ID: 1167516107

View in Genome Browser
Species Human (GRCh38)
Location 19:49924126-49924148
Sequence ACCTCCCAGAGACTACACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 149}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167516105_1167516107 3 Left 1167516105 19:49924100-49924122 CCTGAGGTGAGGGTCAGGGCTTG 0: 1
1: 0
2: 2
3: 36
4: 258
Right 1167516107 19:49924126-49924148 ACCTCCCAGAGACTACACCATGG 0: 1
1: 0
2: 1
3: 11
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167516107 Original CRISPR ACCTCCCAGAGACTACACCA TGG Intronic
900458406 1:2788542-2788564 ACCTCCCAGCAATTACACGAGGG + Intronic
900963318 1:5939733-5939755 CCATGCCAGTGACTACACCAGGG + Intronic
904414706 1:30352524-30352546 TCCTTCCAGAGACTACAGTATGG - Intergenic
907238707 1:53068891-53068913 ACCTGCCAGAGACCACTCCCTGG - Intronic
910122106 1:83801560-83801582 ACCTCACAGAGGCTTCACCCAGG + Intergenic
917852837 1:179080130-179080152 ACCACCCAGAGCCTCCTCCATGG + Intergenic
918152546 1:181810480-181810502 CCCTCACAAAGATTACACCATGG - Intergenic
922199855 1:223393002-223393024 TCCTCCCTGAGACTGCACCCCGG + Intergenic
923881160 1:238105365-238105387 ACCTCCCAAAGACCCCACCTCGG + Intergenic
1063197699 10:3758788-3758810 ACCTCCCAGATCATTCACCAGGG + Intergenic
1067686398 10:48468458-48468480 ACCTTCCAGGGGCTACAGCAAGG - Intronic
1070097774 10:73355102-73355124 ACCTCCCATACCCTACATCAGGG + Intronic
1070959655 10:80489673-80489695 ACCTCCCAGAACCTAAAACAGGG - Intronic
1073114175 10:101081757-101081779 ATCACCCAGAGATTACAGCAGGG + Intergenic
1074226191 10:111486875-111486897 AGCTCCCAGATAATACACGATGG + Intergenic
1075264111 10:120986325-120986347 ACCTCCTAAAGACTTCACCTCGG - Intergenic
1075413215 10:122244260-122244282 GCCACCCAGAGAGTACCCCAAGG - Intronic
1075591145 10:123692568-123692590 AGGTCCCAGAGCCAACACCAGGG - Exonic
1080077920 11:28174053-28174075 TCCTCCCAAAGAGTACAGCATGG - Intronic
1080920415 11:36703250-36703272 TCCTCCAAGAGAATCCACCAGGG - Intergenic
1081158933 11:39729606-39729628 AGGTTCCAGAGACTAGACCATGG + Intergenic
1081214365 11:40376669-40376691 AGCACCCAGAGACAAAACCAGGG + Intronic
1084109903 11:67007328-67007350 CCTTCCCAGGGACTGCACCATGG + Exonic
1084484313 11:69439045-69439067 TCCTCCCAGGGACCACCCCAAGG + Intergenic
1088035008 11:105300655-105300677 ACCTGACAGAGACTAATCCAGGG - Intergenic
1088680115 11:112233145-112233167 GCCTCCTAGAGACAAAACCAAGG - Exonic
1090046114 11:123335071-123335093 ACCTCAAGGAGCCTACACCAGGG + Intergenic
1090452436 11:126818762-126818784 ACTTTCCAGAGTCTACACAATGG - Intronic
1093574838 12:20714928-20714950 ATCCCCAAGAGACTTCACCAAGG - Intronic
1100358048 12:93850197-93850219 ACCTTCCAGAGCCTGCACAACGG + Exonic
1100394631 12:94174028-94174050 ACCTCCCAGGGACTGCAGTAGGG + Intronic
1101582387 12:106053391-106053413 ACCACCCAGAAACTCCACTAGGG + Intergenic
1105761869 13:23522600-23522622 TCCTCCCAAAGAGTACACTATGG + Intergenic
1106243755 13:27929289-27929311 CTCTCCCAGATACTCCACCAGGG - Intergenic
