ID: 1167514125

View in Genome Browser
Species Human (GRCh38)
Location 19:49913092-49913114
Sequence TTGCAGATGCAGCATCAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 1, 2: 0, 3: 15, 4: 186}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167514121_1167514125 17 Left 1167514121 19:49913052-49913074 CCACATGCTGTGGGAGCAGGTTC 0: 1
1: 0
2: 3
3: 43
4: 488
Right 1167514125 19:49913092-49913114 TTGCAGATGCAGCATCAGCCAGG 0: 1
1: 1
2: 0
3: 15
4: 186
1167514124_1167514125 -5 Left 1167514124 19:49913074-49913096 CCAGGGAGAAGCTGAGCGTTGCA 0: 1
1: 0
2: 0
3: 10
4: 158
Right 1167514125 19:49913092-49913114 TTGCAGATGCAGCATCAGCCAGG 0: 1
1: 1
2: 0
3: 15
4: 186
1167514119_1167514125 22 Left 1167514119 19:49913047-49913069 CCGGGCCACATGCTGTGGGAGCA 0: 1
1: 0
2: 0
3: 19
4: 234
Right 1167514125 19:49913092-49913114 TTGCAGATGCAGCATCAGCCAGG 0: 1
1: 1
2: 0
3: 15
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167514125 Original CRISPR TTGCAGATGCAGCATCAGCC AGG Intronic
900676538 1:3890690-3890712 GTGCAGAAGCAGAATGAGCCAGG - Exonic
900917685 1:5650150-5650172 CTGGAGATGCTGCTTCAGCCTGG - Intergenic
901700652 1:11043428-11043450 TTGCACTTACAGCATCAGCCTGG - Exonic
902992233 1:20196360-20196382 GGGCTGATGCAGGATCAGCCAGG - Intergenic
904297743 1:29532656-29532678 TGGCAGAGGGAGCATCAGGCAGG - Intergenic
904973703 1:34439327-34439349 TTCCAAATGAAGCATCAGCATGG + Intergenic
916119366 1:161513818-161513840 TTGCAGCCTCAGCATCAGCGTGG + Intronic
916129128 1:161595476-161595498 TTGCAGCCTCAGCATCAGCGTGG + Intronic
917199374 1:172499040-172499062 TTGCAGCTGCAGGCTGAGCCTGG - Intergenic
919805739 1:201380102-201380124 CTGCAGCTGCAGCCTCAGCAGGG - Intronic
923506290 1:234609196-234609218 TTGCAGCAGCAGCAGCAGCTTGG - Exonic
1066256511 10:33684510-33684532 CTACAGAGGGAGCATCAGCCAGG - Intergenic
1068463355 10:57355592-57355614 TTGCTCATGCAGCATCCACCTGG - Intergenic
1069041347 10:63698886-63698908 TTGCAGATGGAGCTTCAGTGTGG + Intergenic
1070160679 10:73865145-73865167 TTGCAGACCCTGCATCTGCCTGG - Intronic
1070247126 10:74743428-74743450 TAGCATATGCAGCCTCATCCAGG + Intergenic
1070284803 10:75075116-75075138 CTGAAGATGCAGCTTCAGCAGGG + Intergenic
1071164398 10:82787636-82787658 TTGCAGAAGCAGCCTCAGCATGG - Intronic
1071435064 10:85641285-85641307 TTGGAGATGCAGAATTGGCCTGG - Intronic
1073324524 10:102634639-102634661 TTCCAGAAACAGCGTCAGCCTGG - Intergenic
1075622490 10:123938253-123938275 TTGCAGCTTCAGTATCATCCAGG - Intronic
1076906433 10:133364359-133364381 TTGAAAATGCAGTTTCAGCCGGG - Intronic
1077594407 11:3519316-3519338 TTGCATTTGCTGCTTCAGCCTGG + Intergenic
1077642321 11:3892906-3892928 TTGCAGATGCTGCTGCTGCCGGG - Intronic
1079480382 11:20873724-20873746 TTACACAAACAGCATCAGCCAGG - Intronic
1079941668 11:26688273-26688295 TTCCCAATGCAGCATCAGCTCGG + Intronic
1081901269 11:46630266-46630288 ATGCAGAAGAAGCAGCAGCCTGG + Intronic
1083389190 11:62335556-62335578 TTGGAGCTGCTGCACCAGCCTGG + Intergenic
1084250258 11:67892593-67892615 TTGCACTTGCTGCTTCAGCCTGG + Intergenic
