ID: 1167513776

View in Genome Browser
Species Human (GRCh38)
Location 19:49910829-49910851
Sequence CAGTGGTGCCATCTATCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 127}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167513771_1167513776 29 Left 1167513771 19:49910777-49910799 CCATTCAGTTCAAACTGACTTGA 0: 1
1: 0
2: 0
3: 17
4: 153
Right 1167513776 19:49910829-49910851 CAGTGGTGCCATCTATCAGCAGG 0: 1
1: 0
2: 0
3: 6
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167513776 Original CRISPR CAGTGGTGCCATCTATCAGC AGG Intronic
902703555 1:18189573-18189595 CAGTGGGGCCATCTAGTTGCAGG - Intronic
910341800 1:86196961-86196983 CAGTGGTGCCTTTTTTCATCTGG - Intergenic
911275671 1:95854549-95854571 CAGGGGTGCCAGCTCTCTGCAGG - Intergenic
915905335 1:159872882-159872904 CTGTGGTGCCATCTCTTTGCGGG + Intronic
916064518 1:161125182-161125204 CAGTGCTGTCATCTATAAACAGG + Intronic
916115960 1:161485255-161485277 CAGTGGTCCCTGATATCAGCTGG + Intergenic
920361752 1:205422842-205422864 CAGTTCTGCCATTTACCAGCTGG + Intronic
921863664 1:220065600-220065622 CAGTTCTGCCATTTACCAGCTGG + Intronic
922669828 1:227500959-227500981 CAGTGGAGCCTCTTATCAGCTGG + Intergenic
922857447 1:228787221-228787243 CAGTGGAGCCTTCTAGCTGCAGG + Intergenic
923877288 1:238062937-238062959 CACTGGAGCCGTCTAGCAGCTGG - Intergenic
924470064 1:244335434-244335456 CAGTGTGGTCCTCTATCAGCTGG - Intergenic
1064640579 10:17411545-17411567 CAGTGGGGCATTTTATCAGCTGG - Intronic
1064686253 10:17865440-17865462 CTGTGGTGTCATCCAGCAGCAGG + Intronic
1069373475 10:67770633-67770655 CAGTGGTGCAATATATCAAATGG - Intergenic
1071503690 10:86220622-86220644 CATCGGTGCCATCTCTGAGCAGG + Intronic
1075895529 10:125991307-125991329 CAGTGATGCTATCTATTATCTGG - Intronic
1077788035 11:5405863-5405885 GAGTTGTGTCACCTATCAGCGGG - Intronic
1080631841 11:34084557-34084579 AAGTTGTGCCATGTATCTGCGGG + Intronic
1086945166 11:92837512-92837534 CAGTGGTGCCAAGAATCACCCGG + Intronic
1087709966 11:101536912-101536934 TAATGGTGCCATCTCTCACCTGG - Intronic
1089377591 11:118005570-118005592 AGGTGGTGCCATTTATCAGGTGG - Intergenic
1090277743 11:125431683-125431705 CATGGGTGCCATCTATCCTCAGG - Exonic
1090739764 11:129647404-129647426 CAGTGACACCATCCATCAGCTGG + Intergenic
1091145555 11:133276403-133276425 CAGTGGGGTCAACTCTCAGCAGG + Intronic
1091470757 12:724689-724711 CAGTGTAGCCATCCATCAACAGG - Intergenic
1106136222 13:26975702-26975724 CACTGGCTCCTTCTATCAGCGGG - Intergenic
1112656945 13:101461571-101461593 CTGTAGTGCCAGCTATCAGGAGG + Intronic
1113184774 13:107675335-107675357 CGGTGATGCCATCTATGCGCAGG - Intronic
1114560073 14:23583371-23583393 AAGGGCTGCCATCTATTAGCTGG - Intergenic
1114820251 14:26009718-26009740 CAGTGCTGCCCTGTAACAGCTGG + Intergenic
1116295386 14:43100548-43100570 CACTGGTGCCACCTGTCACCTGG - Intergenic
1118449583 14:65887999-65888021 CAGTGGTGGCAACAATGAGCGGG - Intergenic
1119105143 14:71916630-71916652 CAGTGGTGCCATCTCTGAATGGG - Intergenic
1119125417 14:72121305-72121327 GAATGGAGCCATTTATCAGCAGG - Intronic
1120111225 14:80559989-80560011 CAGAGGTGACATCTATAAACAGG + Intronic
1120361795 14:83513800-83513822 CTGTAGTCCCATCTATCAGGAGG + Intergenic
1121583219 14:95046009-95046031 CAGTGCTGCCATCCACCTGCTGG - Intergenic
1124805712 15:32880217-32880239 CAGAGTTTCCATATATCAGCTGG - Intronic
