ID: 1167520784

View in Genome Browser
Species Human (GRCh38)
Location 19:49953326-49953348
Sequence GAGGCTGATCACTTCTTGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 69}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167520781_1167520784 -6 Left 1167520781 19:49953309-49953331 CCATAGGGATGGAAGGGGAGGCT 0: 1
1: 0
2: 8
3: 25
4: 235
Right 1167520784 19:49953326-49953348 GAGGCTGATCACTTCTTGCGGGG 0: 1
1: 0
2: 2
3: 7
4: 69
1167520775_1167520784 0 Left 1167520775 19:49953303-49953325 CCCATCCCATAGGGATGGAAGGG 0: 1
1: 1
2: 8
3: 34
4: 151
Right 1167520784 19:49953326-49953348 GAGGCTGATCACTTCTTGCGGGG 0: 1
1: 0
2: 2
3: 7
4: 69
1167520777_1167520784 -1 Left 1167520777 19:49953304-49953326 CCATCCCATAGGGATGGAAGGGG 0: 1
1: 4
2: 7
3: 33
4: 163
Right 1167520784 19:49953326-49953348 GAGGCTGATCACTTCTTGCGGGG 0: 1
1: 0
2: 2
3: 7
4: 69
1167520769_1167520784 22 Left 1167520769 19:49953281-49953303 CCTTTTGGGGACCAAGGCAGGAC 0: 1
1: 0
2: 2
3: 35
4: 360
Right 1167520784 19:49953326-49953348 GAGGCTGATCACTTCTTGCGGGG 0: 1
1: 0
2: 2
3: 7
4: 69
1167520770_1167520784 11 Left 1167520770 19:49953292-49953314 CCAAGGCAGGACCCATCCCATAG 0: 1
1: 2
2: 11
3: 40
4: 139
Right 1167520784 19:49953326-49953348 GAGGCTGATCACTTCTTGCGGGG 0: 1
1: 0
2: 2
3: 7
4: 69
1167520780_1167520784 -5 Left 1167520780 19:49953308-49953330 CCCATAGGGATGGAAGGGGAGGC 0: 1
1: 0
2: 8
3: 22
4: 224
Right 1167520784 19:49953326-49953348 GAGGCTGATCACTTCTTGCGGGG 0: 1
1: 0
2: 2
3: 7
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167520784 Original CRISPR GAGGCTGATCACTTCTTGCG GGG Intronic
901737959 1:11324217-11324239 GAGGCTGGTCGCATCTTGCTCGG + Intergenic
902964990 1:19994693-19994715 GAGGCTGATGACTTCTGGATGGG + Intergenic
903717460 1:25378773-25378795 GAGGCAGAACACGTCTTGCAGGG - Intronic
909436841 1:75651967-75651989 GAAGCTGATCACTTGTTTCAGGG - Intergenic
921939803 1:220827883-220827905 GAGGTTGATCTCTTCTTCTGGGG + Intergenic
1069565500 10:69460903-69460925 GAGGATGAGCACTTCTTGGTTGG + Intronic
1077333314 11:1992879-1992901 GAGGCTGAGCACCTGCTGCGGGG + Intergenic
1079135543 11:17774310-17774332 CAGGCTGAGCTCTTCTTGCCAGG - Intronic
1080643728 11:34173531-34173553 AAGGCTGATCACCCCTTGCAAGG + Intronic
1084962163 11:72722586-72722608 GAGGCTGATCACTTGTTGCCAGG - Intronic
1089647465 11:119889651-119889673 GAGACTGCTCACTTCCTGCCCGG - Intergenic
1202816294 11_KI270721v1_random:48060-48082 GAGGCTGAGCACCTGCTGCGGGG + Intergenic
1092468521 12:8756917-8756939 GAGGCTGATCACTTGAGGCCAGG - Intronic
1093278491 12:17159764-17159786 GAGGCTGATCGCTTGGTGGGAGG + Intergenic
1107291749 13:38862580-38862602 GAGGCTGACCACTTCTTCTGTGG + Intronic
1117839373 14:59842827-59842849 GAGTCTGATCAGTTCTGGTGAGG + Intronic
1133444657 16:5849647-5849669 GAGGCTGCTCTCCTGTTGCGTGG + Intergenic
1134181106 16:12048501-12048523 CAGGCTGCTCACTCCTTGCGTGG - Exonic
1135307843 16:21382256-21382278 CACGCTGCTCACTCCTTGCGTGG - Intergenic
1136304588 16:29361376-29361398 CACGCTGCTCACTCCTTGCGTGG - Intergenic
1137778114 16:51073422-51073444 GAAGCTGATCACTTCCAGCTGGG - Intergenic
1138073705 16:54019531-54019553 GAGGATGATCACTACCTGGGAGG - Intronic
1138444319 16:57053940-57053962 GGGGCTGATCACTGCTGGGGTGG + Intronic
1139475390 16:67200198-67200220 GAGGCTGAGCAGCTCTTGGGTGG + Exonic
1141804998 16:86336500-86336522 GGGGCTGAGCACTCTTTGCGTGG - Intergenic
1147017130 17:37501162-37501184 GAGGCTGAGCAGTGCTTACGTGG + Intronic
1152800429 17:82328300-82328322 GAGGCTCATCACTGCCTGTGGGG - Intronic
1153116498 18:1663196-1663218 GAGTCTGATGACTTCTTGAGAGG - Intergenic