1084822533 11:71702753-71702775 TTGCACTTGCTGCTTCAGCCTGG - Intergenic
1085802202 11:79601043-79601065 ATGCAGAGGCAGCAGCAGCAGGG - Intergenic
1085989716 11:81827316-81827338 TTCCAGATGTAGCATGAGCCTGG + Intergenic
1090737282 11:129621079-129621101 TGGCAGAAGCAGCATCACCTGGG + Intergenic
1091334365 11:134755324-134755346 GTCCAGATGCAGCATGAGCAGGG - Intergenic
1092203966 12:6604488-6604510 TTGGGAATGCAACATCAGCCTGG + Intronic
1092420581 12:8328105-8328127 TTGCACTTGCTGCTTCAGCCTGG + Intergenic
1092447260 12:8568623-8568645 TGGCAGCTGCAGCAACACCCAGG + Intergenic
1093933274 12:24975458-24975480 TAGCAGGTACAGCATCAGCAAGG - Intergenic
1094057372 12:26280932-26280954 TTGCAGAGGCTACTTCAGCCAGG + Intronic
1098828781 12:75333015-75333037 TGGCTGATGCAGAATAAGCCAGG + Intronic
1100331347 12:93585306-93585328 CTGCAGCTGCTTCATCAGCCTGG - Intergenic
1100975405 12:100117266-100117288 TGGCAAATGCTACATCAGCCAGG + Intronic
1103880236 12:124160342-124160364 TTCCAGCTGCAGCTGCAGCCGGG - Intronic
1104023273 12:125008098-125008120 TAGCAGCAGCAGCATCACCCAGG - Intronic
1104618777 12:130293605-130293627 GTGGAGTTGCTGCATCAGCCAGG + Intergenic
1104754578 12:131261169-131261191 TGGCAGATGCAGCATCCACGTGG - Intergenic
1110958962 13:81595737-81595759 TTGTATGTGCAGCATCTGCCTGG + Intergenic
1114737458 14:25057180-25057202 TGGCAGCTTCAGCATCATCCTGG + Intergenic
1114856259 14:26448300-26448322 TTGCAGCAGTAGCAGCAGCCAGG + Exonic
1115461541 14:33666451-33666473 TAGCAGGTTCAGCATCACCCAGG + Intronic
1118502005 14:66370708-66370730 TTGCAGTTACAGCACCAGCTAGG + Intergenic
1121392118 14:93584478-93584500 TTGTAGGTGCTGCAGCAGCCAGG + Intronic
1122920690 14:104878758-104878780 TTGTGGATGCAGCAGCATCCGGG + Intronic
1123424925 15:20163513-20163535 GGCCAGATGCAGCATCAGCAAGG + Intergenic
1123534149 15:21170046-21170068 GGCCAGATGCAGCATCAGCAAGG + Intergenic
1123857971 15:24433855-24433877 TTGCAAAGGCAGTTTCAGCCAGG - Intergenic
1125334114 15:38610996-38611018 TTGCAGATTCAGCATCATGCTGG + Intergenic
1128494382 15:68185212-68185234 TTTCAGTTGCAGCAATAGCCTGG - Intronic
1129188193 15:73923115-73923137 TTCCAGAGGCAGCAGCTGCCTGG + Intergenic
1131549986 15:93349091-93349113 TTGCCCATTCAGCATCAGGCAGG - Intergenic
1131643206 15:94314159-94314181 TTGCATATGCAGCTTCAGTGAGG - Intronic
1133129212 16:3665842-3665864 TGGCAGCAGCAGCAGCAGCCAGG + Intronic
1133359296 16:5161159-5161181 TTGCACTTGCTGCTTCAGCCTGG + Intergenic
1133746394 16:8690184-8690206 TGGCAGCAGCAGCATCTGCCTGG + Intronic
1134103666 16:11470394-11470416 GTGAAGTTGCAGCCTCAGCCTGG - Intronic
1137549693 16:49428891-49428913 TTACAGCTACACCATCAGCCTGG + Intergenic
1139252019 16:65505667-65505689 TTCCAGCTGCAGCCTCAGGCAGG - Intergenic
1141897444 16:86967587-86967609 GTGCTGATGCTGCTTCAGCCTGG - Intergenic
1142141420 16:88474365-88474387 TGGCAGATGCAGCAGCTGCCCGG + Intronic
1143295053 17:5864799-5864821 GTGCAGATACAGGATCAGCATGG - Intronic
1143875608 17:9988385-9988407 TTGCAAATTCTGCATCTGCCTGG - Intronic
1145250954 17:21296784-21296806 TTTAAGATGCAGCAACACCCTGG - Intronic
