ID: 1167517054

View in Genome Browser
Species Human (GRCh38)
Location 19:49929552-49929574
Sequence CTGCGCATGCGCACTGGGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 5, 3: 19, 4: 190}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167517051_1167517054 -9 Left 1167517051 19:49929538-49929560 CCGAAGGCGCGCGGCTGCGCATG 0: 1
1: 0
2: 0
3: 2
4: 25
Right 1167517054 19:49929552-49929574 CTGCGCATGCGCACTGGGCCCGG 0: 1
1: 0
2: 5
3: 19
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167517054 Original CRISPR CTGCGCATGCGCACTGGGCC CGG Intronic
900207871 1:1439338-1439360 CTGCGGGTGCGCACGCGGCCCGG + Exonic
901317345 1:8318051-8318073 CTCCGCATCCGCGCGGGGCCCGG - Intronic
901382947 1:8887208-8887230 CTGCACTTGCACACTGGGACTGG - Intergenic
902206221 1:14870090-14870112 CTGTCCAGGAGCACTGGGCCTGG + Intronic
902380151 1:16048957-16048979 CAGGGCATGCGCCCTGGGCGGGG - Intronic
903068558 1:20715227-20715249 CTGACCCTGTGCACTGGGCCAGG - Intronic
905929341 1:41776339-41776361 CTGAGCATGCCCTCTGTGCCAGG + Intronic
905970985 1:42142285-42142307 CTGAGCATGCACAGTGTGCCGGG + Intergenic
906038174 1:42766312-42766334 CTGCCCATGCGAACTGGGCGAGG + Intronic
906262966 1:44407153-44407175 CTGCGCCGGCCCACTGGCCCGGG + Intronic
906345035 1:45009733-45009755 CTGGGCTTGTGCTCTGGGCCAGG + Intronic
907296757 1:53460511-53460533 GTGCGCAGGCGCACTGGGCCAGG - Intronic
907933680 1:59022806-59022828 CTAAGAATGCGCATTGGGCCTGG + Intergenic
909685242 1:78340555-78340577 CTGAGCATGCACAATGTGCCAGG - Intronic
911123555 1:94319609-94319631 CTGGGGATACGCACTGTGCCTGG + Intergenic
911450271 1:98053555-98053577 CCGCGAAGGCGCGCTGGGCCTGG - Intergenic
915097777 1:153475858-153475880 CTGAGCGTGGGCACCGGGCCTGG - Intergenic
919796831 1:201325877-201325899 CTGCTCATGAGCAGAGGGCCTGG + Intronic
923902059 1:238336656-238336678 CTGCACGTGCACACTGGGGCTGG + Intergenic
1066094141 10:32056446-32056468 CTGCGCAGGCGCAGTGGGCCAGG + Intergenic
1067097195 10:43309532-43309554 CTGGGCATGCCCACAGGGGCAGG + Intergenic
1069673907 10:70233501-70233523 GTGCGCAGGCGCACTCCGCCAGG + Intronic
1069820398 10:71224044-71224066 CTGAGGATGGTCACTGGGCCAGG - Intronic
1069902358 10:71713451-71713473 CTGGGCCTGCCCACTGGGGCAGG + Exonic
1071463120 10:85917195-85917217 CTGAGCCTGGGCACTGAGCCAGG + Intronic
1072871306 10:99124094-99124116 CTGCGCCTGGGCACTGAGGCAGG + Intronic
1073063371 10:100745066-100745088 CTAGGGATGCGCACTGGGCCCGG + Intronic
1075410728 10:122226048-122226070 CTGAGCACGCTCTCTGGGCCAGG - Intronic
1076010814 10:126986540-126986562 CTGGGCATGTGCTCTGGGTCAGG - Intronic
