ID: 1167525134

View in Genome Browser
Species Human (GRCh38)
Location 19:49978958-49978980
Sequence CTCCCTGGGAAGCTGGGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 664
Summary {0: 1, 1: 0, 2: 5, 3: 75, 4: 583}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167525127_1167525134 -2 Left 1167525127 19:49978937-49978959 CCGTGCGGAAAAACCCAGTGTCT 0: 1
1: 0
2: 1
3: 15
4: 122
Right 1167525134 19:49978958-49978980 CTCCCTGGGAAGCTGGGCCCTGG 0: 1
1: 0
2: 5
3: 75
4: 583
1167525124_1167525134 22 Left 1167525124 19:49978913-49978935 CCTTGAGGCTGGGAAGTTCAAGG 0: 1
1: 3
2: 23
3: 134
4: 482
Right 1167525134 19:49978958-49978980 CTCCCTGGGAAGCTGGGCCCTGG 0: 1
1: 0
2: 5
3: 75
4: 583
1167525123_1167525134 27 Left 1167525123 19:49978908-49978930 CCATTCCTTGAGGCTGGGAAGTT 0: 1
1: 0
2: 2
3: 48
4: 378
Right 1167525134 19:49978958-49978980 CTCCCTGGGAAGCTGGGCCCTGG 0: 1
1: 0
2: 5
3: 75
4: 583

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167525134 Original CRISPR CTCCCTGGGAAGCTGGGCCC TGG Intronic
900174755 1:1286749-1286771 CGGCCTGGGACGCAGGGCCCTGG - Exonic
900208313 1:1440942-1440964 CTTCCTTTGGAGCTGGGCCCAGG + Exonic
900309716 1:2027855-2027877 CTGCCTGGGGAGCCGGGCCATGG + Intronic
900408134 1:2501366-2501388 CTTCCTGGACAGCTGGGCCCAGG - Intronic
900521208 1:3106321-3106343 CTCCCTGGGCAGAGGGGCCGGGG + Intronic
900663062 1:3795747-3795769 CCCCCTGGGGCACTGGGCCCAGG - Intronic
900743054 1:4342305-4342327 TTCCCTTGCAAGCAGGGCCCCGG - Intergenic
900832306 1:4973859-4973881 CTCCCTGGGATGCAGGTCCCTGG - Intergenic
900953962 1:5875499-5875521 CTCCTGTGGACGCTGGGCCCAGG - Intronic
901003039 1:6158252-6158274 TTCCTGGGGACGCTGGGCCCAGG + Intronic
901063643 1:6485149-6485171 CTACCTGGGCAGCTGCACCCTGG - Intronic
901130899 1:6962290-6962312 CTTGCTGGGAGGCTGGTCCCTGG + Intronic
901800358 1:11704831-11704853 TCCCCTGGGATCCTGGGCCCTGG - Intronic
901841884 1:11958690-11958712 TACCTTGTGAAGCTGGGCCCTGG - Intronic
901990085 1:13105562-13105584 CTCCCTGGGCAGCTAGTCCAGGG + Intergenic
902628084 1:17688489-17688511 CTCTGGGGGAAGCTGGGCCAAGG - Intronic
902649286 1:17826220-17826242 GCCCGTGGGATGCTGGGCCCCGG - Exonic
902796948 1:18806260-18806282 CAGCCCTGGAAGCTGGGCCCAGG - Intergenic
903121502 1:21219426-21219448 CTCCCTGTGAGGCTGGGCTGAGG - Intronic
903130977 1:21279373-21279395 CTCCAAGGGAAGCGGGGCCCGGG - Intronic
903181915 1:21609088-21609110 GTACCTGGGGAGCTGAGCCCAGG - Intronic
903538954 1:24086057-24086079 AGCCCTGGGAAGCTGGGGTCAGG + Intronic
903659366 1:24967330-24967352 CTCCCTGGGAACCTGAGTCCAGG + Intergenic
903668942 1:25024308-25024330 CTCCCAGGGCAGCTGTGCCACGG + Intergenic
903963371 1:27071142-27071164 CTCCGTGGGAAGCTGAGTTCAGG + Intergenic
904264919 1:29312746-29312768 CTCCCTGGGAATTTGGGCTTGGG + Intronic
905110103 1:35588661-35588683 CTCCCTGGGAGGGGAGGCCCCGG + Intronic
905271012 1:36787457-36787479 CACCCTGGGAGGCTGGAGCCAGG - Intergenic