1153810656 18:8749154-8749176 TTGCAGATGCTGCATAAGAAGGG - Intronic
1154411181 18:14143058-14143080 TTGCAGATGCCTCAGAAGCCAGG - Intergenic
1156136666 18:34048495-34048517 TTGCAGATCCAGCATCCCTCAGG + Intronic
1158896744 18:61921352-61921374 GTGCAGAGGCAGGATCAGCCAGG - Intergenic
1159625777 18:70692265-70692287 TTGCAAATGCAGGAGCAGCGTGG - Intergenic
1160799881 19:962898-962920 TTTCAGCTGCAGGATCGGCCCGG - Intronic
1161302225 19:3548201-3548223 CTGCAGGTGCAGCAGGAGCCAGG + Exonic
1164754086 19:30677389-30677411 CTGCAGATGCATCAATAGCCAGG - Intronic
1164878265 19:31708652-31708674 TTGCAGCTGCAGCGTCACCATGG + Intergenic
1165547851 19:36556678-36556700 TGGCAGATGGGGCAGCAGCCAGG - Intronic
1167514125 19:49913092-49913114 TTGCAGATGCAGCATCAGCCAGG + Intronic
925591119 2:5511023-5511045 TTTCAGAAGCAGTGTCAGCCTGG - Intergenic
927912870 2:26914088-26914110 TTTCAGCAGCAGCATCAGACCGG + Intronic
928106000 2:28471111-28471133 TTCCAGCTGCACCTTCAGCCTGG - Intronic
928385925 2:30867984-30868006 TGGCTGAGGCAGCCTCAGCCTGG + Intergenic
929638674 2:43552607-43552629 TAGCACATGCCACATCAGCCTGG - Intronic
930333872 2:50020670-50020692 TTGCAGATTCAGGATTAGCCAGG + Intronic
930382197 2:50645136-50645158 TTACTGATGCAGCATCTGGCTGG + Intronic
930382273 2:50646338-50646360 TTACTGATGCAGCATCTGCCTGG - Intronic
931777712 2:65554596-65554618 TTGAAAATGCAAAATCAGCCAGG - Intergenic
932813448 2:74843320-74843342 TTGCACATGCAGAATCCCCCTGG - Intronic
934704209 2:96465035-96465057 TTCCAGATGCAGCATCTCTCAGG + Intergenic
935191421 2:100781721-100781743 AGGCTGATGCAGCATCAGGCTGG - Intergenic
935259233 2:101340686-101340708 TTACAGATGTAGCATGACCCTGG + Intergenic
938844821 2:135197664-135197686 TTGCACAGCCAGCATCAGGCTGG - Intronic
942373370 2:175310273-175310295 AGGGAGATGCAGCATCAGCTCGG - Intergenic
948127251 2:235573371-235573393 TTAAAGATGGAGCAGCAGCCGGG - Intronic
948279068 2:236732505-236732527 TGGCAGATGGACCATGAGCCTGG - Intergenic
948538809 2:238670174-238670196 CTGCACCTGCAGAATCAGCCAGG - Intergenic
948779654 2:240310859-240310881 TTGCAGGTGCAGCCTCAGCAGGG - Intergenic
1169072534 20:2742085-2742107 TTGCCGCTGCAGTACCAGCCTGG + Intronic
1169130801 20:3165575-3165597 TTCCCGCTGCCGCATCAGCCGGG + Exonic
1171328809 20:24319094-24319116 TGGCTGATGCTGGATCAGCCTGG + Intergenic
1171373144 20:24674520-24674542 TGGCAGAGGAAGAATCAGCCTGG + Intergenic
1172011488 20:31848543-31848565 GTGCAGGTGCAGCTTCGGCCTGG - Intronic
1174541662 20:51294558-51294580 TTGCAGGTGGAGCAGGAGCCTGG + Intergenic
1175486950 20:59353590-59353612 TTGTAGGAGCAGTATCAGCCTGG + Intergenic
1178784302 21:35638283-35638305 TAGCAAATGCAGCACCAGCTAGG - Intronic
1179006972 21:37523636-37523658 TTGCAGATTAGGCATCAGCAAGG + Intergenic
1179959039 21:44758140-44758162 TTGCTTCTGCAGCATAAGCCAGG + Intergenic
1184866068 22:47202461-47202483 GTGCAAGTGCAGCATCACCCCGG + Intergenic
1185341589 22:50293553-50293575 TGGCAGAGGCAGCCTCAGCCAGG + Intronic
949247228 3:1939519-1939541 GTGCAGACACAGCATCAACCTGG - Intergenic
949490145 3:4581192-4581214 TTGCCGAGGCAGCATCAGCAGGG + Intronic