1077285621 11:1764034-1764056 CGGCGCACGCGCACAGCGCCCGG + Intergenic
1077325960 11:1964224-1964246 CGGCGCGTGGGCACTGGGCATGG + Intronic
1077775596 11:5268399-5268421 CTGCACATGGGGACTGGGCTTGG - Exonic
1081694879 11:45102781-45102803 CTGCCCCTGTGCAATGGGCCAGG - Intronic
1082776437 11:57248530-57248552 CTGAGCATTCGCCCTGTGCCAGG - Intergenic
1083389456 11:62337421-62337443 CTGCGCCTGCGCACGAGGGCGGG - Intergenic
1084145192 11:67261553-67261575 AGGCGCATGCGCGCTGGGCAGGG + Intergenic
1087602540 11:100335083-100335105 CTGCGCATGTGTAGTGGGCAGGG + Intronic
1089135044 11:116242253-116242275 CTGCGGCTTCTCACTGGGCCTGG + Intergenic
1089684662 11:120139110-120139132 CTGCCCATCCTCTCTGGGCCAGG + Intronic
1202808940 11_KI270721v1_random:19403-19425 CGGCGCGTGGGCACTGGGCATGG + Intergenic
1101353634 12:103956663-103956685 CTGCCCCTGCGCACATGGCCAGG + Exonic
1102890160 12:116552602-116552624 CTGCGCATGCTCACAGAACCTGG - Intergenic
1103342933 12:120230660-120230682 CTGCTCATGTGCTCTGGGCTGGG - Intronic
1103595369 12:122021874-122021896 CGGCGCTTGCGCACTGGGCCAGG + Exonic
1103900120 12:124299275-124299297 CAGAGCCTGCCCACTGGGCCTGG + Intronic
1104760856 12:131296926-131296948 CTGTGCATGAACCCTGGGCCTGG - Intergenic
1104818920 12:131663866-131663888 CTGTGCATGAACCCTGGGCCTGG + Intergenic
1104880212 12:132065505-132065527 CAGTCCATGAGCACTGGGCCAGG - Intronic
1105779095 13:23690791-23690813 CTGCAGATGCTCACTGGGACAGG - Intergenic
1106190657 13:27450026-27450048 CTGCGCAGGCGCCCTTCGCCTGG + Intronic
1107364446 13:39655619-39655641 CCGCGCATGCGCATCGGCCCCGG - Intronic
1107534064 13:41311215-41311237 CCGCGCATGCGCACAGGATCCGG + Exonic
1112402474 13:99087702-99087724 CTGAGCATGCGCCGCGGGCCTGG - Intergenic
1113640604 13:111954276-111954298 CTGTGCATGGGCATTGGCCCAGG - Intergenic
1114032048 14:18586683-18586705 CTAGGCATGCACATTGGGCCTGG + Intergenic
1114076828 14:19165713-19165735 CTAGGCATGCACATTGGGCCTGG + Intergenic
1114085333 14:19233855-19233877 CTAGGCATGCACATTGGGCCTGG - Intergenic
1114449847 14:22818339-22818361 CTGCCCGTGCGCACTAGGCAAGG + Intronic
1115203091 14:30874497-30874519 GTGCGCATGAGCACTGTGCGGGG - Intronic
1118317807 14:64736554-64736576 CTGCGCGAGGGCCCTGGGCCAGG + Intronic
1119640736 14:76312942-76312964 CTGGGCCTGCACAGTGGGCCAGG - Intronic
1121697647 14:95926709-95926731 CTGAGCATGAGCTATGGGCCAGG - Intergenic
1121872077 14:97417553-97417575 CTGCACATGCCCACCAGGCCAGG + Intergenic
1122200648 14:100120652-100120674 CTGCACCTGGACACTGGGCCCGG - Intronic
1202896897 14_GL000194v1_random:15563-15585 CTAGGCATGCACATTGGGCCTGG - Intergenic
1124453835 15:29822482-29822504 CCGGGCATGCTCAGTGGGCCGGG - Exonic
