ID: 1167524865

View in Genome Browser
Species Human (GRCh38)
Location 19:49977361-49977383
Sequence CACTCACTCAGCCCCTTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 206}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167524865_1167524874 7 Left 1167524865 19:49977361-49977383 CCAACCAAGGGGCTGAGTGAGTG 0: 1
1: 0
2: 2
3: 30
4: 206
Right 1167524874 19:49977391-49977413 GGGAGCGCGTGGGTGTGAGACGG 0: 1
1: 0
2: 3
3: 38
4: 307
1167524865_1167524877 20 Left 1167524865 19:49977361-49977383 CCAACCAAGGGGCTGAGTGAGTG 0: 1
1: 0
2: 2
3: 30
4: 206
Right 1167524877 19:49977404-49977426 TGTGAGACGGTGGAGACCCTGGG 0: 1
1: 0
2: 0
3: 9
4: 101
1167524865_1167524870 -4 Left 1167524865 19:49977361-49977383 CCAACCAAGGGGCTGAGTGAGTG 0: 1
1: 0
2: 2
3: 30
4: 206
Right 1167524870 19:49977380-49977402 AGTGGCCTCCAGGGAGCGCGTGG 0: 1
1: 0
2: 2
3: 22
4: 205
1167524865_1167524871 -3 Left 1167524865 19:49977361-49977383 CCAACCAAGGGGCTGAGTGAGTG 0: 1
1: 0
2: 2
3: 30
4: 206
Right 1167524871 19:49977381-49977403 GTGGCCTCCAGGGAGCGCGTGGG 0: 1
1: 0
2: 2
3: 15
4: 145
1167524865_1167524878 23 Left 1167524865 19:49977361-49977383 CCAACCAAGGGGCTGAGTGAGTG 0: 1
1: 0
2: 2
3: 30
4: 206
Right 1167524878 19:49977407-49977429 GAGACGGTGGAGACCCTGGGAGG 0: 1
1: 0
2: 1
3: 32
4: 289
1167524865_1167524876 19 Left 1167524865 19:49977361-49977383 CCAACCAAGGGGCTGAGTGAGTG 0: 1
1: 0
2: 2
3: 30
4: 206
Right 1167524876 19:49977403-49977425 GTGTGAGACGGTGGAGACCCTGG 0: 1
1: 0
2: 2
3: 10
4: 134
1167524865_1167524875 10 Left 1167524865 19:49977361-49977383 CCAACCAAGGGGCTGAGTGAGTG 0: 1
1: 0
2: 2
3: 30
4: 206
Right 1167524875 19:49977394-49977416 AGCGCGTGGGTGTGAGACGGTGG 0: 1
1: 0
2: 0
3: 5
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167524865 Original CRISPR CACTCACTCAGCCCCTTGGT TGG (reversed) Intronic
901326865 1:8371870-8371892 CACCCACTTGGCCCCTGGGTCGG - Intronic
901668550 1:10840176-10840198 CACACACTCAGCCCTCTGCTGGG - Intergenic
902991361 1:20189532-20189554 CACTCACACAGACTTTTGGTGGG + Intronic
903015576 1:20359414-20359436 CACACACACAGCCCCATGGTAGG - Intergenic
903306648 1:22417652-22417674 CACGCACACAGCCCCTCTGTGGG + Intergenic
903640601 1:24857356-24857378 CACTCACTCTACCCCTCGCTGGG - Intergenic
904263895 1:29306826-29306848 CACTCATCCTGTCCCTTGGTTGG + Intronic
904301271 1:29556407-29556429 CTCTCACTCAGCCCATTGTGAGG + Intergenic
904685055 1:32253669-32253691 TGCCCACTCAGCACCTTGGTGGG + Intronic
905873965 1:41420498-41420520 CAATCACACAGCCCAGTGGTGGG + Intergenic
908317146 1:62944067-62944089 CATTCACTGAGCCCCGTGGAAGG + Intergenic
910689683 1:89953387-89953409 CACTGAGTCAGCCTCTGGGTGGG - Intergenic