1109366821 13:61366725-61366747 ACCCTCCTGAGACTAAACCAGGG + Intergenic
1112025348 13:95406420-95406442 ACCTCCCAGAGGCATCACAATGG + Intergenic
1113013979 13:105806538-105806560 ACATGCCTGAGACTACACCCTGG - Intergenic
1113941667 13:114021615-114021637 GCCTCCCAGAGTCTCCATCAAGG + Intronic
1113951650 13:114075101-114075123 ACCACGCTGAGACCACACCAAGG + Intronic
1114693494 14:24606650-24606672 ACCTCCAGGAGTCTACATCAAGG - Exonic
1115529800 14:34316771-34316793 ACCTTCCAGAGGCTATTCCAAGG + Intronic
1119185312 14:72637216-72637238 ACTTCCTAGAGACTCCACCTTGG - Intronic
1121801580 14:96778605-96778627 ATTTCCCAGAGAGTGCACCATGG - Intergenic
1126420867 15:48470550-48470572 GCCTCCCTGGGACTACACAAGGG - Intronic
1126938364 15:53737286-53737308 ACCTCCCACAGGCCAAACCATGG + Intronic
1128257753 15:66211071-66211093 CCCTCCCAAAGACCACTCCAAGG + Intronic
1128808911 15:70555731-70555753 ACCACCCAGATTCTCCACCAAGG - Intergenic
1132656011 16:1042045-1042067 ACCCCACAGTGACCACACCATGG - Intergenic
1134346001 16:13392515-13392537 ACAGCCCAGGGACTACAGCATGG + Intergenic
1138179172 16:54930789-54930811 TCCTCCCACCGACTACACCCCGG + Intergenic
1141378893 16:83557644-83557666 ACCTCCCAGACTCAACTCCAGGG - Intronic
1144507797 17:15848058-15848080 ACCTCACAAAGAACACACCAGGG + Intergenic
1145171920 17:20665690-20665712 ACCTCACAAAGAACACACCAGGG + Intergenic
1145767255 17:27467284-27467306 ACCCCCCAGAGCCTAGACAAAGG - Intronic
1146904907 17:36612115-36612137 ACCCCCCACAGACTCCTCCATGG + Intergenic
1147060712 17:37875534-37875556 CCCTCAAAGAGACGACACCAGGG + Intergenic
1153522263 18:5964072-5964094 ACCTCCCAGAGCCAAGGCCAAGG - Intronic
1153617917 18:6951490-6951512 ACCACCCAGGGACAGCACCAGGG + Intronic
1153984475 18:10340450-10340472 AGCTCCCAGAGTGTACAGCATGG - Intergenic
1156374012 18:36496073-36496095 ACCACACAGAAACTTCACCAAGG - Intronic
1163015538 19:14451862-14451884 ACCTCCCAGAGACCATCCCGTGG + Exonic
1166253883 19:41588948-41588970 GCCTCCCAGAGACCACACCCTGG - Intronic
1166409668 19:42548095-42548117 GCCTCCCAGAGACCACACCCTGG + Intronic
1166893301 19:46007885-46007907 AGTTCCCCCAGACTACACCAGGG + Intronic
1167516107 19:49924126-49924148 ACCTCCCAGAGACTACACCATGG + Intronic
1167719709 19:51170093-51170115 TCCTTCCAGAGAATACACCAGGG - Intergenic
1168473866 19:56662207-56662229 ACCTCCCTGAGAACACACCCAGG + Exonic
925083081 2:1084921-1084943 ACCTCCCACAGCCCACACCCCGG + Intronic
926806600 2:16717094-16717116 ACATTCCAGAGGCCACACCAGGG + Intergenic
926977199 2:18526760-18526782 ACCTCCCAGAAACCTCACCCTGG - Intergenic
929992187 2:46799682-46799704 ACTTCCCAGAGCCTTCTCCATGG + Intergenic
934614856 2:95764515-95764537 ACCTCCAAGACACTACCCCATGG - Intergenic
934646047 2:96059972-96059994 GCCTCCAAGACACTACCCCATGG + Intergenic
934839451 2:97616062-97616084 GCCTCCAAGACACTACCCCATGG + Intergenic
934978910 2:98824302-98824324 ACCTCCAAGATACTCTACCAGGG + Intronic
935759845 2:106310715-106310737 GCCTCCCAGAGGCATCACCAGGG - Intergenic
936038862 2:109133894-109133916 ACCCACCAGAGACTACAGCCTGG - Intronic
