intergenic
958666618 3:97147742-97147764 AGTACACCCTAAGACTGTCAAGG + Intronic
959348535 3:105231112-105231134 AGTAATCCTCAAAACTGTCATGG - Intergenic
959612363 3:108309547-108309569 ATTATACCTCAAAACTGTCAAGG - Intronic
963161484 3:142155028-142155050 AGTACACTTCAAAAATGTCAAGG + Intergenic
963933645 3:151030162-151030184 AGTCAACCTCAAAAATGTGAGGG + Intergenic
964095161 3:152922858-152922880 AGTACTCCTCAAAATTGTCATGG + Intergenic
964327985 3:155567950-155567972 AGAAAAGCCCAAATATGTCATGG + Intronic
965202577 3:165678267-165678289 AGTCAATTCCCAAAATGTCATGG + Intergenic
965509504 3:169552902-169552924 AGCAAACCAAAAAAATGCCAAGG + Intronic
966544156 3:181125792-181125814 AGTATTCCTCAAAACTGTCAAGG - Intergenic
967324613 3:188226717-188226739 ACTACACCACAAATATGTCAAGG - Intronic
967854602 3:194107154-194107176 AGTAAGCTTCCAAAATGTCAGGG - Intergenic
968146507 3:196303640-196303662 AGTACTCCTCAAAAAAGTCAAGG + Intronic
969944364 4:10767952-10767974 ATTAAACACCTAAAATGTCCTGG - Intergenic
971541217 4:27819219-27819241 AGTCAACTCCAAATATGTCCAGG + Intergenic
972122550 4:35723467-35723489 AGTACACCTCAAAATTGTCAAGG + Intergenic
972191212 4:36593473-36593495 AGTACTCCCCAAAACTATCAAGG + Intergenic
972192512 4:36612101-36612123 ATTAGACCCCAAAAATGCTAAGG + Intergenic
972877461 4:43381214-43381236 AATAAACTTCAAGAATGTCAAGG + Intergenic
973747738 4:53980725-53980747 CAAAAACCCCAAAAATGGCAGGG + Intronic
973908658 4:55556640-55556662 AGAAAACCCCAGAAAAGACATGG - Exonic
974208171 4:58734626-58734648 AGTAATTCCCAAGAATTTCAAGG - Intergenic
974451804 4:62072624-62072646 AGTAAACCAGAAAAATGGAATGG + Intronic
974678835 4:65134796-65134818 AGAAAACCCCAAACATTTCAAGG + Intergenic
974777602 4:66506706-66506728 AGTATTCCTCAAAACTGTCAAGG + Intergenic
975140447 4:70913108-70913130 TGTAATCCTCAAAAATGTAAAGG - Intronic
975200559 4:71583228-71583250 AGTATTCTCCAAAATTGTCAGGG + Intergenic
975213251 4:71725214-71725236 AGTACTCCTCAAAACTGTCAAGG - Intergenic
975234298 4:71973321-71973343 AGTATTCCTCAAAATTGTCAAGG - Intergenic
975624921 4:76336414-76336436 ATAAAACCACAAAAATATCAAGG + Intronic
975953473 4:79804915-79804937 ACAAAATCCCAAAAATCTCAAGG + Intergenic
976158280 4:82171527-82171549 AGTAACCACCAAAAATTTTAAGG - Intergenic
976487914 4:85629881-85629903 AGAAAACCCCAAATTTGTCAAGG - Intronic
976579586 4:86720273-86720295 AAGGAACCTCAAAAATGTCAAGG + Intronic
977032372 4:91901673-91901695 ATTAAACACCACAACTGTCATGG + Intergenic
977112548 4:92977311-92977333 AGTCAACCACAAAAATTTCTGGG + Intronic
978530889 4:109711993-109712015 AGTACTCCTCAAAACTGTCAAGG + Exonic
978845700 4:113270046-113270068 AGGAAACCAGAAAAATGTTATGG - Intronic
979155231 4:117378820-117378842 AGTAATTCTCAAAACTGTCAGGG + Intergenic
979343385 4:119555819-119555841 AGGAAAACCTAAAAATTTCAAGG - Intronic
979643969 4:123045524-123045546 TGTAATCTACAAAAATGTCAAGG - Intronic
980624330 4:135353936-135353958 AGTAAACCCCAATAATTTAATGG - Intergenic