912138713 1:106695123-106695145 CACACACTCAGCCTTTTGGAGGG - Intergenic
913115693 1:115694621-115694643 CACTCACTCAGTACGTAGGTTGG - Exonic
915306053 1:154979644-154979666 TATTCACTGTGCCCCTTGGTTGG + Intergenic
916386601 1:164279980-164280002 AATTCACTCAGCCCCGTGGAAGG + Intergenic
916688319 1:167167762-167167784 CACTGAGTCAGCTCCTGGGTGGG + Intergenic
919638852 1:200029958-200029980 CTCTCCCTCAGCCCTTTGGATGG - Intronic
921199719 1:212792970-212792992 CATACACTCACCCCCTTGCTTGG - Intronic
921283107 1:213586305-213586327 CACTCTCTCAGCCCCTGGCTCGG + Intergenic
921882010 1:220266304-220266326 CACTCACTCAGGTACTTGGAAGG + Intronic
922737815 1:227998798-227998820 CAGTCCATCAGCCCCTTTGTGGG - Intergenic
924626326 1:245699016-245699038 CATTCACTGAGCCACTTGTTGGG - Exonic
1064058978 10:12121264-12121286 CACTCTCTCAACCCCTCTGTTGG + Exonic
1066053951 10:31663048-31663070 CACTCCCCCAGCCTCTTCGTGGG - Intergenic
1067560556 10:47301585-47301607 CACTTCCTCAGCCCCTTGGATGG + Intronic
1067570110 10:47365343-47365365 CACTCACTCAATCCCTTGCCTGG + Intergenic
1068717097 10:60200519-60200541 CACTCACTCACCCCCCTGCTTGG - Intronic
1071495461 10:86164808-86164830 CACTCACTCAGCCTCTCTCTTGG + Intronic
1072328121 10:94318625-94318647 CCCACACTCAGCACCTTGGGAGG + Intronic
1074037825 10:109758399-109758421 CACTCACACAGCAGCTGGGTAGG + Intergenic
1074527686 10:114276235-114276257 CAGCGACTCAGCCCTTTGGTGGG - Intronic
1077047217 11:551929-551951 CGCTCCCGCAGGCCCTTGGTGGG - Exonic
1080822713 11:35822342-35822364 CACTCACTCAGCCACTACGGTGG - Intergenic
1081618666 11:44605467-44605489 CAGTCAATCACCCCCATGGTTGG - Intronic
1081724593 11:45319272-45319294 CACTGAGTCAGCCTCTGGGTAGG + Intergenic
1083516462 11:63263417-63263439 CACTCACTCCCTCCCTTGGCTGG + Intronic
1084184250 11:67463321-67463343 CACTCAGCCAGCCTCTTGGTTGG + Exonic
1084320981 11:68373283-68373305 CACCCTCTCAGCCCCTTCCTTGG - Intronic
1084769501 11:71333632-71333654 AACTGAGTCAGCCTCTTGGTGGG - Intergenic
1086571829 11:88294137-88294159 CACTGACTCAGCCTCTGGGATGG - Exonic
1087129027 11:94652970-94652992 GACTGACTGAGCCCCTTGGTGGG - Intergenic
1090230364 11:125098536-125098558 AAGTCAGTCAGCCACTTGGTTGG - Intronic
1090997723 11:131882053-131882075 CACTCACTTGGGCCCTTTGTTGG - Intronic
1094192647 12:27712725-27712747 CCCACACTCAGCCCCTTGGCAGG - Intronic
1094503014 12:31037077-31037099 CTTCCACTCAGCCCCTTGGCTGG - Intergenic
1095359597 12:41320118-41320140 CGCTACCTCAGCCCCTAGGTGGG - Intronic
1095599486 12:43999553-43999575 CACTCACTCTGCCTCCTGGGCGG + Intronic
1096780673 12:53990321-53990343 CACACACTCAGCCTCTTCGGGGG - Intronic
1096788825 12:54032836-54032858 CACTCCCTCTCCCCCTTGGTTGG + Exonic