937236423 2:120434100-120434122 CCCTCCCAGCGACATCACCATGG - Intergenic
943668514 2:190635735-190635757 GCTTCTCAGAGACTACACCTAGG + Intergenic
1169503042 20:6179884-6179906 ACCTTCCAGAGAATGCAGCAGGG + Intergenic
1170287225 20:14723157-14723179 ACCACACAGTCACTACACCAAGG - Intronic
1172183719 20:33018888-33018910 ACCTCCCAGAGGCCAAATCATGG + Intronic
1173094798 20:40015184-40015206 ACCTCTCAGAGACCACACTGCGG + Intergenic
1174148271 20:48467788-48467810 ACCTCCCAGTGACCACAGCCTGG - Intergenic
1176264112 20:64199702-64199724 ACCTCCCAGAGAGTCCTCCAAGG - Intronic
1176300793 21:5098035-5098057 ACCTCCCGGAGACCACCCCACGG - Intergenic
1179856242 21:44163918-44163940 ACCTCCCGGAGACCACCCCACGG + Intergenic
1180021119 21:45127719-45127741 ACCTCCCAGAGACTTCTCTTTGG + Intronic
1184180246 22:42817487-42817509 ACCTACCAGAGAGGAAACCATGG - Intronic
1184225462 22:43127007-43127029 CCATCCCAGTGACTACACCGGGG - Intronic
950570173 3:13794909-13794931 AGGTCCCAGAGACTAGGCCATGG - Intergenic
950936776 3:16847225-16847247 ACCTCTCAGAGACTTGGCCATGG + Intronic
951711818 3:25591104-25591126 ACCTCCCAGATACTTGCCCAGGG - Intronic
951825695 3:26865677-26865699 AGCTCCCACAGAGTAGACCAAGG + Intergenic
952631547 3:35475390-35475412 ATCTACCAGTGACTCCACCATGG + Intergenic
953468436 3:43146067-43146089 ACCTCCCGAAGACTCCATCATGG + Intergenic
954689637 3:52388769-52388791 GCCTCCCAGAGCCCACCCCACGG + Intronic
954751004 3:52813683-52813705 AACTCCCAGAGCCTAAACCCTGG - Intronic
957414092 3:79878391-79878413 CCCTCCCAGACACTGCAGCAGGG - Intergenic
958536585 3:95411810-95411832 GAGTCCCAGAGACTACAACAGGG - Intergenic
961424526 3:126834780-126834802 ACCTCCCCAAGACTCCAACACGG + Intronic
962046710 3:131767857-131767879 ACCACACAGAGCCTACACCCTGG + Intronic
962182978 3:133227511-133227533 ACCTCACAGACACTCTACCATGG - Intronic
962948371 3:140194950-140194972 ACCTCCTATAGACTACATGAGGG - Intronic
965511252 3:169570268-169570290 ACCCTCCAAAGACTAAACCAGGG + Intronic
965689772 3:171343177-171343199 ACCTGCCAAAGAATACAGCATGG + Intronic
967928530 3:194672631-194672653 ACCTCGGAGAGACCACACCTCGG - Intergenic
967962798 3:194939329-194939351 AGCTCCCAGTGACTACCCCAAGG + Intergenic
968768730 4:2489463-2489485 TGCTTCCAGAGACCACACCATGG - Intronic
969161238 4:5260877-5260899 GCCTCACTGAGACTGCACCAAGG - Intronic
970461842 4:16282529-16282551 AACTCCCAGAGACAAAACAACGG + Intergenic
972414285 4:38823739-38823761 ACCTCCCAGAAACGACGGCAGGG + Exonic
973693068 4:53460070-53460092 GCCTCCTAGAAACTACACTATGG - Intronic
981848771 4:149202493-149202515 ACCTCCCAGTGACTACAGCAAGG + Intergenic
982683392 4:158459287-158459309 AACACCCAGGGAGTACACCATGG - Intronic
985233184 4:187844275-187844297 ACCCTCCCGAGACTAAACCAGGG + Intergenic
991986491 5:72292361-72292383 AGCTCCCAGAGAATAGACCACGG + Intronic
992752554 5:79874661-79874683 GCTTCCCATAGGCTACACCAAGG + Intergenic
997418536 5:133748250-133748272 TCCTCCCAGCGACTTCACAAGGG - Intergenic
1001066280 5:168537395-168537417 TGCTCCCAGAGATTCCACCAAGG + Intergenic