905666140 1:39764191-39764213 CTCCCTGGGAAGGAGGGCACGGG + Intronic
905684965 1:39901582-39901604 CGTCCCGGGAAGCCGGGCCCCGG + Intronic
906094759 1:43215139-43215161 CTCCCTGTGAGGCTGTGCCCAGG + Intronic
906479330 1:46189851-46189873 CACCTTGGCAAGCTGGGTCCAGG + Exonic
906962310 1:50426094-50426116 CGGCCTGGGAAGCTGGGCAGAGG - Intergenic
907091625 1:51730146-51730168 CTCCCAAGGAAGAGGGGCCCGGG - Intronic
907331776 1:53676411-53676433 CTCCCTGGGTTGCTGTGCCAGGG - Intronic
909922620 1:81400881-81400903 ATCCCTGGGAAACAGAGCCCTGG - Intronic
912664787 1:111569288-111569310 CTACCTGGGAAGCTGAGGCGGGG + Intronic
912950394 1:114116705-114116727 CTTGCTGGGAAGCTGGGACTGGG - Intronic
913378635 1:118184927-118184949 GTCCCTGGGACCCTGGGTCCTGG + Intronic
915065330 1:153219984-153220006 CCCCCTAGGAAGCTGGTCCTTGG - Intergenic
916807183 1:168270197-168270219 CTGGCTGGGATGGTGGGCCCAGG + Intergenic
919877835 1:201883488-201883510 TCCCCAGGGATGCTGGGCCCTGG + Exonic
919979340 1:202632677-202632699 CTCTCTGGGCAGGTGGGCTCTGG - Intronic
920065654 1:203267707-203267729 CTTGCTGGGAAGCTGCCCCCGGG - Intronic
920230297 1:204465748-204465770 TGCCCAGGGAAGCTTGGCCCTGG + Intronic
920946058 1:210529604-210529626 GTCCCTGAGAAGCTGGGCCTGGG - Intronic
922155419 1:223037077-223037099 CTCCCTGGTCTGTTGGGCCCTGG - Intergenic
922222940 1:223622224-223622246 GTCCCAGGACAGCTGGGCCCTGG - Intronic
922565207 1:226597127-226597149 CTCCCTGGGCTGCTTGGCACTGG + Intronic
922706631 1:227793898-227793920 ATCCCTGGGAAGCCAGGCCATGG + Intergenic
922752369 1:228076319-228076341 GTTCCTGGGAAGCAGGACCCTGG - Exonic
922768123 1:228166386-228166408 CTCCCCCGGGTGCTGGGCCCTGG - Intronic
923606298 1:235446285-235446307 CTACTTGGGAAGCTGAGGCCGGG - Intronic
1062971594 10:1653119-1653141 CTCCGTGGGAAGGTGGCCCTTGG - Intronic
1063426308 10:5952845-5952867 TCTCCTGGGAAGCTGGGCCCTGG + Exonic
1065736738 10:28759845-28759867 CTACCTGGGAAGCTGAGGCAAGG + Intergenic
1065846545 10:29748279-29748301 CTCCCTGTCACCCTGGGCCCTGG + Intergenic
1066417579 10:35235591-35235613 GGCCCAGGGAAGATGGGCCCAGG + Intergenic
1066694062 10:38062186-38062208 CTGCCTTGGAAGCTGAGACCTGG + Intronic
1067498030 10:46776154-46776176 CTTCCTGGGGAGCCGGTCCCCGG + Intergenic
1067523977 10:47027456-47027478 TTTCCTGGGAAGCTGTGCCCTGG + Intergenic
1067596616 10:47564260-47564282 CTTCCTGGGGAGCCGGTCCCCGG - Intergenic
1067850084 10:49749254-49749276 CTCCCTGGGAGGCCTGGGCCAGG - Intronic
1068790769 10:61028893-61028915 CTTCCTGGGAAGGTGGTCCCAGG + Intergenic
1068811136 10:61257155-61257177 CTCCCTGGGATGAAGTGCCCAGG - Intergenic
1069673833 10:70233192-70233214 CTCCCGGGGAGGCAAGGCCCGGG + Intronic
1069822899 10:71238563-71238585 CTACTTGGGAAGCTGAACCCAGG - Intronic
1069864286 10:71491927-71491949 CTCCCTGGGTTGCTGGCACCAGG - Intronic
1070230342 10:74559210-74559232 ATGCCTGGGCAGCTGGGCCAAGG - Intronic
1070238586 10:74655687-74655709 CTCCCTGGGCAGCTCTGCCACGG - Intronic