1097643189 12:62205940-62205962 CACTCACTGACTCCCTTGGTTGG + Intronic
1099374691 12:81884898-81884920 CACTCAGTCAGTCTCTAGGTAGG + Intergenic
1103506349 12:121444154-121444176 CACTCACTCCTCCGCTTGGCAGG + Exonic
1104256479 12:127143517-127143539 CACTCACTGCGTCCCTTGGCTGG + Intergenic
1104759916 12:131290977-131290999 CACTCACTCAACCCCTCTGCAGG + Intergenic
1104820808 12:131676183-131676205 CACTCACTCAACCCCTCTGCAGG - Intergenic
1106915520 13:34509901-34509923 CACTCACTCATTCAGTTGGTTGG - Intergenic
1108550030 13:51534709-51534731 CACTAAAGCAGCCCCTTGGCAGG - Intergenic
1110672304 13:78195101-78195123 CACCAACTCAGCCCCCTGCTGGG + Intergenic
1111337831 13:86846186-86846208 CCCTCACTCAGCCCCTTTTTGGG - Intergenic
1113758549 13:112831568-112831590 CACTCACTCACACACTTGGACGG - Intronic
1115403044 14:32985214-32985236 CAGTCACCAAGCCCATTGGTAGG - Intronic
1116161114 14:41267907-41267929 CATTCATTCAGTCCATTGGTGGG - Intergenic
1116320859 14:43460596-43460618 CTGTCACTCAGACTCTTGGTTGG + Intergenic
1120748408 14:88174765-88174787 CACTCAGTTGGCCCCTTGGAGGG + Intergenic
1120925492 14:89793459-89793481 CACTTACTCAGCCCCTCAGAGGG + Intergenic
1121016458 14:90552228-90552250 CACTCACTCAGCCCCTCACCGGG + Intronic
1122987558 14:105219529-105219551 CCCTCACTTGGCCCCTTTGTGGG - Intronic
1124542870 15:30604027-30604049 CACTCACACAGCTGCCTGGTAGG + Intergenic
1125573267 15:40737425-40737447 CACTGAATCAGCCACATGGTTGG - Intronic
1127534147 15:59874366-59874388 TTTTCACTCAGCCCCTTGGCAGG - Intergenic
1128015854 15:64346043-64346065 CTCACACTCAGCACTTTGGTAGG - Intronic
1132712609 16:1276280-1276302 CACTCCCACCTCCCCTTGGTGGG + Intergenic
1132955014 16:2587062-2587084 AACCCACTCAGCCCCTGGGCCGG - Intronic
1133125539 16:3643534-3643556 CACCCACTCCGCTCCGTGGTGGG - Intronic
1133859147 16:9577532-9577554 CTCTCACTCAGCACTTTGGGAGG - Intergenic
1134020082 16:10915501-10915523 CCCTCATTCAGCCCCAGGGTGGG - Intronic
1134034746 16:11021089-11021111 CACTTCCTCAGCCCCTAGGGAGG + Intronic
1135497046 16:22962012-22962034 AACTCACTCATCCCCAAGGTAGG + Intergenic
1138261411 16:55626004-55626026 CACCCACTTTGCCCCTTAGTGGG + Intergenic
1138302695 16:55945860-55945882 CACTCAGTCAGGCTCTTGATCGG + Intronic
1139047663 16:63082266-63082288 CACTCACTCTGACTCTTGGCTGG + Intergenic
1139671737 16:68497054-68497076 CACTCACTTAGCTCCCTGGAGGG + Intergenic
1139747596 16:69087153-69087175 CACTCACTCAGCCTTGTGCTTGG + Intergenic
1140855332 16:78972918-78972940 CAATTACTCAGCCCTTCGGTCGG - Intronic
1141135667 16:81463665-81463687 CACTTATTCAGCCCCCTGGGTGG + Intronic
1141533503 16:84662713-84662735 CACTCACTCACCCTCATGGGTGG - Intronic