1006385040 6:33726221-33726243 TCCTCCCATAGTCTACCCCATGG + Intronic
1006804358 6:36778659-36778681 ACCTCCCACCGACCACACCTAGG + Intronic
1007416978 6:41696925-41696947 CCCTCCCAGACACTCCCCCAAGG - Intronic
1012072246 6:94637466-94637488 ACTTTCCAAAGACTACTCCAGGG - Intergenic
1012676759 6:102124124-102124146 ACCTTCCAGAGATTAGAACATGG - Intergenic
1015252600 6:131142657-131142679 CCCACCCAGAGTCTCCACCAGGG + Intronic
1018115259 6:160577623-160577645 ACCTCCTACAGCCTGCACCAAGG - Intronic
1020078848 7:5275694-5275716 ACCTCACAGTGACTACAGGAGGG - Intronic
1021147639 7:17108223-17108245 ACCTCCCAGACACTCCTACAGGG - Intergenic
1025200039 7:56956473-56956495 ACCTCACAGTGACTACAGGAGGG + Intergenic
1025671905 7:63620459-63620481 ACCTCACAGTGACTACAGGAGGG - Intergenic
1026177645 7:68012099-68012121 GCCTTCCAGAGACTGGACCATGG - Intergenic
1027201855 7:76068961-76068983 ACCTCCCAGAGAGTTCACTCAGG + Intergenic
1030075110 7:105730075-105730097 TCCTTCCAGAGAGTACAGCATGG + Intronic
1032946533 7:136859970-136859992 AACTACCAGAAACTACAGCATGG - Intergenic
1038488739 8:27954366-27954388 ACCTCCCACCCACTCCACCACGG + Intronic
1038653691 8:29429096-29429118 ACCTCCTAGAGCCTCCAGCAGGG - Intergenic
1039783546 8:40812184-40812206 TCCTCCCAAAGAGTACACAATGG + Intronic
1041158711 8:55015117-55015139 ACCTGCCAGAGTTTACATCACGG - Intergenic
1043708125 8:83378534-83378556 AGCTCCCAGAGACTGTTCCAGGG - Intergenic
1044808766 8:96035825-96035847 ACCCTCCCAAGACTACACCAGGG - Intergenic
1046121162 8:109848742-109848764 ACATCCCAGGGAGTGCACCAGGG - Intergenic
1046545372 8:115642897-115642919 ACCTCGGAGATACTACACCTCGG + Intronic
1047435131 8:124829781-124829803 ACCACCCAGAAACTAGACTAAGG + Intergenic
1048027637 8:130601366-130601388 AACTCAAAGAGACCACACCAGGG + Intergenic
1052637567 9:31123581-31123603 AAATCCCAGAGACTAGACCAAGG - Intergenic
1052817740 9:33114537-33114559 ACTTTCCAGAGACTTCCCCATGG - Intronic
1054145565 9:61558677-61558699 ACCTCCCAGGGGCTGCATCATGG - Intergenic
1054465305 9:65489785-65489807 ACCTCCCAGGGGCTGCATCATGG - Intergenic
1057079009 9:92158421-92158443 TCCTTCCAGAGAGTACAGCATGG - Intergenic
1062035833 9:134382152-134382174 ACCTCCCAGCATCTACACCTTGG - Intronic
1062235001 9:135503521-135503543 ACCTGCCAGAGACCCCACCAAGG - Exonic
1062623465 9:137432947-137432969 TCCTCGCAGAGCCCACACCAAGG - Intronic
1185540938 X:902635-902657 ACCCCCCAGAAGCTCCACCATGG - Intergenic
1185540951 X:902687-902709 ACCCCCCAGAAGCTCCACCATGG - Intergenic
1187068571 X:15865304-15865326 ACCTCCTAGAGACTACTCTGAGG - Intergenic
1192400228 X:70827267-70827289 ACGACCCAGGGAGTACACCATGG + Intronic
1197362622 X:125525092-125525114 TCCTCCCTAAGACTACAACATGG - Intergenic
1198939657 X:141939322-141939344 AAGTCCCAGAGACCACAACAGGG - Intergenic
1199318099 X:146404250-146404272 ACCTGGCAGAGAGTAGACCAAGG + Intergenic
1201775906 Y:17665399-17665421 ACCTTCCCAAGACTAAACCAGGG - Intergenic
1201825650 Y:18240593-18240615 ACCTTCCCAAGACTAAACCAGGG + Intergenic