981262959 4:142744478-142744500 AGAAATCCCCAAACACGTCATGG + Intronic
981861925 4:149365782-149365804 GGTAATCCTCAAAACTGTCAAGG + Intergenic
982427987 4:155288591-155288613 AGTAATCTTCAAAACTGTCAAGG + Intergenic
983613308 4:169674205-169674227 TGTACTCTCCAAAAATGTCAAGG - Intronic
984067444 4:175065832-175065854 AGCTAACACCAAAAATGTAAAGG + Intergenic
984334242 4:178368106-178368128 ATCCAACCCCATAAATGTCAAGG + Intergenic
984929171 4:184831412-184831434 AGTATGCCTCAAAACTGTCAAGG - Intergenic
985272641 4:188208700-188208722 AGTACTCCTCAAAACTGTCAAGG - Intergenic
985565962 5:617490-617512 AGGAAACCACAAGACTGTCACGG + Intronic
985715623 5:1458130-1458152 TGTAAACCAATAAAATGTCAGGG - Intronic
986848026 5:11778596-11778618 AGTACTCCCCAAAACTGTCAAGG + Intronic
986947228 5:13037690-13037712 AGTACTCCCCAAAATTCTCAAGG + Intergenic
987057777 5:14211010-14211032 AGCAATTTCCAAAAATGTCAAGG - Intronic
987661180 5:20878699-20878721 GATGAACCTCAAAAATGTCATGG + Intergenic
988508435 5:31844564-31844586 AGTAGATCCCAAAAATCACATGG - Intronic
989270667 5:39528707-39528729 AGAAAACACAAAAAATGTGAAGG - Intergenic
990263736 5:54053730-54053752 AGTACACCTCAAAACTGTCAAGG + Intronic
990711059 5:58581348-58581370 TGCAAACCTCAAAAATGTCACGG - Intergenic
990752027 5:59027112-59027134 AGTACTCCTCAAAACTGTCAAGG - Intronic
991221253 5:64222103-64222125 AGTACTCCTCAAAACTGTCAAGG - Intronic
991288450 5:65007247-65007269 AGTATTCCTCAAAACTGTCAAGG + Intronic
992062461 5:73068056-73068078 TGTAAACACCAAAAGTGTAAAGG + Intronic
992340399 5:75817305-75817327 AGTACTCCTCAAAACTGTCAAGG + Intergenic
993811791 5:92488697-92488719 AGTAATCCTCAAGACTGTCAAGG + Intergenic
994124440 5:96153532-96153554 ATTGGGCCCCAAAAATGTCAGGG + Intergenic
994521315 5:100840684-100840706 AGAAAGCTCCAAAAATGTTATGG - Intronic
994915649 5:105974656-105974678 AGTAAATGTCAAAAATGTTAAGG + Intergenic
995068992 5:107896028-107896050 TTCACACCCCAAAAATGTCAGGG - Intronic
996261634 5:121477935-121477957 AATAAAACCCACAAATGGCAAGG + Intergenic
996810195 5:127507891-127507913 AGTATTCCTCAAAACTGTCACGG - Intergenic
999113293 5:149140854-149140876 ATTAAACCCAGAAAATGTCTGGG + Intergenic
999833706 5:155346271-155346293 TGTAATCCCCAACAGTGTCAAGG - Intergenic
1000318520 5:160115882-160115904 AGTAAACCCCAAAACTGCACAGG + Intronic
1000594555 5:163199382-163199404 AGTACTCCTCAAAACTGTCAAGG + Intergenic
1002338684 5:178499538-178499560 AGTACTCCTCAAAACTGTCAAGG + Intronic
1003754607 6:9102714-9102736 AGTACTCTTCAAAAATGTCAAGG - Intergenic
1006195519 6:32238992-32239014 AGTACACCTCAAAACTATCAAGG - Intergenic
1008112806 6:47511325-47511347 AGTACTCCTCAAAAATGTCAAGG + Intronic
1008858620 6:56122111-56122133 AATGACCCACAAAAATGTCATGG + Intronic
1009198696 6:60718463-60718485 AGTAAATTCCTCAAATGTCAGGG - Intergenic
1009244299 6:61216597-61216619 AGTAGTCTCCAAAACTGTCAAGG - Intergenic