1125429641 15:39581734-39581756 CTGGGCATGGGGACAGGGCCGGG - Intronic
1126849881 15:52790404-52790426 TCGCGCATGCGCGCTGCGCCTGG - Intronic
1128104024 15:65029638-65029660 CTGCGCAGGCGCATCGGGGCGGG + Intronic
1128646305 15:69381090-69381112 CTGGGCCTGCGGACTGGGCAGGG + Intronic
1131061441 15:89407143-89407165 CTGCGCTTGCGGACTGGGAGCGG - Intergenic
1132988797 16:2782627-2782649 CTGAGTATGTGCACTGTGCCAGG - Intergenic
1134098373 16:11434681-11434703 CTGAGCATGCTCACTGGCCCTGG + Intronic
1138436515 16:57003640-57003662 CTGCGCATGTGCAAGGGGTCTGG - Intronic
1140067889 16:71626107-71626129 GTGCGCATGCGCGCTAGTCCGGG - Intergenic
1141456424 16:84145252-84145274 CTGCGCACGCGCACTCGGGACGG - Intergenic
1142989942 17:3723819-3723841 CTGCGCATGCGCACCTCGCCAGG - Intronic
1143140500 17:4739590-4739612 CTGCGCCCCCGCACTGGGCCCGG + Exonic
1145867700 17:28251325-28251347 CTGCTCATGCGCTCTGGTCGTGG - Intergenic
1145968661 17:28940766-28940788 CTGTGCATGCGTCCTGGGCATGG + Intronic
1151689745 17:75674991-75675013 ATGTTCATGTGCACTGGGCCTGG - Intronic
1152719868 17:81918178-81918200 TTGCGCATGCGCCCTGAGCGCGG - Exonic
1152753785 17:82078582-82078604 CTGCACAGGCACACAGGGCCCGG - Exonic
1157102536 18:44743553-44743575 CTGCCCATGCCCACTGCCCCTGG - Intronic
1157522087 18:48352368-48352390 CTGCGGATGCCCCCAGGGCCTGG - Intronic
1160691140 19:461103-461125 CCGCGGCTGCGCGCTGGGCCGGG - Intergenic
1160773380 19:843740-843762 CTGCCCACGCGCGCGGGGCCTGG - Intronic
1160824918 19:1074988-1075010 CCGCGCATGCGCAGGAGGCCGGG - Intronic
1160864325 19:1250347-1250369 CGGCGCCTGCGAGCTGGGCCCGG + Exonic
1161065727 19:2236355-2236377 GTGCGCAGGCGCACTAGCCCTGG - Exonic
1161344579 19:3761682-3761704 CCGCGCATGCTCAATGGGCCAGG - Exonic
1162937068 19:13986629-13986651 CTGGGCATGCGCAGGAGGCCAGG + Intronic
1163412935 19:17168098-17168120 CTACGCATGGGCACTGGGTCAGG + Intronic
1163547315 19:17948073-17948095 CGACGCATGCGCGCTGGGCGCGG - Intergenic
1163640213 19:18457853-18457875 CTGGGCATCCCCACAGGGCCTGG - Intronic
1165443800 19:35845748-35845770 CAACGCATCCGCACTGCGCCCGG - Exonic
1165898590 19:39157503-39157525 CTGCGCATGTACTCTGAGCCAGG + Intronic
1165996340 19:39846458-39846480 CGGCGCACGCGCAGTGAGCCTGG + Intergenic
1167469176 19:49665959-49665981 CCGCGCCTGCGCACTGGGCCGGG - Exonic
1167517054 19:49929552-49929574 CTGCGCATGCGCACTGGGCCCGG + Intronic
1167577726 19:50325771-50325793 CTGCGGCTGCGCACTGCGGCGGG - Intronic
1168151134 19:54449457-54449479 CTGCGCCTGCGCACCGGGCCTGG + Intronic
1168320076 19:55503845-55503867 ATGCGCAGGCGCGGTGGGCCCGG + Intronic