1141701094 16:85642483-85642505 CCCTGTCTCAGCCCCTTGGAAGG - Intronic
1142282578 16:89156355-89156377 CACACACCCTGCCCCTTGCTGGG + Intergenic
1143222235 17:5272360-5272382 CACTGACTCAGTTCCTGGGTGGG - Intergenic
1143804742 17:9417008-9417030 CACTGAGTCAGCCTCTGGGTAGG - Intronic
1144306475 17:13973301-13973323 GCCTGACTGAGCCCCTTGGTGGG - Intergenic
1145833202 17:27934195-27934217 CACTGAGTCAGCTCCTGGGTGGG + Intergenic
1147149316 17:38504914-38504936 CAGTCTCTCAGCTCCGTGGTGGG + Intronic
1147463988 17:40596452-40596474 CACTAGCACAGCCACTTGGTGGG - Intergenic
1149082845 17:52678602-52678624 CAGGCACTCAGCTCCTTTGTTGG - Intergenic
1149384067 17:56124700-56124722 CCCTCACTCTGCCCCTTGGATGG + Intronic
1151204956 17:72499793-72499815 CCCTTTCTCAGCCCCTTAGTAGG - Intergenic
1151321031 17:73352447-73352469 CACTCCCTCAGCCCCCAGGCCGG + Intronic
1152266368 17:79297235-79297257 CACTCACTAAGTCCCTAGATGGG - Intronic
1152877606 17:82795982-82796004 CCCTCACCCACCACCTTGGTAGG - Intronic
1153460201 18:5324912-5324934 CACTCACCACTCCCCTTGGTTGG - Intergenic
1153785152 18:8528126-8528148 CACTCACTGTGTCCCTGGGTTGG - Intergenic
1156866612 18:41895699-41895721 CACTGAGTCAGCCTCTGGGTAGG - Intergenic
1157746463 18:50140334-50140356 CACTCACTCAGCACCATGTTTGG - Intronic
1161903923 19:7140975-7140997 CACTCACCCAGCACCTTGCATGG + Intronic
1163686495 19:18714850-18714872 CCCTCCCTCAGCCCTTTGGAGGG + Intronic
1163886251 19:19967247-19967269 CACTCACTGCCCCCCTTGGCTGG + Intergenic
1164599679 19:29552490-29552512 CACTCACTGACTCCCTTGGCTGG - Intronic
1164813360 19:31175658-31175680 CTCTGGCTCAGGCCCTTGGTGGG + Intergenic
1165122429 19:33568925-33568947 CACTGAGTCAGCTCCTGGGTGGG - Intergenic
1166830694 19:45638066-45638088 CACTAACTCAGCACATTGGGAGG - Intronic
1167524865 19:49977361-49977383 CACTCACTCAGCCCCTTGGTTGG - Intronic
926133779 2:10322511-10322533 AACTCACTGGGCCCCCTGGTTGG - Intronic
927188448 2:20499415-20499437 CACTCACACATCTCCTTGGGAGG + Intergenic
930621262 2:53646268-53646290 CACTTACTCAGTTCCTGGGTGGG - Intronic
935337992 2:102034753-102034775 CACTCCCTCAGCCTCCTGATCGG - Intergenic
937307359 2:120880595-120880617 CACAGGCTCAGCCTCTTGGTGGG - Intronic
938084730 2:128391384-128391406 CACACTCTCAGCCCCGTGCTGGG - Intergenic
938628787 2:133142109-133142131 CACTCACTCAGCTCATTTATAGG - Intronic
943612179 2:190046016-190046038 CACTCACTGCTTCCCTTGGTGGG + Intronic
944400988 2:199326078-199326100 CACTGACTCAGCCTTTTAGTTGG - Intronic
944665319 2:201954463-201954485 CACTCACTGAGCACCTAGGAGGG + Intergenic
946372194 2:219287648-219287670 CACAGACTAAGCCCCTGGGTAGG + Intergenic
948450096 2:238063887-238063909 CACTCTTTCTACCCCTTGGTAGG - Intronic