1010028503 6:71246719-71246741 GCCAAAACCCAAAAATGTCATGG - Intergenic
1010200979 6:73281884-73281906 AGTATGCCTCAAAACTGTCAAGG - Intronic
1010324772 6:74551459-74551481 ATTAAACCCAAACTATGTCAAGG - Intergenic
1010543577 6:77123099-77123121 AGTACCCCTCAAAATTGTCAAGG + Intergenic
1010710266 6:79165624-79165646 AGTACTCCTCAAAACTGTCAAGG + Intergenic
1011104364 6:83762529-83762551 AGTAAAGCAAAAAAATGTGAAGG + Intergenic
1011364515 6:86567022-86567044 AGTATTCCTCAAAAATGTCAGGG + Intergenic
1011425336 6:87222866-87222888 AGTACTCCTCAAAACTGTCAAGG - Intronic
1011897233 6:92243998-92244020 AGTAGCCCTCAAAACTGTCAAGG - Intergenic
1012809297 6:103937569-103937591 AGCAATCCCCTAAACTGTCAAGG + Intergenic
1013323989 6:109026020-109026042 AGTAAAACTGAAAAATTTCAAGG + Intronic
1013674839 6:112446983-112447005 CGTAAGCCTCAAAACTGTCAAGG + Intergenic
1013700981 6:112769268-112769290 AATTAACTCCAAAAATCTCAGGG + Intergenic
1014324013 6:119968153-119968175 AGTAATCCTCAAAGCTGTCAAGG + Intergenic
1014342061 6:120222877-120222899 GGTAAACCCACAAAATGTCTTGG + Intergenic
1014491773 6:122071356-122071378 AGTATTCCTCAAAACTGTCAAGG - Intergenic
1014791706 6:125679808-125679830 AGGAAACCACAAAAATAACAGGG + Intergenic
1015876459 6:137827710-137827732 AGTAATCCTCAAAACTATCAAGG - Intergenic
1016058697 6:139605619-139605641 TGCAAACCACTAAAATGTCAAGG + Intergenic
1016582903 6:145649439-145649461 ATTATACCCTAAAAAAGTCAGGG + Intronic
1016852747 6:148638101-148638123 GGTAAAACCCACAAAAGTCAGGG - Intergenic
1016866016 6:148767168-148767190 TGTAAACAACAAATATGTCAGGG + Intronic
1017203817 6:151783869-151783891 AGTATTCCTCAAAACTGTCAAGG - Intronic
1017643114 6:156513428-156513450 AGTCAATCCCAAAGATGTCTGGG + Intergenic
1018670396 6:166172223-166172245 AGTAAAAACCAAAAGTGACATGG - Intergenic
1020410015 7:7881778-7881800 AGTACTCCTCAAAACTGTCAAGG - Intronic
1020590452 7:10130229-10130251 AATAAACCCAAAATATGGCAAGG + Intergenic
1021396724 7:20158515-20158537 TGTACACTGCAAAAATGTCAAGG - Exonic
1021515949 7:21487477-21487499 AGTAAACTTAAAAAATTTCATGG - Intronic
1021575448 7:22101856-22101878 GGAAAAACCCAAACATGTCAAGG - Intergenic
1021757145 7:23862704-23862726 AGTAAAATCTAAAAATGTCTAGG + Intergenic
1022782278 7:33598332-33598354 AGTACTCCTCAAAACTGTCAAGG + Intronic
1022997636 7:35774172-35774194 AGTACTCCTCAAAACTGTCAAGG + Intergenic
1023532586 7:41173914-41173936 ATTAAACCTTAAAAATGTCTGGG + Intergenic
1023902774 7:44496566-44496588 AGTACTCCTCAAAACTGTCAAGG + Intergenic
1028406225 7:90477573-90477595 AGTAGTCCTCAAAACTGTCAAGG + Intronic
1029097280 7:98097927-98097949 AGTAGTCTTCAAAAATGTCAAGG - Intergenic
1029631323 7:101752554-101752576 AGTATATCCCAAATATTTCATGG - Intergenic
1030716807 7:112817121-112817143 TGTAAACCATAAAAATGGCAGGG - Intergenic
1030824493 7:114138762-114138784 AGTACTCCTCAAAACTGTCAAGG + Intronic
1031497175 7:122464722-122464744 AGTACTCCTCAAAACTGTCAAGG + Intronic