925014201 2:509526-509548 CTGGGCATCCCCTCTGGGCCAGG - Intergenic
925342984 2:3149553-3149575 CTGGGCATGCCCACGGGGGCCGG - Intergenic
927290748 2:21402611-21402633 CTTCGCATTCGCAGAGGGCCAGG + Intergenic
930209294 2:48617836-48617858 CCGCGCAGGCGCAAAGGGCCAGG + Exonic
932322545 2:70832846-70832868 GGGCGTATGAGCACTGGGCCAGG - Intronic
932753979 2:74392071-74392093 AAGCGCACGCGCACTGTGCCTGG + Intronic
935011624 2:99141405-99141427 GTACGCGTGCGCACCGGGCCTGG - Intronic
936954992 2:118014156-118014178 CAGAGCATGCGCGCTGGGGCCGG + Intergenic
937320870 2:120959972-120959994 CTGTGCAGGCGCAGGGGGCCTGG + Intronic
938491426 2:131763222-131763244 CTAGGCATGCACATTGGGCCTGG + Intronic
938496137 2:131799101-131799123 CTAGGCATGCACATTGGGCCTGG - Intronic
940096927 2:149987407-149987429 CTGCGCAGGGGCTCTGGGCATGG - Intergenic
940650292 2:156435415-156435437 CTGGGCATGCTCAGTGGGCAGGG + Intronic
942516008 2:176753864-176753886 CTGGGCAAGCCCACTGTGCCTGG - Intergenic
942607588 2:177709114-177709136 CGGCGAGTGGGCACTGGGCCAGG + Intronic
948208692 2:236177178-236177200 CTGAGCATCCTCTCTGGGCCAGG - Intergenic
1169137218 20:3204432-3204454 CTGCGCGTGCGCACCTGGGCGGG - Intronic
1172006556 20:31822449-31822471 CTGGGCATGTGCAATGGGGCAGG + Intronic
1176252317 20:64131626-64131648 CTGGGCATGTGCTCTGGGCTGGG + Intergenic
1176274409 20:64255676-64255698 CTGCGCATGCGCCGCGGGCCTGG - Intronic
1176367151 21:6040044-6040066 CTGCTCCCGGGCACTGGGCCAGG + Intergenic
1176510554 21:7744870-7744892 GTGCGCAGGCGCAGTGGGCCCGG - Intergenic
1176616586 21:9031559-9031581 CTAGGCATGCACATTGGGCCTGG - Intergenic
1176708545 21:10132073-10132095 CTAGGCATGCACATTGGGCCTGG + Intergenic
1178644667 21:34375399-34375421 GTGCGCAGGCGCAGTGGGCCCGG - Intergenic
1179492390 21:41749542-41749564 CTGCGCAGGTGCTCTGTGCCTGG - Intronic
1179573578 21:42292448-42292470 CTGAGCAGGTGCACTGGGGCTGG - Intronic
1179756368 21:43498502-43498524 CTGCTCCCGGGCACTGGGCCAGG - Intergenic
1180233644 21:46443357-46443379 GTGGGCATGAGCACTGCGCCTGG + Intronic
1180292638 22:10859338-10859360 CTAGGCATGCACATTGGGCCTGG + Intergenic
1180456162 22:15513740-15513762 CTAGGCATGCACATTGGGCCTGG + Intergenic
1180495443 22:15888760-15888782 CTAGGCATGCACATTGGGCCTGG + Intergenic
1182373659 22:29830185-29830207 CTGTGAATGAGCACTGTGCCTGG - Intronic
1182620605 22:31616554-31616576 CTGCCCCTGCACACAGGGCCTGG - Intronic
1183256032 22:36762930-36762952 CCGGGCATGGGCGCTGGGCCAGG - Exonic
1183258186 22:36776519-36776541 CGGCGCCTGCGCAGTGGGCCAGG + Intergenic
1184450176 22:44577958-44577980 CTGCGCATCAGCAGTGGGCGGGG - Intergenic
950168143 3:10816688-10816710 GTGCGCGTGCGCACTGGCACAGG - Intronic