948515841 2:238503480-238503502 CCCTCACTCAGCCCCTGGGCGGG - Intergenic
949014833 2:241702967-241702989 CACTGTCTCAGCCCCTGGGCGGG - Intronic
1169326398 20:4680223-4680245 CCCTCATTCAGCCCCTTCCTCGG - Intergenic
1173634260 20:44541035-44541057 AACTGACTCAGCCGTTTGGTTGG + Intronic
1174536277 20:51253971-51253993 CACTCAGCGAGCTCCTTGGTGGG - Intergenic
1174742825 20:53032513-53032535 CCATCAGTCAGGCCCTTGGTAGG + Intronic
1174776979 20:53352515-53352537 CACTCTCTCAGCACTTTGGGAGG + Intronic
1177685801 21:24435728-24435750 CATTCACTGAGCCCCTTAGGAGG + Intergenic
1178785552 21:35649992-35650014 CACTCAGTCAGTCCCTGAGTGGG - Intronic
1179178033 21:39022705-39022727 CACTCACCCAGCCCCCTCCTGGG - Intergenic
1179818271 21:43921903-43921925 CACTCACCCCACACCTTGGTGGG - Intronic
1181004886 22:20008557-20008579 CACTCACCCAGCCTCATGCTGGG - Intronic
1181116654 22:20635855-20635877 TACTCACTGAGCCCAGTGGTGGG + Intergenic
1181804518 22:25366806-25366828 CACCCTCTCAGCCCCTTACTTGG + Intronic
1182123858 22:27802435-27802457 CAGTCACTCAGCCACTTTATGGG + Intergenic
1184033343 22:41907348-41907370 AAGTCACGCAGCCCCTTGGCTGG - Intergenic
1184231601 22:43161175-43161197 CACTTACCCAGCCCATTTGTCGG - Exonic
1184479789 22:44739486-44739508 CACACACACACCCTCTTGGTGGG - Intronic
1185333035 22:50260182-50260204 TACTCCCTCAGCCCCTTGGATGG - Intronic
949558528 3:5181445-5181467 CACACACTCACCCCCTTGGTAGG - Intergenic
952382132 3:32813647-32813669 CACTCTCTCAGACCTTGGGTTGG - Intergenic
952727956 3:36608307-36608329 CACTCACTCTGCCTCCTTGTAGG - Intergenic
953370638 3:42385611-42385633 CATTCACTCAGCACCATGGGAGG + Intergenic
953741514 3:45542947-45542969 CCCTCCCTCAGCCCCTAGGTGGG - Intronic
954970020 3:54643789-54643811 CAGTCACTCAGCCACCTGGCAGG - Intronic
956146362 3:66194967-66194989 CACCCACTCCTCCCCTTGGTGGG + Intronic
956299806 3:67759587-67759609 CACACACTGGGCCCTTTGGTGGG - Intergenic
959530807 3:107431779-107431801 CACACACTGAGCCCCTTGCCAGG + Intergenic
961521359 3:127469033-127469055 CCCTCACTCTGCTCCTGGGTGGG - Intergenic
962579572 3:136785599-136785621 CACTCACTCAGGTCCCTTGTTGG - Intergenic
962867501 3:139459814-139459836 CACTCACACACACCCTTAGTAGG - Intronic
963693670 3:148536988-148537010 CACTCACTCAGTCTCTGGGTGGG + Intergenic
964921226 3:161898058-161898080 CACTGAGTCAGCTCCTAGGTTGG - Intergenic
965076170 3:163979616-163979638 CACACACTGGGCCCTTTGGTGGG - Intergenic
967878550 3:194282809-194282831 CACTCCCTCAGCTCCATGTTGGG - Intergenic
969935448 4:10675314-10675336 CATTCACTCAGACCCCAGGTGGG - Intronic
970893851 4:21078835-21078857 TACTCACTCTGCCCCTGGGGAGG + Intronic
972321781 4:37978350-37978372 CATGCACTCAGTCCCTTGGCCGG + Intronic