1031570755 7:123356388-123356410 AGTAAATCTCAAAAATACCAGGG - Intergenic
1032302918 7:130706143-130706165 AGTAAACCCAAAAAATAAGAAGG - Intergenic
1033970865 7:147037712-147037734 AGAAAACTCTAAAATTGTCAGGG - Intronic
1034057158 7:148047545-148047567 AAAAAAGCACAAAAATGTCAGGG + Intronic
1035740263 8:1922471-1922493 AGCATCCTCCAAAAATGTCAGGG + Intronic
1036951029 8:13139450-13139472 ACTAAACCCTAGAAAAGTCAGGG + Intronic
1037039581 8:14214250-14214272 AGTAATTCTCAAAACTGTCAAGG + Intronic
1037178985 8:15981732-15981754 TGTACTCTCCAAAAATGTCAAGG - Intergenic
1037408122 8:18565521-18565543 AGCAAAGCCCACAAATGACAGGG + Intronic
1038741003 8:30216778-30216800 AGTACTCCTCAAAACTGTCAAGG + Intergenic
1039007027 8:33050819-33050841 AGTAGATCCCATAAATGTCAGGG - Intergenic
1039384626 8:37123394-37123416 GGTAATCCTCAAAACTGTCAAGG + Intergenic
1040457799 8:47616977-47616999 AGTAATCCTCAAAATTGTCCTGG - Intronic
1040683407 8:49841562-49841584 AGTATTCCTCAAAACTGTCAAGG - Intergenic
1041088098 8:54275367-54275389 AGTACTCCTCAAAACTGTCAAGG - Intergenic
1041635762 8:60141463-60141485 AGTACTCCTCAAAATTGTCAAGG + Intergenic
1042343356 8:67703397-67703419 AGGAAACCCCAAATATTTCATGG - Intronic
1042949884 8:74189962-74189984 AGTACTCCTCAAAACTGTCAAGG - Intergenic
1043338552 8:79208045-79208067 AGTACATCTCAAAACTGTCAAGG - Intergenic
1043888995 8:85635332-85635354 TGTAAACCCCACAAATGCAAAGG - Intergenic
1044377064 8:91487712-91487734 AGAAAATCCCAAATATGTTATGG + Intergenic
1044447286 8:92293668-92293690 AGTATCCCCAAAAAATGTAAAGG - Intergenic
1044568590 8:93692876-93692898 AGTACACCTCAAAACTGTCAAGG - Intergenic
1044651776 8:94503498-94503520 AGTACTCTCCAAAAATGTCAAGG + Intronic
1045112629 8:98948824-98948846 AGAAAGCCCTAAAAATGGCAGGG - Exonic
1046172251 8:110525862-110525884 AGTACTCCTCAAAACTGTCAAGG + Intergenic
1046179057 8:110618764-110618786 AGTATACTTCAAAACTGTCAAGG - Intergenic
1046324658 8:112625875-112625897 GGTAATCATCAAAAATGTCAAGG - Intronic
1046584704 8:116136836-116136858 AGTATGTCCCAAAAATGTCATGG - Intergenic
1046597342 8:116275963-116275985 AGTAAACACCAGTAATGACATGG - Intergenic
1046681121 8:117171355-117171377 AGTCAGCCCCAAGAATGTCGTGG - Intronic
1046746010 8:117876869-117876891 AGTAAACAACAAAATTGTAAAGG + Intronic
1047038775 8:120969736-120969758 AGGTAAACTCAAAAATGTCACGG - Intergenic
1047775735 8:128068785-128068807 AATAAACCCCAAAACTGGCCGGG - Intergenic
1048092595 8:131257496-131257518 AGTACTCCTCAAAATTGTCAAGG + Intergenic
1048117084 8:131535641-131535663 AGTAATCATCAAAACTGTCACGG - Intergenic
1049131177 8:140844020-140844042 AGTACTCCTCAAAACTGTCAAGG - Intronic
1049753774 8:144298642-144298664 GGTAAACCACAAAATTGTCCAGG + Intronic
1050072410 9:1829529-1829551 AGTAATCCTCAAAGCTGTCAAGG + Intergenic
1050140022 9:2507781-2507803 AGTATTCCTCAAAAAAGTCAAGG - Intergenic
1050227752 9:3479980-3480002 AGGAAAGACCAAAACTGTCAAGG + Intronic
1050513495 9:6418202-6418224 AAAAAACCCCAAAAAACTCAAGG - Intronic