952853931 3:37752184-37752206 CTGAGAATGCTCACTGGGTCAGG + Intronic
954121980 3:48504770-48504792 CAGCGCTGGCGCAGTGGGCCAGG + Intronic
959906118 3:111712756-111712778 CTGCACATGCTCACGAGGCCTGG - Intronic
960433476 3:117598267-117598289 CTGAGGATGAGCACTGGGTCTGG + Intergenic
961718942 3:128879422-128879444 CCGCGCAAGCGCAGTGGGGCCGG + Intergenic
963603767 3:147397446-147397468 CTGCTCATGCGCTCTGACCCGGG + Intronic
968506518 4:973573-973595 CCGCGCCTGCGCAGTGGGGCAGG - Intronic
968526204 4:1058819-1058841 GTGGGCATGCGGACTGTGCCTGG + Intronic
968691186 4:1991172-1991194 CTGAGCATGTACTCTGGGCCAGG + Intronic
983395133 4:167184461-167184483 CTGAGCATTCACACTGAGCCAGG + Intronic
985839018 5:2291631-2291653 CTGAGCGTGGACACTGGGCCGGG + Intergenic
986274936 5:6265552-6265574 CTGCCCATTCCTACTGGGCCAGG + Intergenic
986626499 5:9727889-9727911 CTACTCATGCTCACTGGGCTTGG - Intergenic
992812940 5:80407922-80407944 GTGCGCAAGCGCCCCGGGCCTGG + Intergenic
992820250 5:80488521-80488543 TTGGGAATGCGGACTGGGCCGGG + Intronic
998056531 5:139082997-139083019 TTGAGCATGGGCACTGGGCCAGG + Intronic
999397710 5:151240688-151240710 CCCAGCATGCGCCCTGGGCCTGG - Intronic
1001545530 5:172568475-172568497 CTGTGCATCCACCCTGGGCCAGG - Intergenic
1001957439 5:175857852-175857874 CTGAGCACGTGCTCTGGGCCAGG - Intronic
1002184113 5:177446406-177446428 CTGCGCACACGCAGTGGGCAGGG - Intergenic
1002296225 5:178232716-178232738 CTTCGCTTGCCCACTGGGCCTGG + Exonic
1002719074 5:181246963-181246985 ATAGGCATGCGCTCTGGGCCGGG + Intronic
1003169864 6:3712768-3712790 CTCCGCATGAGCACAGGGCAGGG + Intergenic
1003325417 6:5086546-5086568 CTGCGGACGCGCTCTGAGCCTGG + Exonic
1003873666 6:10419602-10419624 CGACGCATGCGCGCTGGCCCAGG + Intronic
1004114190 6:12750079-12750101 CTGCGCATGGGCGCGCGGCCCGG - Intronic
1006284260 6:33080982-33081004 CTGCTCCTGCGCCCTGGGCACGG - Intronic
1007897555 6:45378044-45378066 GGGCGCATGCGCGCTTGGCCAGG + Intronic
1016749542 6:147617705-147617727 CTGGGAATGCGCACAGGGCTAGG + Intronic
1017679040 6:156845294-156845316 CTCCGAATGCGCAGCGGGCCAGG - Intronic
1018949923 6:168372357-168372379 ATGCACATGCACACTGGCCCAGG + Intergenic
1019498899 7:1354712-1354734 CTGCTGATGCCCACTGAGCCGGG + Intergenic
1020192309 7:6009515-6009537 CCGCGCGTGCGCACTGGGCGGGG - Intronic
1024539330 7:50463282-50463304 CTGCCCATGTGCAGCGGGCCTGG - Exonic
1026091321 7:67302918-67302940 CCGCGCGTGCGCACTTGGCGCGG - Intergenic
1026745098 7:73005537-73005559 CCGCGCGTGCGCAGTGGGCGGGG + Intergenic
1026765488 7:73157046-73157068 CTGCGGCTGTGCACAGGGCCTGG + Intergenic