1154072341 18:11163948-11163970 GAGGCTGAGCACTCCTTGGAGGG + Intergenic
1159096294 18:63906191-63906213 GAGGCTGATCCCTTATGGCTTGG + Intronic
1160139035 18:76302876-76302898 GATGTTGATCACTTCATGTGAGG - Intergenic
1162980205 19:14234130-14234152 GAGGCGGATCACTTGTGGCCAGG + Intergenic
1163635581 19:18435749-18435771 GAGCCTGACCACTGCGTGCGTGG - Exonic
1165974214 19:39660337-39660359 GAGGCTGAAAACTTGTTGGGTGG + Intronic
1167520784 19:49953326-49953348 GAGGCTGATCACTTCTTGCGGGG + Intronic
1168569152 19:57450485-57450507 GAGTCTGATCCCTTCGGGCGAGG + Intronic
935544637 2:104387660-104387682 GAGGCTGATCAGTTCCTTCTTGG - Intergenic
942246357 2:174012648-174012670 GAGGGAGCTCACTTCTTCCGGGG - Intergenic
942768131 2:179481786-179481808 GAGCCTGCTGACTTCTTGCCTGG - Intronic
942901614 2:181126691-181126713 GTTGCTGATCACTTTTTGGGGGG + Intergenic
944119537 2:196226138-196226160 GAGGCTGATCCCTTATGGCTTGG + Intronic
944924603 2:204451579-204451601 AAGGCTGATTACTTCCTGCTAGG + Intergenic
948133065 2:235615109-235615131 GAGGCTGCTCATTCCCTGCGCGG - Intronic
948508264 2:238445948-238445970 CAGGCTGAGCACTGCTTGAGGGG - Intronic
1170573845 20:17648023-17648045 GAGGCTGATGACTGCTTGCGTGG - Intronic
1174665371 20:52253242-52253264 GAGGCTGACGACTCCTTGCATGG - Intergenic
1176418289 21:6492847-6492869 GAGGCTTATCCCTTCTAGGGAGG - Intergenic
1177373818 21:20241680-20241702 GAGCCTGATAACTACTTGCCTGG - Intergenic
1179693782 21:43101169-43101191 GAGGCTTATCCCTTCTAGGGAGG - Intronic
1183797080 22:40128238-40128260 GAGGCTGATCTCATCTCGCAGGG + Intronic
1184432219 22:44448174-44448196 GAGACTGATGACTACTTGTGAGG + Intergenic
954171840 3:48810005-48810027 GAGGCACATCATTTCTTGCTTGG + Intronic
954635668 3:52069507-52069529 GAGGCTGGGAACTGCTTGCGAGG + Intergenic
962501461 3:135997838-135997860 GATTCTCATCACTTCTTGCATGG + Intronic
969235247 4:5861064-5861086 GCGGCTGATGACTTCTTCCAAGG - Exonic
973664042 4:53139295-53139317 GACGCTCCTCACTTCTTGTGGGG - Intronic
977372987 4:96163931-96163953 GAGTCTCATCACTCCTTGCAGGG + Intergenic
981079318 4:140622819-140622841 GAGGCTGGTCACTGCTGCCGTGG + Exonic
982958023 4:161795393-161795415 CAGGCTGAGCACTTCATGAGAGG + Intronic
983738891 4:171102240-171102262 GACTCTGATCATTTCTTGCAGGG - Intergenic
988210298 5:28195366-28195388 GAGGCTCATCTCTCCTTGAGGGG - Intergenic
990841378 5:60083122-60083144 GAGCCTGATCACTTCTTTTAGGG - Intronic
994824349 5:104694578-104694600 GAGGCTGATAACTTCCTACATGG + Intergenic
999382617 5:151132046-151132068 CAGGCTGATCATTTCCTGAGGGG - Intronic
1000317063 5:160102467-160102489 GAGGCTGATCACTTGAGGCCAGG + Intronic
1006478517 6:34273420-34273442 GAGGCTGGTCACTTCCTGCCAGG - Intergenic
1008675617 6:53815000-53815022 TTGGCTGGTCACTTGTTGCGGGG + Intronic
1017707353 6:157135893-157135915 GAGACTGATGACATCTTGGGTGG - Intronic
1023047266 7:36221034-36221056 CAGGCTGATCATTTCAGGCGAGG - Intronic
1023901496 7:44484221-44484243 GGAGCTGATCCCTTCTTGTGTGG - Intronic
1025191146 7:56896943-56896965 GAGGTTGGTCACTTCTTGCATGG + Intergenic
1025262465 7:57427808-57427830 GATGCTGCTCACATCTTGCAAGG - Intergenic
1025680802 7:63679987-63680009 GAGGTTGGTCACTTCTTGCATGG - Intergenic
1036223020 8:6936812-6936834 GAGCCTCATCACCTCTTGCCTGG + Exonic
1040060218 8:43097343-43097365 GATAGTGATCACTTCTTGAGGGG + Intronic
1040503902 8:48029475-48029497 GAGTCTGAGCTCTTCTTGCCAGG + Intronic
1044729345 8:95217880-95217902 GAGGCTATTTACTTCTTGCCTGG + Intergenic
1060638682 9:125220554-125220576 GGGGCTGGTCACTTCTGGCGTGG - Exonic
1196923946 X:120613268-120613290 GAGGCTGATCACTTGAGGCCAGG - Intronic