956239568 3:67114676-67114698 TAGCAGATTCATCATCATCCTGG - Intergenic
958080764 3:88743551-88743573 TTGTGGATGCATCATCACCCAGG + Intergenic
961006555 3:123409606-123409628 GAGCAGCTGCAGCATCACCCAGG + Intronic
961288810 3:125828719-125828741 TTGCACTTGCTGCTTCAGCCTGG - Intergenic
961507166 3:127377811-127377833 TTACAGATGCAGAATCAGAGAGG + Intergenic
961898259 3:130187307-130187329 TTGCACTTGCTGCTTCAGCCTGG + Intergenic
963375561 3:144459059-144459081 TTGCAGCTGCAGTATCAACAGGG + Intergenic
966068784 3:175849044-175849066 TGGCAGAGGCACCATCAGCCTGG + Intergenic
969350831 4:6597002-6597024 CTGCAGAGGCAGCCTCTGCCAGG - Intronic
969386883 4:6857365-6857387 CTGCAGATGGAGCATGAGGCTGG - Intronic
969632203 4:8345349-8345371 TTGCAGAGGTGGCGTCAGCCTGG + Intergenic
969685618 4:8672395-8672417 TTGCAGAGCCAGGATCACCCAGG + Intergenic
969804524 4:9596622-9596644 TTGCACTTGCTGCTTCAGCCTGG - Intergenic
970499900 4:16666476-16666498 TTCCACATGCAGCAGCAGCCTGG - Intronic
972270114 4:37502714-37502736 CTGCAGCTGCAGCATCTCCCTGG - Intronic
973090036 4:46124501-46124523 TTGCAGATCCAGCACCTGGCAGG + Intergenic
973832280 4:54773716-54773738 GTGTTGATGCAGCACCAGCCTGG - Intergenic
975265513 4:72361227-72361249 TTACAGATGAAGCACCAGCTTGG - Intronic
975407299 4:74004607-74004629 ATGAAGAAGCAGCATCATCCAGG + Intergenic
975472596 4:74787610-74787632 TTGCAGATCCAGTATCAGCTGGG + Intronic
975488306 4:74959902-74959924 TTGCAGTTGCAGAATCTGTCTGG + Intronic
976122922 4:81802592-81802614 TTGCAGCTGCAGTAGCAGCAGGG + Intronic
980866134 4:138555354-138555376 CTACAGATGCTGCATCAGCAGGG + Intergenic
981672187 4:147299604-147299626 TCACAGATGCAACATCAGACAGG + Intergenic
983094978 4:163550833-163550855 TAGCAGATGCAGCAGCAATCAGG + Intronic
983130438 4:164012526-164012548 TAGCAGCAGCAGCAGCAGCCAGG + Intronic
984626514 4:182013193-182013215 TTTCAGTGGCAGCAGCAGCCTGG - Intergenic
985516313 5:346747-346769 CTGCAGATGCAGCATCAGCCAGG + Intronic
985762547 5:1757726-1757748 ATGCAGATGCCACAGCAGCCAGG + Intergenic
991386054 5:66091789-66091811 CTGCATATGCACCATCAACCTGG + Intergenic
997128468 5:131252704-131252726 TTGCAGGTCCAGCATCATCTGGG + Intronic
997653862 5:135541275-135541297 TTGCAGATGCAGCTTATGACAGG + Intergenic
1000904319 5:166945392-166945414 TTGCAAATGGAGCATTTGCCAGG + Intergenic
1001399202 5:171436842-171436864 TTGCAGAGGCAGCATAGGCAGGG - Intronic
1002660460 5:180788026-180788048 ATGCAGCAGCAGCAGCAGCCAGG + Intergenic
1003870578 6:10399543-10399565 TTCCAGGGGCAGCAGCAGCCTGG + Intronic
1006800367 6:36756074-36756096 GGGCAGATGGAGCAACAGCCAGG - Intronic
1008566917 6:52777643-52777665 TTGCTGATGCAAAATCAGTCTGG + Intergenic
1008570458 6:52811707-52811729 TTGCTGATGCAAAATCAGTCTGG + Intergenic
1016436807 6:144046537-144046559 TTCCAGAGGAAGGATCAGCCAGG - Intronic
1017231011 6:152073815-152073837 TTGCAGATGCTGCATCTGGAGGG - Intronic
1017748653 6:157469685-157469707 TTGCAGGTGCAGTATCCTCCAGG - Intronic
1018516376 6:164584261-164584283 TGGCAGAGGCAGCATCGGCAGGG + Intergenic
1018954883 6:168402729-168402751 ATGCAGTTACAGCATCAGCTAGG - Intergenic