1027031210 7:74890232-74890254 CCGCGCGTGCGCAGTGGGCGGGG + Intergenic
1027041962 7:74966740-74966762 CTGCGGCTGTGCACAGGGCCTGG + Intronic
1027081680 7:75235615-75235637 CTGCGGCTGTGCACAGGGCCTGG - Intergenic
1027098642 7:75359543-75359565 CCGCGCGTGCGCAGTGGGCGGGG - Intergenic
1029390266 7:100270196-100270218 CTGCGGCTGTGCACAGGGCCTGG - Intronic
1029399741 7:100336355-100336377 CCGCGCGTGCGCAGTGGGCGGGG - Intronic
1029546837 7:101214850-101214872 CTGTGCCTGGGCACCGGGCCAGG - Intronic
1030727183 7:112939700-112939722 CTGCTCGTGCGCAGAGGGCCGGG - Exonic
1034649219 7:152676177-152676199 GCGCGCGTGCGCACTGCGCCAGG + Intergenic
1035112466 7:156494754-156494776 CCTCGCATGGGCCCTGGGCCTGG - Intergenic
1035435511 7:158856543-158856565 ATGCGCAGGCGCACTGGGAGAGG + Intergenic
1036612459 8:10362226-10362248 CTGAGCATCTGCACTGGGGCAGG - Intronic
1038816871 8:30913027-30913049 CGGCGCTTGCGCACTGCGCCGGG + Intergenic
1040640954 8:49333934-49333956 CTGCGCATCCACACTGGGAGGGG + Intergenic
1049237259 8:141518562-141518584 CTGCGCCCGCGCGCGGGGCCCGG + Exonic
1049742492 8:144247785-144247807 CTGCTCATGCCCACTGGCCATGG - Intronic
1049838551 8:144755449-144755471 CTGCGCAGTCGCACCGAGCCCGG + Exonic
1050472694 9:6008462-6008484 CTACGCATGCGCACCGGGGATGG - Intergenic
1053586484 9:39464277-39464299 CTGGGCCCGCGCACTGGGCCGGG + Intergenic
1053645512 9:40117586-40117608 CTAGGCATGCACATTGGGCCTGG + Intergenic
1053760202 9:41345941-41345963 CTAGGCATGCACATTGGGCCTGG - Intergenic
1054326530 9:63715487-63715509 CTAGGCATGCACATTGGGCCTGG + Intergenic
1054539061 9:66258386-66258408 CTAGGCATGCACATTGGGCCTGG - Intergenic
1054579822 9:66900956-66900978 CTGGGCCCGCGCACTGGGCCGGG - Intronic
1056643180 9:88388303-88388325 CTGCGCAGGCGCAGTGGGGCGGG - Intergenic
1057706795 9:97400353-97400375 CTGGCCATGGGCACTAGGCCTGG - Intergenic
1059119721 9:111631280-111631302 CCGCGCAGGCGCACAGGGCGCGG - Intergenic
1059401715 9:114074742-114074764 CTGGGCATGGGCACTGGGTGGGG + Intronic
1060193278 9:121606563-121606585 CTGCCCGTGAGCACTGGACCTGG - Intronic
1062417943 9:136462835-136462857 CTGCACATGTCCACTGGGTCGGG - Intronic
1202793306 9_KI270719v1_random:101042-101064 CTAGGCATGCACATTGGGCCTGG + Intergenic
1185610526 X:1391688-1391710 CCACGCGTGCGCACTGGGCCCGG - Intronic
1187510150 X:19910395-19910417 CTGTGCATCTGCTCTGGGCCAGG - Intergenic
1189997452 X:46652426-46652448 ATAGGCATGCGCACTGTGCCTGG + Intronic
1190915547 X:54808852-54808874 GTGCGCATGCGCAATGGTCGTGG - Intronic
1200084939 X:153599323-153599345 CTGCGCCTGCGCGCGCGGCCAGG - Intronic
1201149966 Y:11090282-11090304 CTAGGCATGCACATTGGGCCTGG - Intergenic