976395412 4:84550155-84550177 CACTCACTGCTTCCCTTGGTGGG - Intergenic
976408083 4:84681986-84682008 CACTGAGCCAGCCCCATGGTGGG + Intronic
976958466 4:90935265-90935287 AACTCACTCACCCCCAGGGTGGG - Intronic
977506593 4:97911076-97911098 CAATCACTCACCCCCTTTCTTGG - Intronic
985422315 4:189796754-189796776 CAGTCACTCAGCCCTTTGGATGG + Intergenic
987491222 5:18582515-18582537 CACTGAATCAGCCTCTAGGTAGG + Intergenic
988589302 5:32535087-32535109 CAGTCATTCAGCCTCTTGGTGGG - Intronic
992859748 5:80898296-80898318 GACTGACTGAGCCCCTTGGTGGG + Intergenic
994645657 5:102465741-102465763 CCCTCAGTTAGCACCTTGGTTGG + Intronic
995030858 5:107479705-107479727 CACTCATTCAACCCCTGGTTAGG - Intronic
995238462 5:109857871-109857893 CAGTCACTCAGCCCACAGGTAGG - Intronic
995638784 5:114228661-114228683 TTCTCACTCAGCCCCTTACTTGG + Intergenic
997044093 5:130292576-130292598 AACTCACTCACCCCCATGGGAGG - Intergenic
997096857 5:130923493-130923515 CACTCACTGCCTCCCTTGGTTGG - Intergenic
997368558 5:133341475-133341497 CACTCACACAGGGGCTTGGTGGG - Intronic
998264290 5:140655981-140656003 CATTCACTCACCTCCATGGTGGG - Exonic
1000261592 5:159593659-159593681 CACTGAGTCAGTCCCTGGGTGGG - Intergenic
1000610516 5:163368527-163368549 AACTCACTCACCCCCATGGGAGG - Intergenic
1001947362 5:175791018-175791040 AACTCACTCACCCCCGTGGGAGG - Intergenic
1003959068 6:11192334-11192356 CACTCACTCACCCCTTTTGTAGG + Exonic
1004533169 6:16473611-16473633 CTTTGACTCAGCCCCTTGGTAGG + Intronic
1005019475 6:21404028-21404050 CTCTCACTCAGCCCATCGGGTGG - Intergenic
1005972048 6:30769229-30769251 CACCCACTCTGCCACTTGGCCGG - Intergenic
1006440026 6:34048227-34048249 CCCCCACTCAGCCCCTTGCTGGG + Intronic
1006521201 6:34572217-34572239 CACTCGCGCAGCCCCGTCGTGGG - Intergenic
1006737810 6:36287195-36287217 CACACACTGAGAGCCTTGGTGGG + Intronic
1007210059 6:40186256-40186278 CACTGACTCAGCCCCTGGGTAGG + Intergenic
1008552590 6:52647162-52647184 CACACACTTAGCTCCTGGGTTGG - Intergenic
1008610317 6:53179497-53179519 CTCACACTCACCCCCATGGTTGG + Intergenic
1010759186 6:79702757-79702779 AAATCACTCAGCCCCTGGGTGGG + Exonic
1012415055 6:99004172-99004194 CACTTAGTCAACCCTTTGGTTGG + Intergenic
1017026380 6:150184971-150184993 CACTCCCTCATGCCCATGGTTGG + Intronic
1017463426 6:154672557-154672579 CTCTGTCTCAGCCCCTTGGTGGG + Intergenic
1017980548 6:159397635-159397657 CGCTCAGTCAGTTCCTTGGTGGG - Intergenic
1018751744 6:166812480-166812502 CCCACACTCAGCCCCTGGGAAGG - Intronic
1019816693 7:3206170-3206192 CCCTTACTCAGAGCCTTGGTCGG - Intergenic
1020741844 7:12030084-12030106 AAATCACTCAGCCCCTGGGTTGG + Intergenic
1023202776 7:37716944-37716966 AACACCCTCAGCCCCTTGGCAGG - Intronic