1019961787 7:4466613-4466635 TGGCAGCTTCAGCATCACCCAGG + Intergenic
1020328912 7:6998564-6998586 TTGCACTTGCTGCTTCAGCCTGG + Intergenic
1026095670 7:67344610-67344632 CTGGAGATGCAGCATGAGCAAGG - Intergenic
1026930468 7:74220578-74220600 TTCCAGATCCAGCATCTTCCAGG + Exonic
1027628586 7:80574946-80574968 TGGCAGCTGCAGCAGCAGCAGGG + Intronic
1029232170 7:99079246-99079268 TTGCAGATGGAGAACGAGCCTGG - Intronic
1032481158 7:132248267-132248289 TTCAAGCTGCTGCATCAGCCAGG - Intronic
1033286967 7:140049630-140049652 TTCCTGAGGAAGCATCAGCCTGG - Intronic
1034066754 7:148144377-148144399 TTGCATGTGCAGCATCCACCTGG + Intronic
1034569902 7:151947124-151947146 TGGCAGAGCCACCATCAGCCTGG - Intergenic
1036249732 8:7151454-7151476 TTGCACTTGCTGCTTCAGCCTGG + Intergenic
1036367721 8:8135593-8135615 TTGCACTTGCTGCTTCAGCCTGG - Intergenic
1036883160 8:12530068-12530090 TTGCACTTGCTGCTTCAGCCTGG + Intergenic
1037410285 8:18588705-18588727 TTGAAGCTTCAGCATCAGCTTGG - Intronic
1039052762 8:33509842-33509864 TTCCAGATGCTGGCTCAGCCAGG + Exonic
1039445770 8:37630654-37630676 TTGCAGAGGGAGCAGCAGGCAGG - Intergenic
1040028636 8:42804249-42804271 TTCCAGAGGCAGGGTCAGCCTGG + Intergenic
1041245298 8:55883379-55883401 TAGCAGATGCACCATCAAGCTGG + Intronic
1045554855 8:103206263-103206285 TTACAGATGCTGTATCAGTCAGG - Intronic
1047960863 8:130010764-130010786 TTGCACCATCAGCATCAGCCTGG + Intronic
1048862780 8:138736398-138736420 TTTCAAATGCAGCATCACCATGG - Intronic
1049103670 8:140597882-140597904 TGGCAGATGACGCAACAGCCCGG - Intronic
1051114283 9:13675979-13676001 TTGCTGCTGCAGCATCTGCATGG + Intergenic
1051346404 9:16154788-16154810 TTGCTGCTGCAGCACCAGCGTGG - Intergenic
1052820615 9:33135498-33135520 CTGCAGCTGCAGCTGCAGCCTGG - Intronic
1055958940 9:81801181-81801203 TTACAAATACACCATCAGCCTGG + Intergenic
1056536582 9:87533410-87533432 GTTCACAGGCAGCATCAGCCAGG + Intronic
1057610674 9:96540730-96540752 TTGCAGTTGCAGCCCCTGCCAGG - Intronic
1059961907 9:119573924-119573946 TTGTTGCTGCTGCATCAGCCTGG + Intergenic
1061022198 9:128023144-128023166 TAGCAGAGGCTCCATCAGCCAGG + Intergenic
1061304774 9:129725855-129725877 CTGCACAGGCAGCCTCAGCCTGG - Intergenic
1062184874 9:135212842-135212864 TGGCAACTGCAGCCTCAGCCAGG - Intergenic
1062410760 9:136423027-136423049 TTACTGATGCAGCCTCAGCGTGG + Intronic
1185997495 X:4968152-4968174 TTGCAGATAAAGTATTAGCCAGG - Intergenic
1186765759 X:12769133-12769155 TGGCAGAGCCACCATCAGCCTGG - Intergenic
1188939219 X:36216440-36216462 TAACAGATCCAGCATCAGACTGG - Intergenic
1189818867 X:44850219-44850241 TGGAAAATGCAGCTTCAGCCAGG - Intergenic
1193524002 X:82566622-82566644 GTGCAACTGCAGCATCATCCCGG + Intergenic
1194820575 X:98501505-98501527 TTGCTGATGCAGCATCCTCCAGG - Intergenic
1196549082 X:116999742-116999764 TTGCTGTTGCAGGACCAGCCTGG + Intergenic
1197210144 X:123821539-123821561 TTGAAAAAGCAGCATCAGGCCGG - Intergenic
1198945299 X:142005657-142005679 TTGCTCATACAGCATCTGCCTGG + Intergenic
1200920664 Y:8610068-8610090 TGGTACATGCAGAATCAGCCTGG - Intergenic