1070587872 10:77780113-77780135 CTCCCAGGGCAGCCTGGCCCAGG + Intergenic
1071284440 10:84131618-84131640 GTCCCTGGGAGGCTGACCCCTGG + Intergenic
1071289894 10:84181099-84181121 CTCCCTCTGATGCTGAGCCCAGG - Intronic
1071524076 10:86348028-86348050 CTCTCTGGGAAGATGACCCCTGG + Intronic
1071554420 10:86591560-86591582 CTCCATGGGAAGCTGTGGGCTGG + Intergenic
1071563815 10:86661558-86661580 ACCCCTGGGAAGCTGGGGCGGGG - Intronic
1071797146 10:89019137-89019159 CTCACTAGGAGGCTGGGGCCTGG + Intergenic
1073363013 10:102915605-102915627 CTACTTGGGAGGCTGAGCCCAGG + Intergenic
1074289311 10:112126555-112126577 CTCCCTGGAGAGCTGAGCACTGG + Intergenic
1074366580 10:112862355-112862377 CTGTCAGGTAAGCTGGGCCCAGG - Intergenic
1075031546 10:119027924-119027946 CTCCCCTGGCAGGTGGGCCCTGG - Intergenic
1075095743 10:119469437-119469459 CTCCCTGGCAAGGTGGGCAGTGG + Intergenic
1075461634 10:122620426-122620448 CTCCCTGGGAACCTAGTCCTGGG + Intronic
1075783712 10:125033803-125033825 AGCCCTGGGCAGCTGGGCCCAGG + Intronic
1076766083 10:132634256-132634278 CTCCCTTGGCAGGTGTGCCCCGG + Intronic
1077010459 11:377027-377049 CTCCCCGGGCAGCTGCGGCCCGG - Exonic
1077341904 11:2029989-2030011 CTCCTTGGGGAGCGGGGCCCAGG + Intergenic
1077351454 11:2095045-2095067 AGCCCTGGGAAGCTGCTCCCGGG - Intergenic
1077371816 11:2185905-2185927 CTCCCAAGGAAGCTGGGCGAGGG + Intergenic
1077376962 11:2209622-2209644 CCCCCTGGGAAGCAGGGCCAGGG - Intergenic
1077378802 11:2218274-2218296 GGCACTGGGAAGCTGAGCCCAGG + Intergenic
1077441069 11:2569509-2569531 CTCCCTCAGAAGCCGGGCCCTGG - Intronic
1077634488 11:3832937-3832959 CTACTAGGGAGGCTGGGCCCAGG + Intronic
1077807625 11:5605222-5605244 CTCCCTGGGAGGCTTGGCCCAGG + Intronic
1078108912 11:8376204-8376226 ATCCTTGGGAACCTGGGTCCTGG + Intergenic
1078532503 11:12148057-12148079 CTCCCTGAGAAGGTGGTACCAGG - Intronic
1080642906 11:34168132-34168154 CTTCCTGGGCTGCTGGGCACAGG + Intronic
1081630778 11:44688252-44688274 CTGCGTGGGCAGCTGGGGCCAGG - Intergenic
1083206253 11:61151049-61151071 CTCCCTGGGAAACTGTGGGCAGG - Intronic
1084430183 11:69106663-69106685 CTCACTGGGCAGCCGGGCCTGGG - Intergenic
1084459265 11:69287077-69287099 CTCTGTGGGAACCTGGGCCCGGG - Intergenic
1084979978 11:72823767-72823789 GTTCCTGGGAAGCTGAGCCGGGG - Intronic
1085423093 11:76380699-76380721 CTCACCGCGAAGGTGGGCCCGGG + Intronic
1086437934 11:86800322-86800344 GTCCCTGCGCAGGTGGGCCCCGG - Exonic
1087107325 11:94423542-94423564 CCCACAGGGAAGCTGGCCCCAGG - Intronic
1087401036 11:97667313-97667335 CTCCCTGCGAGGCAGGGCTCGGG + Intergenic
1087713745 11:101583523-101583545 CTCCCCCGGGAGCGGGGCCCAGG - Exonic
1089009126 11:115118642-115118664 TTCCCTTGGGAGCTGAGCCCAGG - Intergenic
1089494616 11:118901926-118901948 TTGCCTGGGAAACGGGGCCCAGG + Exonic
1089526576 11:119101122-119101144 CTCCCTGGGATTCTGGGCTGTGG + Exonic
1089543907 11:119207108-119207130 CTCTCAGGGAAGCTGTGCTCTGG + Intronic
1089750323 11:120647150-120647172 CTCCAAGGGAAGCAGAGCCCTGG - Intronic