1023832791 7:44049762-44049784 CACACACTGGGCCCCTTGGAAGG - Intronic
1023937670 7:44750824-44750846 CAGGCACTAAGACCCTTGGTGGG + Intronic
1023986729 7:45101405-45101427 CACTCTCCCAGCCCCTCGGAGGG + Intronic
1026205789 7:68255999-68256021 CACTGAGTCAGCTCCTGGGTGGG + Intergenic
1026684276 7:72494914-72494936 CACTCACACAGCCCTTGGGGAGG - Intergenic
1028641126 7:93043382-93043404 CACACACTGAGCCCCTTTGTAGG - Intergenic
1029858013 7:103538429-103538451 CACTCACACAGACCCATCGTAGG - Intronic
1034235654 7:149567079-149567101 CAGTCACTCAGCCCGTGGCTAGG + Intergenic
1034486378 7:151366663-151366685 CACACATGCAGCCCCTTGATAGG - Intronic
1036993630 8:13629454-13629476 CACTCACTCAGGCACTTATTAGG - Intergenic
1037735618 8:21563632-21563654 CACAGACTCAGCCTCTGGGTGGG - Intergenic
1038160260 8:25030517-25030539 CACTGAGTCAGCCTCTGGGTGGG + Intergenic
1039566251 8:38554329-38554351 CACCCACTCAGCCCCCAGCTGGG + Intergenic
1043592252 8:81845204-81845226 GCCTAACTGAGCCCCTTGGTGGG - Intergenic
1044306067 8:90642811-90642833 CCCTAGCTCAGCCACTTGGTAGG + Intronic
1046212075 8:111089446-111089468 CTCTCACTATGCCCTTTGGTAGG - Intergenic
1047971762 8:130090719-130090741 CACTTACTATGCCCCTTGCTTGG - Intronic
1055813805 9:80181797-80181819 CACTGACTCTGCCTCTGGGTGGG - Intergenic
1057497153 9:95570336-95570358 CACCCGCTCAGCCCCTTCGCCGG - Intergenic
1059463718 9:114451968-114451990 TACTCACTAAGCACCATGGTGGG + Intronic
1060600184 9:124872078-124872100 CAATCACTCGGCCCATTGATGGG - Intronic
1061862693 9:133476077-133476099 CACTCAGTCAGCACCTTGCTGGG - Intronic
1062025990 9:134341055-134341077 CTCTCACTCCGCCCCAAGGTGGG - Intronic
1062331334 9:136046161-136046183 CCCTGACTCACCCCCGTGGTGGG + Intronic
1185934198 X:4237210-4237232 CACCCACTCTGCTCCTTGGAGGG - Intergenic
1186807418 X:13153993-13154015 CACTGACTCAGCCTCTGGGTGGG - Intergenic
1187112809 X:16318796-16318818 CACTGAGTCAGCCTCTAGGTGGG - Intergenic
1188884254 X:35530993-35531015 CACTCACTCCTTCCCTTGGCTGG - Intergenic
1189064816 X:37796126-37796148 CACTCACTCAGCTCCATGGATGG - Exonic
1190971845 X:55357120-55357142 CAGTCTGTCTGCCCCTTGGTGGG - Intergenic
1191093971 X:56655332-56655354 CACTCACTGCTTCCCTTGGTTGG + Intergenic
1191707288 X:64106419-64106441 CCCTCATTCTGCCCCTTTGTAGG + Intergenic
1192980101 X:76330298-76330320 CACTCACTGCCTCCCTTGGTTGG - Intergenic
1193007182 X:76633430-76633452 CACACACTGAGGCCCTTTGTGGG - Intergenic
1193305736 X:79949290-79949312 CACTCCCTTAGCCCCTTGACTGG - Intergenic
1194793508 X:98181000-98181022 GACTCACTCAGCTCCGTGATGGG + Intergenic
1195983049 X:110600706-110600728 CACTCACTGCCTCCCTTGGTTGG - Intergenic
1196381726 X:115098443-115098465 CACTCACTGCCTCCCTTGGTTGG - Intergenic