1128771481 15:70285940-70285962 CAGTGCTGCCACTTACCAGCTGG + Intergenic
1129373738 15:75114532-75114554 CAGTGTTGACATGTGTCAGCCGG - Intronic
1130015645 15:80184319-80184341 CAGTGGTGGCGTCTTTCACCTGG + Intronic
1130060907 15:80569313-80569335 CAGTGCTGCCCTCCATTAGCTGG - Intronic
1134892312 16:17852006-17852028 CAGTGATGCCTGCTACCAGCTGG - Intergenic
1137977535 16:53044014-53044036 CAGGGGTTCCATCCTTCAGCGGG + Intergenic
1138055180 16:53825407-53825429 CAGTGGTCTCATCTATAAACTGG + Intronic
1140609110 16:76576999-76577021 CAGTTCTGCCTTCTACCAGCAGG - Intronic
1140863530 16:79040055-79040077 CAGTGTTTCCATCTATAAACTGG + Intronic
1141284118 16:82655257-82655279 CAGTGTTGCAATCAATGAGCCGG + Intronic
1142287046 16:89175733-89175755 CAGGGCCGCCATCTGTCAGCTGG + Intronic
1144835478 17:18154549-18154571 CAGTGGGGTCATCTGTAAGCTGG - Intronic
1145926984 17:28655337-28655359 CAGTGTTGACATGTGTCAGCCGG + Exonic
1151783169 17:76261135-76261157 CAGTGCTACCATCAGTCAGCAGG + Intergenic
1155100750 18:22607750-22607772 CTGTGGTGCCTACTAGCAGCCGG - Intergenic
1155307765 18:24495805-24495827 AGTTGGTGCCAGCTATCAGCTGG - Intergenic
1159146932 18:64466956-64466978 CAGTGGTGGCTTCCTTCAGCAGG + Intergenic
1160023727 18:75202072-75202094 CGGTGGTGCCACTTACCAGCAGG + Exonic
1160044033 18:75370501-75370523 CCGTGCTCCCAGCTATCAGCAGG - Intergenic
1161370637 19:3908945-3908967 CAGTGGTGCCATCTCAGAGCGGG - Intronic
1161814589 19:6492033-6492055 AGGTGGTGCCAATTATCAGCTGG - Intergenic
1163038624 19:14586542-14586564 CAGTAGTCCCAGCTATCAGGAGG - Intronic
1163385035 19:16994638-16994660 CTGTGGTCCCAGCTATCAGGAGG - Intronic
1166381357 19:42356882-42356904 CCGTGGTGCCATGTATCTGCTGG + Exonic
1166389071 19:42398908-42398930 CAGTGGAGCCATCTCTGAGGTGG + Intergenic
1167193258 19:48006979-48007001 CAGTGGTGCCACCTACCTGTGGG + Intronic
1167513776 19:49910829-49910851 CAGTGGTGCCATCTATCAGCAGG + Intronic
931118172 2:59187157-59187179 CAGTGGAGGCATCTATCTGCTGG - Intergenic
932822362 2:74912255-74912277 CTGGGGTGCTATCTCTCAGCAGG - Intergenic
941207367 2:162590649-162590671 CCCTGGTCCAATCTATCAGCAGG + Intronic
944637863 2:201692169-201692191 CAATGGTGTCATTTATCAACTGG - Intronic
947559277 2:231132692-231132714 TAGTGCTGCCATTTATTAGCAGG - Intronic
947612770 2:231533887-231533909 CAGTGGTCCCCTCTAGGAGCAGG - Intergenic
947842066 2:233214182-233214204 CTGTGGTGCAATCGATCAGGAGG - Intronic
1169654334 20:7906218-7906240 CAATAGACCCATCTATCAGCTGG - Exonic
1170826435 20:19800108-19800130 CAGTGGTGTCATCCCTCAGACGG - Intergenic
1171776588 20:29373967-29373989 CAGTGGGGCCTCTTATCAGCTGG - Intergenic
1171900254 20:30849837-30849859 CAGTGGGGCCTCTTATCAGCTGG + Intergenic
1172747709 20:37225757-37225779 CAGTGTTCACATCTACCAGCTGG - Exonic
1174015063 20:47481199-47481221 CAGTGGTGCAATCTCACTGCAGG + Intergenic
1174783779 20:53413533-53413555 CAGTAGTCCCATTTATCAGATGG - Intronic
1175236537 20:57516691-57516713 CATTGGTGCCATGTGACAGCAGG + Intronic
1177384246 21:20388489-20388511 CAGTGGAGGCAAGTATCAGCAGG + Intergenic
1180321432 22:11324925-11324947 CAGTGGGGCCTCTTATCAGCTGG - Intergenic
1181891669 22:26068811-26068833 CATTGGGGCCATTCATCAGCAGG + Intergenic
1182116308 22:27758413-27758435 CAGGGGTGCCATCTGCCAGCAGG - Intronic
1182434304 22:30320514-30320536 CAGTTCTGCCATTTACCAGCTGG + Intronic