1090254036 11:125270738-125270760 CTCTCTGGGAAGGTGGGCTGGGG - Intronic
1090803754 11:130189987-130190009 CTCTCTGGGGCACTGGGCCCTGG - Intronic
1091097583 11:132838823-132838845 CTCCCTGGGAAGCCTGTCTCAGG + Intronic
1091279404 11:134373584-134373606 CTCCCTGAGAAGCTGGGGTGAGG - Intronic
1202824890 11_KI270721v1_random:85178-85200 CTCCTTGGGGAGCGGGGCCCAGG + Intergenic
1091653158 12:2324536-2324558 CTCCTGGGGAGGCGGGGCCCGGG - Intronic
1091802593 12:3334008-3334030 GTCCCTGGGAAGCTGGTCCACGG + Intergenic
1091933923 12:4419911-4419933 CTACTTGGGAGGCTGAGCCCGGG - Intergenic
1092165565 12:6340566-6340588 CTGCCTGGGGACCTGGGGCCGGG + Intronic
1092559100 12:9590953-9590975 CTCCATGGGAATATGAGCCCAGG - Intergenic
1094842249 12:34347057-34347079 CTCCCGGAGAGGCTGGGCCCCGG - Intergenic
1095587437 12:43864123-43864145 CTCCCTGGGGGGCAGGGCTCAGG + Intronic
1095943465 12:47740662-47740684 CTTCCTGAGCAGCTGGGCCCGGG + Exonic
1096111493 12:49031706-49031728 CTCAGTGGGAAGCTGGGAGCTGG + Exonic
1096111907 12:49033792-49033814 CTCCCTGGTCAGCTGCTCCCTGG - Exonic
1096406664 12:51348721-51348743 CTCCTTGGGAAGCTGTGGCAGGG + Intergenic
1096694316 12:53339024-53339046 CCCCCTGGGAGGCTGGGCTGAGG - Intronic
1096774319 12:53955024-53955046 CAGCCCGGGAAGCTGCGCCCCGG - Exonic
1096793230 12:54058152-54058174 CTCGCTGGGAAGCTGAGGGCTGG + Intergenic
1097032030 12:56096729-56096751 CTCCCTGGGAAGTTTGGGGCAGG - Exonic
1098777121 12:74634761-74634783 CACCCTGGGAGGCTGGGACCAGG + Intergenic
1099202143 12:79690115-79690137 CTCCCGGGGGGGCCGGGCCCGGG + Exonic
1099969396 12:89485267-89485289 CACTCTGGGAGGCTGGGCCTTGG + Intronic
1100271252 12:93027302-93027324 GTCCCTGGGCACTTGGGCCCTGG - Intergenic
1101000169 12:100349558-100349580 CTACCTGGGAAGCTGGGGGCAGG + Intergenic
1101093511 12:101312562-101312584 CTCCCAGAGTAGCTGGGCACAGG + Intronic
1101318565 12:103652344-103652366 CTCCCTGGAAGGCCTGGCCCAGG + Intronic
1102033613 12:109758786-109758808 CCCCCTGGCGAGCTGGGGCCAGG + Intronic
1102096725 12:110247024-110247046 TTTCCTAGGAAGCTAGGCCCTGG - Intergenic
1102426749 12:112849817-112849839 TTCCCTGGGAATTTGGACCCTGG - Intronic
1102557947 12:113741234-113741256 CTCCCTGGGAACCTGGCTCAGGG - Intergenic
1103464568 12:121131990-121132012 CTTCCTAGGAAACAGGGCCCTGG + Intergenic
1103703147 12:122858350-122858372 CTACCTGGTGAGCAGGGCCCAGG + Exonic
1104090538 12:125513071-125513093 CTCCCGGGGAGGCTGGGCTGTGG - Intronic
1104283114 12:127396531-127396553 CTCCCGGGGAGGCTGGGCTGTGG + Intergenic
1104814492 12:131637889-131637911 GTGCCTGGGAAGCAGGGCCTGGG + Intergenic
1104836440 12:131795189-131795211 GTCCCTGGTGAGCTGGGCCCGGG - Intronic
1104874679 12:132025746-132025768 CGCCCTGGGAAGCAAGCCCCCGG + Exonic
1105466917 13:20652521-20652543 CTACTTGGGAGGCTGAGCCCGGG + Intronic
1105678860 13:22705334-22705356 CTCCATGAGGAGCTGGGCCGGGG + Intergenic
1106115563 13:26814887-26814909 CTCCCACGGGAGCAGGGCCCCGG - Intergenic
