ID: 1167519757

View in Genome Browser
Species Human (GRCh38)
Location 19:49947116-49947138
Sequence TACTTAAACCCGGGGGGCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 31704
Summary {0: 1, 1: 1, 2: 23, 3: 1464, 4: 30215}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167519757_1167519764 8 Left 1167519757 19:49947116-49947138 CCTCGGCCCCCCGGGTTTAAGTA 0: 1
1: 1
2: 23
3: 1464
4: 30215
Right 1167519764 19:49947147-49947169 GCCTCAGCCTCCCTAGTAGCTGG 0: 6861
1: 191001
2: 257873
3: 186273
4: 171967
1167519757_1167519768 17 Left 1167519757 19:49947116-49947138 CCTCGGCCCCCCGGGTTTAAGTA 0: 1
1: 1
2: 23
3: 1464
4: 30215
Right 1167519768 19:49947156-49947178 TCCCTAGTAGCTGGGATTATAGG 0: 427
1: 13910
2: 125823
3: 267847
4: 263307
1167519757_1167519766 9 Left 1167519757 19:49947116-49947138 CCTCGGCCCCCCGGGTTTAAGTA 0: 1
1: 1
2: 23
3: 1464
4: 30215
Right 1167519766 19:49947148-49947170 CCTCAGCCTCCCTAGTAGCTGGG 0: 7839
1: 209224
2: 276986
3: 184996
4: 195979

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167519757 Original CRISPR TACTTAAACCCGGGGGGCCG AGG (reversed) Intronic
Too many off-targets to display for this crispr