1050548324 9:6727894-6727916 AGTAAACCCCAAAAAGCAAATGG + Intronic
1051067819 9:13125815-13125837 AGTATACAACAAAAAAGTCAAGG + Intronic
1051261138 9:15265889-15265911 AGTACTCCTCAAAACTGTCAAGG + Intronic
1051616251 9:19009810-19009832 AGAAAACCCCAAAACTTTAATGG - Intronic
1051814127 9:21085190-21085212 AGTACTCCTCAAAACTGTCAAGG + Intergenic
1053473759 9:38366591-38366613 TGGAAACCACATAAATGTCAAGG + Intergenic
1053653215 9:40190162-40190184 AGTAATCTTCAAAAGTGTCAAGG + Intergenic
1053903618 9:42819452-42819474 AGTAATCTTCAAAAGTGTCAAGG + Intergenic
1054531367 9:66186056-66186078 AGTAATCTTCAAAAGTGTCAAGG - Intergenic
1055317822 9:75051698-75051720 AGTAACTACCCAAAATGTCATGG - Intergenic
1055448783 9:76411289-76411311 AAAAAACCCCCAAAATGGCAGGG - Intergenic
1056451932 9:86724700-86724722 AGTACCTCCCAAAATTGTCAAGG + Intergenic
1056892025 9:90503150-90503172 AGTATTCCTCAAAACTGTCAAGG - Intergenic
1057746188 9:97753413-97753435 AGTATTCTTCAAAAATGTCAAGG - Intergenic
1058197358 9:101994565-101994587 AAGAAAACCCAAAAATGTGAGGG + Intergenic
1058212519 9:102187732-102187754 AGTACTCTTCAAAAATGTCAAGG - Intergenic
1058527729 9:105877100-105877122 AATATACCTCAAAACTGTCAAGG + Intergenic
1060676061 9:125515861-125515883 AGCAAGCCCCAAAACTGTGAAGG + Intronic
1060683637 9:125587901-125587923 AAAAAACCCCAAAAATAGCAAGG + Intronic
1060900930 9:127257544-127257566 AGTGAACCACATAAATTTCAGGG + Intronic
1186323497 X:8454386-8454408 AGTACTCCTCAAAATTGTCAAGG + Intergenic
1186552146 X:10517383-10517405 AGGAAACTCCAAAAAGGCCATGG - Intronic
1186745655 X:12565570-12565592 AGTACTCCTCAAAACTGTCAAGG + Intronic
1188257062 X:27975954-27975976 AGTACACTACAAAACTGTCAAGG + Intergenic
1188424303 X:30028945-30028967 AGTAAACCGCAAAGATATCCTGG - Intergenic
1189626482 X:42902674-42902696 AGCAATCCTCAAAACTGTCAAGG + Intergenic
1191703916 X:64072558-64072580 ATTAAACTCCCAAAAGGTCAAGG + Intergenic
1192269754 X:69567640-69567662 AAAAAACCCCACAAAAGTCATGG + Intergenic
1193476145 X:81968482-81968504 AGTAAAACTCAAAAATTTAAAGG - Intergenic
1193855819 X:86600322-86600344 AGTAAACCCAAAAGTTTTCATGG - Intronic
1194393754 X:93354160-93354182 AATAAATCTCCAAAATGTCAGGG + Intergenic
1194849792 X:98856578-98856600 AGGAAACCCCAAACATTGCATGG - Intergenic
1195429434 X:104771908-104771930 AATAAAACACAAAAATGTTATGG + Intronic
1195896133 X:109747854-109747876 AGTACTCCTCAAAACTGTCAAGG + Intergenic
1196153755 X:112404796-112404818 AATAGACCCAAAAAATGTCACGG - Intergenic
1196261871 X:113592510-113592532 AGTACTCTCCAAAACTGTCAGGG - Intergenic
1196935470 X:120726293-120726315 AGTACTCCCCAAAACTGTCAAGG - Intergenic
1198663147 X:138993104-138993126 AGTATACCTCAAAAATGTCAAGG + Intronic
1198806057 X:140495935-140495957 AGAAATCCTCAAAACTGTCAAGG - Intergenic
1199627484 X:149753778-149753800 ATTAGACCCCAAAAATGCTAAGG - Intergenic
1200102576 X:153695303-153695325 GGCAGACCCCAAAAGTGTCAGGG - Exonic