1108193743 13:47970747-47970769 CTACCTGGGAAGCTGAGGCAGGG + Intronic
1112571996 13:100601531-100601553 CTCCCTGGGAAGGTGGCTTCCGG - Intergenic
1113481540 13:110625508-110625530 CTGCCTCTGGAGCTGGGCCCCGG - Intronic
1116317651 14:43417879-43417901 CTCCCTGGGAAGGAGTGCCTGGG - Intergenic
1118510103 14:66462846-66462868 CTACCTGGGAGGCTGAGGCCGGG + Intergenic
1118976297 14:70679721-70679743 CTACTTGGGAAGCTGAACCCAGG + Intergenic
1119307243 14:73617367-73617389 CTACCTGGGAGGCTGAGGCCGGG + Intronic
1119425037 14:74529497-74529519 CTCCCTGGGAAGATGAGGCAAGG + Intronic
1119499063 14:75107444-75107466 CTCCATGGTCAGCTGGGCCATGG - Exonic
1119660775 14:76450229-76450251 CTGCCTGGAACGCTGGTCCCAGG - Intronic
1120664279 14:87287462-87287484 CTCCCAGGGAAGGTGGGTCAGGG - Intergenic
1121235728 14:92390108-92390130 CGGACTGGGAAGCCGGGCCCAGG - Intronic
1122175675 14:99916862-99916884 GACACTGGGAAGCTGGGCCAAGG - Intronic
1122582190 14:102777749-102777771 CGCCCTGGGCGGCGGGGCCCGGG + Intronic
1122628177 14:103094781-103094803 CCCCCTGAGAAGCTGGCCCGTGG - Intergenic
1122839068 14:104445965-104445987 GTCCCTGGGATGCTGGCTCCGGG + Intergenic
1122919556 14:104874442-104874464 CTCCCTGGGAAGGCGGATCCTGG - Intronic
1122929545 14:104927060-104927082 GTGCCTGGGCAGCTGGGCACTGG - Intronic
1122962034 14:105098552-105098574 CTCCCTGCGATGCTGGCCACAGG + Intergenic
1122988515 14:105225025-105225047 CTCCCCGGGCAAGTGGGCCCAGG + Intronic
1123475817 15:20592170-20592192 CTCCCTGGGCAGAAGGCCCCTGG + Intergenic
1123642194 15:22408193-22408215 CTCCCTGGGCAGAAGGCCCCTGG - Intergenic
1124067957 15:26363516-26363538 CTCTCTGGGAAGCTGGAGACTGG + Intergenic
1124494939 15:30180633-30180655 CTCTCTGGGCAGGTGGGCTCTGG - Intergenic
1124609803 15:31200771-31200793 CTCCTTGACAAGCTGGGCCATGG - Intergenic
1124748628 15:32358012-32358034 CTCTCTGGGCAGGTGGGCTCTGG + Intergenic
1125921601 15:43528630-43528652 CTGCCTGGGAACGTGGGGCCTGG + Exonic
1125972217 15:43921116-43921138 CTCCCTGTGAAGCTGAGCCGCGG - Intronic
1128566070 15:68700982-68701004 CTCCCTGAGGAGCTGGGGGCGGG + Intronic
1128699354 15:69793060-69793082 CACCCTCAGAGGCTGGGCCCAGG + Intergenic
1128706783 15:69842563-69842585 CTCCCTGGGAAGCTGGCACAGGG - Intergenic
1128749376 15:70138086-70138108 CTCCTTAGGCAGCTGGGCCATGG - Intergenic
1129116236 15:73366996-73367018 TGCCCTGGGAAGCTGCGGCCGGG - Intronic
1129227034 15:74176068-74176090 GTCCCTGGGCAGCTGCCCCCAGG + Exonic
1129228293 15:74182413-74182435 CTTCCTGGGAACCACGGCCCTGG - Exonic
1129268925 15:74409467-74409489 CTGCCTGGAGAGCTCGGCCCAGG + Exonic
1129415223 15:75373034-75373056 CACCCTGGGAAGCAGAGTCCAGG + Intronic
1130390007 15:83447196-83447218 CGGCCTGGGAAGCTGGGCGTGGG - Intergenic
1130596909 15:85255142-85255164 CTCCCTGGGCAGCAGCCCCCCGG + Intergenic
1130728005 15:86461076-86461098 CTCCCTGAGGAGCTGAGCCAAGG - Intronic
1131146714 15:90018698-90018720 CACACAGGAAAGCTGGGCCCTGG + Intronic
1131425057 15:92339257-92339279 GTCCCTGGACAGCTGGGCCTGGG - Intergenic