1183403784 22:37620001-37620023 CCATGGTGCCATCTAGCAGGTGG + Intronic
1184098079 22:42327348-42327370 CAGAGGTGCCTTCCCTCAGCAGG - Intronic
1184555924 22:45233095-45233117 CAGTGGCCCCATCTATCACATGG + Intronic
954307016 3:49732893-49732915 CACTGTTGCCATCTAGCATCTGG + Exonic
955188674 3:56739520-56739542 CTGTGGTCCCAGCTATCAGGAGG - Intronic
956797945 3:72732960-72732982 CCTTGGTGCCAAGTATCAGCAGG - Intergenic
964896659 3:161604658-161604680 TAGTGGTGCCATTTATTGGCTGG + Intergenic
966066344 3:175826399-175826421 CATTTGTGCCATTTATCAGAAGG + Intergenic
968357236 3:198118855-198118877 CAGTGGGGCCTCTTATCAGCTGG + Intergenic
968533296 4:1107510-1107532 CAGTGGCGCCATCTCACTGCAGG + Intronic
968853416 4:3100610-3100632 AAGTGGTGCCAATGATCAGCAGG - Intronic
975610854 4:76201251-76201273 CAGAAGTGCCATCTCTCAGAAGG + Intronic
983281998 4:165692894-165692916 CAGTGGTCCCATCTATTATAAGG + Intergenic
985442421 4:189992707-189992729 CAGTGGGGCCTCTTATCAGCTGG - Intergenic
986869904 5:12033465-12033487 CAGTGTTGCCTTCTGTCAACTGG + Intergenic
988070923 5:26287001-26287023 CAGTGTTGGCATCCATCAGCAGG + Intergenic
989290512 5:39759243-39759265 CAGTGATGCCATCTGTTAGGTGG + Intergenic
991660331 5:68944747-68944769 CAAAGGTGCCATCTATGAACAGG - Intergenic
997923593 5:138006480-138006502 CAGTGGTCCCAGCTATGTGCTGG + Intronic
1000817465 5:165941348-165941370 AAGTGTTGCCAACCATCAGCAGG + Intergenic
1003332140 6:5138055-5138077 CAATGGTGCTGTCTTTCAGCAGG + Intronic
1006609828 6:35287677-35287699 CAGTGGAGCCATCTTCCAGTTGG - Exonic
1007613819 6:43168493-43168515 CAGGGGTGACATCCCTCAGCAGG - Intergenic
1009614547 6:65988708-65988730 CAGTGGTGCCATCTCTGCTCAGG - Intergenic
1011826243 6:91308969-91308991 CAGTGGTGCAATCTAGGTGCAGG + Intergenic
1020467008 7:8491675-8491697 CCGTGGTGGTACCTATCAGCAGG - Intronic
1022171266 7:27834397-27834419 CAGGGGTGCCAAGTAGCAGCTGG + Intronic
1022370463 7:29766159-29766181 CAGTCCTGCCACTTATCAGCTGG - Intergenic
1022892307 7:34714094-34714116 CACTGGTGCCAGCTGTCCGCTGG + Intronic
1037501480 8:19489855-19489877 CTGAGCTGACATCTATCAGCTGG + Intronic
1039428822 8:37509844-37509866 CAGTGGAGCCTTCTATAAGAAGG + Intergenic
1039506289 8:38054782-38054804 CAGTGGTGCCCTCTCTTTGCAGG - Intronic
1040459726 8:47635593-47635615 CTGTAGTCCCATCTATCAGGAGG + Intronic
1044971956 8:97628494-97628516 CTGTGGTCCCAGCTATCAGGAGG + Intergenic
1048326967 8:133447314-133447336 CAGTGGTGGCCCCTGTCAGCTGG - Intergenic
1051696114 9:19769353-19769375 CACTGGTGCCATGAATCAGGTGG - Intronic
1055363777 9:75523009-75523031 CAGTGGTGGCCTCTAAAAGCTGG + Intergenic
1055478399 9:76686293-76686315 CAGTACTTTCATCTATCAGCAGG - Intronic
1056104835 9:83336832-83336854 CAGTGGTGCAGTCTTTCAGAAGG - Intronic
1059001662 9:110354991-110355013 CAGGTGTGCCATATATCAGAAGG + Intergenic
1059236075 9:112761666-112761688 CAGTGGTGCCGTCTTTGAGAGGG + Intronic
1059797894 9:117719345-117719367 CAGTGCTGCCACCAATGAGCAGG - Intergenic
1059924589 9:119195683-119195705 CAGTCGTGCCACCTCTCAGCAGG + Intronic
1203369649 Un_KI270442v1:290705-290727 CAGTGGGGCCTCTTATCAGCTGG - Intergenic
1185921302 X:4096160-4096182 CAGAGGTGCCATCTAACCCCAGG + Intergenic
1189173835 X:38934411-38934433 GAGAGGTGCCATCTAGCAGAAGG - Intergenic
1189260946 X:39678492-39678514 CAGTGGGGACATTTATCACCCGG + Intergenic
1191842508 X:65523419-65523441 CAGTTGTCCCATCTGTCAGTGGG + Intronic