ID: 1167523266

View in Genome Browser
Species Human (GRCh38)
Location 19:49969527-49969549
Sequence CTGTGAAAGGAGAAGTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167523255_1167523266 5 Left 1167523255 19:49969499-49969521 CCTCATGCCCTCTGCCCTGCTGC No data
Right 1167523266 19:49969527-49969549 CTGTGAAAGGAGAAGTTGGGAGG No data
1167523254_1167523266 22 Left 1167523254 19:49969482-49969504 CCTGGTTTGGGGCTGGTCCTCAT No data
Right 1167523266 19:49969527-49969549 CTGTGAAAGGAGAAGTTGGGAGG No data
1167523256_1167523266 -2 Left 1167523256 19:49969506-49969528 CCCTCTGCCCTGCTGCTTCCCCT No data
Right 1167523266 19:49969527-49969549 CTGTGAAAGGAGAAGTTGGGAGG No data
1167523253_1167523266 26 Left 1167523253 19:49969478-49969500 CCTTCCTGGTTTGGGGCTGGTCC No data
Right 1167523266 19:49969527-49969549 CTGTGAAAGGAGAAGTTGGGAGG No data
1167523259_1167523266 -10 Left 1167523259 19:49969514-49969536 CCTGCTGCTTCCCCTGTGAAAGG No data
Right 1167523266 19:49969527-49969549 CTGTGAAAGGAGAAGTTGGGAGG No data
1167523258_1167523266 -9 Left 1167523258 19:49969513-49969535 CCCTGCTGCTTCCCCTGTGAAAG No data
Right 1167523266 19:49969527-49969549 CTGTGAAAGGAGAAGTTGGGAGG No data
1167523257_1167523266 -3 Left 1167523257 19:49969507-49969529 CCTCTGCCCTGCTGCTTCCCCTG No data
Right 1167523266 19:49969527-49969549 CTGTGAAAGGAGAAGTTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167523266 Original CRISPR CTGTGAAAGGAGAAGTTGGG AGG Intergenic
No off target data available for this crispr