1132465221 16:74312-74334 CTCTCTGGAAAGCTGGGGACTGG + Intronic
1132516254 16:367505-367527 ATCCCTGCCAAGCTGGCCCCGGG + Exonic
1132550951 16:553643-553665 GCCCATGGGAAGCTGAGCCCTGG - Exonic
1132566849 16:627499-627521 CTCCCTGGCCAGCGGGGCCGGGG + Exonic
1132659485 16:1055036-1055058 GGCCCAGGGAAGCTGGACCCTGG - Intergenic
1132696734 16:1205281-1205303 CTCCCCAGGAAGAGGGGCCCGGG + Intronic
1132708042 16:1254906-1254928 GTCCATGGGGAGCTGGGGCCGGG + Intergenic
1132708138 16:1255169-1255191 CTCCATGGGGAGCTGGGGCTGGG + Intergenic
1132719784 16:1309894-1309916 CTCCCCGGAAAGCTCGGCCGCGG - Intronic
1132749736 16:1452017-1452039 GTGCCGGGGAAGGTGGGCCCAGG + Intronic
1132944863 16:2527277-2527299 CTCCCTGGGCTGCTGTGCCCAGG + Intronic
1133097540 16:3457881-3457903 CTCCGTGCGAAGCCAGGCCCAGG - Intronic
1133270688 16:4609645-4609667 CTCCATGGCAGGGTGGGCCCTGG + Exonic
1134083519 16:11340842-11340864 CTCACTGGGAAGCTGGAGCTCGG + Intronic
1134232153 16:12437669-12437691 CTCCCAGGGACTCTGGGTCCTGG - Intronic
1134476897 16:14581808-14581830 CTACTTGGGAGGCTGAGCCCAGG + Intronic
1135531197 16:23256038-23256060 CACTTTGGGAAGCTGAGCCCAGG + Intergenic
1135552945 16:23412292-23412314 GTCCCTGAGAAACTGGGCACGGG - Intronic
1136096853 16:27963031-27963053 ATCCCTGGGCAACAGGGCCCTGG - Intronic
1136153053 16:28364802-28364824 CTCCCAGGGCCGCAGGGCCCGGG - Intergenic
1136210030 16:28750471-28750493 CTCCCAGGGCCGCAGGGCCCGGG + Intergenic
1136413899 16:30092060-30092082 CTCCCTGGGACGCTGCCCCTAGG + Intergenic
1137337017 16:47559664-47559686 CTGCCTGGGATTCTGGGCCTTGG - Intronic
1137619419 16:49866729-49866751 GCCCCTGGGAAGCCAGGCCCTGG - Intergenic
1137754263 16:50888937-50888959 CTCTGGAGGAAGCTGGGCCCAGG + Intergenic
1137788635 16:51155802-51155824 CTCCCGGGGAAGCAAGGTCCCGG - Intergenic
1138081259 16:54093439-54093461 CTCCCTGGCAGGCCGGGCACGGG + Intronic
1138230284 16:55331399-55331421 CTCGCAGGGAAGCAGGGACCCGG + Intergenic
1138387271 16:56644191-56644213 TTCCCTGGGAATCTGGGGGCTGG + Intronic
1138441496 16:57037611-57037633 CTCCCTGGGAGACTAGGCCAAGG + Intronic
1138521884 16:57575782-57575804 ATCCCTGGCGAGCTGGGCCCAGG - Exonic
1138599450 16:58046164-58046186 TTCCCTGGGGAGAGGGGCCCTGG - Exonic
1139922582 16:70469276-70469298 CTCCCTCCACAGCTGGGCCCGGG - Exonic
1140389577 16:74573646-74573668 CTACTGGGGAAGCTGAGCCCAGG - Intronic
1140426851 16:74868314-74868336 CTCCCTGGGAAGCAGCGCTGAGG + Intergenic
1141167979 16:81673152-81673174 CTTCCTAGGAAGGTGGTCCCAGG + Intronic
1141323802 16:83036870-83036892 GACCCTGGGATGCTGGACCCTGG - Intronic
1141324061 16:83039103-83039125 CTCCGTGGGAACCTGGGCCATGG - Intronic
1141341344 16:83206445-83206467 ATCCCTGAGGAGCTGTGCCCTGG + Intronic
1141524228 16:84601398-84601420 CTGCCTGGGCAGCTGTGACCAGG + Intronic
1141684304 16:85561671-85561693 CTCCGGGGGCAGCTGGGGCCGGG - Intergenic
1141820330 16:86441409-86441431 CTGCCATGGAAGCTGAGCCCAGG - Intergenic
1141907800 16:87039102-87039124 CTCCAAGGGAAGCTGAGCCCAGG - Intergenic
1142204499 16:88776492-88776514 CTCCAAGGGAAGCTGGGCCCCGG - Intronic
1142590032 17:1000008-1000030 CTACCTGGGAAGCTGAGGCAGGG - Intronic
1142799537 17:2336968-2336990 CTCCGTGGGAGGCGGGGCGCAGG - Exonic
1143419910 17:6780683-6780705 CTGCCTGGCCAGCTTGGCCCAGG - Exonic
1143628786 17:8125474-8125496 CTCCTTGGGAACCTGGGCTCGGG + Intergenic
1143679529 17:8465970-8465992 CTCCCTGTGTCGCTGGGCTCCGG + Intronic
1143736818 17:8916786-8916808 TGCCTTGGGAAGCTGGACCCAGG - Intronic
1143773860 17:9185296-9185318 CCCCCTGGGAAGCGGGGCCCGGG + Intronic
1144547493 17:16211351-16211373 CTACTTGGGAAGCTGAGCCTGGG - Intronic
1144724561 17:17495371-17495393 CTCGCTGGGCAGCTTGGCCATGG + Exonic
1144765337 17:17729458-17729480 CTCTCGGAGAAGCTGGGCTCAGG - Intronic
1144858616 17:18285418-18285440 CTCCCTGGGCACCTGGGCATGGG - Exonic
1144922526 17:18776208-18776230 CTACCTGGGAGGCTGGGGCAGGG + Intronic
1145279306 17:21456249-21456271 CTCACGGGGCAGCGGGGCCCTGG + Intergenic
1145799582 17:27674279-27674301 CTCCCTGAGAGGCAGAGCCCAGG - Intergenic
1145883983 17:28370222-28370244 GTGCCTGGCAAGCTGGGCTCTGG + Exonic
1145987048 17:29054069-29054091 CTACTTGGGAGGCTGAGCCCAGG + Intronic
1146179970 17:30691696-30691718 CTCCCTGGGAAGCTGAGGTGGGG + Intergenic
1146297301 17:31659912-31659934 CTTCTTGTGATGCTGGGCCCAGG + Intergenic
1146357127 17:32143198-32143220 CTCCCGGGGAAGCTGGGGGAGGG + Intronic
1146953623 17:36923142-36923164 AAGCCTGAGAAGCTGGGCCCTGG + Intergenic
1147340421 17:39750437-39750459 CAGGCTGGGAAGCTGGGACCAGG + Intergenic
1148085610 17:44992017-44992039 GTCCCTGGGAAGCGGGGCTGGGG + Intergenic
1148344021 17:46891418-46891440 CTCACTGCACAGCTGGGCCCTGG - Intergenic
1148819922 17:50354401-50354423 CTCTCAGGGAAGATGAGCCCCGG + Exonic
1149382902 17:56111274-56111296 CTCCCTGGTTAACTGGACCCTGG + Intronic
1149998414 17:61416924-61416946 CTCCCAGGGAAGCGCGGCCAGGG + Intergenic
1150004444 17:61461399-61461421 CAGCCTTGGATGCTGGGCCCTGG + Intronic
1150318072 17:64186704-64186726 CTACTTGGGAGGCTGAGCCCAGG + Intronic
1151279738 17:73064606-73064628 CTCTCTGGGCAGCTGAGGCCAGG - Intronic
1151340437 17:73467527-73467549 TTCCCTGGGATTCTGGGCCTAGG - Intronic
1151439273 17:74117774-74117796 CTCCGTGCGGGGCTGGGCCCTGG + Intergenic
1151443628 17:74149530-74149552 CTCCCTGGGAATCTCTGTCCAGG + Intergenic
1151567438 17:74907172-74907194 CTCCCTGAGGGGCAGGGCCCGGG - Intergenic
1152175288 17:78782734-78782756 CTCCCTGGCAAGCTGGGGCCGGG - Intergenic
1152314951 17:79574816-79574838 CCACCTGGGAGGCTGGACCCTGG - Intergenic
1152407778 17:80107460-80107482 CTCCCAGGGCACCAGGGCCCGGG + Intergenic
1152777557 17:82212486-82212508 CTCCCGGGGCTGCGGGGCCCTGG + Intronic
1152806034 17:82356794-82356816 CTTCCTGGGCAGCTGGGTACAGG - Intergenic
1155113262 18:22737361-22737383 CTCCGTGGGAAGCAGTGCCAAGG + Intergenic
1155996943 18:32340372-32340394 TTCCCTGGGAAGCTTTGACCTGG - Intronic
1156171145 18:34487507-34487529 CTGCCTGGGAAGCCGAGGCCAGG - Intergenic
1156293730 18:35772085-35772107 CTACTTGGGAAGCTGAGGCCTGG - Intergenic
1156601186 18:38609075-38609097 CTCCCTGGGAGCCTGCACCCAGG + Intergenic
1157571557 18:48715718-48715740 CTCCCTGGGAAGCAGGCTCTGGG + Intronic
1157618572 18:49002247-49002269 CTCCCTGCTCAGCTGGGCCAGGG - Intergenic
1157649366 18:49312502-49312524 CTCCCTGTGTGGCTGGGTCCAGG - Intronic
1157925868 18:51765609-51765631 CTCCCTGGAAGGCTGTGCCTTGG + Intergenic
1158391967 18:57051532-57051554 TTCCCTGGCAGGCTGGGGCCAGG - Intergenic
1158650373 18:59279016-59279038 CACCCTGGGAGTCTGGGACCCGG - Intronic
1160056088 18:75482344-75482366 CTCCATGGGAACCAGAGCCCAGG + Intergenic
1160121578 18:76135066-76135088 CTGCATGGGCAGCGGGGCCCAGG - Intergenic
1160218551 18:76955994-76956016 GTCTCTGGGAACCTGGCCCCGGG + Exonic
1160234263 18:77073579-77073601 CTCCCTGCGGAGCAGGGCACTGG - Intronic
1160463020 18:79053857-79053879 CTCCCTGGGTGGCTGAGCCATGG - Intergenic
1160537066 18:79600366-79600388 ATCCCTGGGAGACTTGGCCCTGG + Intergenic
1161114274 19:2488201-2488223 CTCCCCAGGACGCTGGGCCAGGG + Intergenic
1161171719 19:2815503-2815525 CTCCCTGGGGAACAGGGCCCTGG - Exonic
1161238313 19:3208620-3208642 CTCCCTGGGGAACTGGGTGCGGG + Exonic
1161332565 19:3695298-3695320 CTCGCTTGGCACCTGGGCCCCGG + Intronic
1161513252 19:4683213-4683235 CTCTGTGGGAGGCTGAGCCCGGG - Intronic
1161767875 19:6216890-6216912 CTGGCTGGGAAGCTGGGCCTGGG + Intronic
1161965371 19:7544881-7544903 CTCCCAGATAAGCAGGGCCCAGG - Intronic
1162078528 19:8205197-8205219 TGCCCTGGGAAGCTGGGCAGGGG + Intronic
1162518597 19:11165662-11165684 CTACTTGGGAGGCTGAGCCCTGG - Intronic
1163023241 19:14495111-14495133 CCCCCTGGCAACCTGGGCCGAGG - Intronic
1163565065 19:18046304-18046326 GTCTCTGGGAAGATGGTCCCCGG + Intergenic
1163666504 19:18606305-18606327 TTACCTGGGCAGCTGGGCCGAGG - Intronic
1163828851 19:19538325-19538347 CTCCCTCGGACGCTCTGCCCCGG + Exonic
1164558038 19:29268584-29268606 CCACCTGGGAAGCTTTGCCCAGG - Intergenic
1164768873 19:30792709-30792731 ATCCCTGGGAAGCTGTGTTCAGG + Intergenic
1164972583 19:32545177-32545199 CTCCATGGGCAGCTGGGTCCAGG + Intergenic
1165311141 19:35030214-35030236 CTCCCTGGGAAGGTGGGGGGGGG + Intergenic
1165697905 19:37915003-37915025 CTGCCTGGTAAGGAGGGCCCTGG - Intronic
1165907941 19:39204950-39204972 CTCCCTGGGAGGCAGGACCTTGG + Intergenic
1166128905 19:40733634-40733656 CTCCCTGGGCATCCTGGCCCTGG + Intronic
1166479163 19:43154928-43154950 CTCCCTGGGATGCTGGAGGCTGG - Intronic
1166555117 19:43694113-43694135 CTACCTGGGAAGCTGAGGCAGGG - Intergenic
1166695297 19:44848395-44848417 GTCCCGGGGAAGCCGGGCTCCGG + Intronic
1167124372 19:47539154-47539176 AGCCCTGGGAGGCAGGGCCCAGG + Intronic
1167441884 19:49513452-49513474 CTTCCTGGGAGCCTGGGCGCAGG + Exonic
1167525134 19:49978958-49978980 CTCCCTGGGAAGCTGGGCCCTGG + Intronic
1167583421 19:50359630-50359652 CTCAGTGTGAAGGTGGGCCCAGG - Exonic
1167787402 19:51647120-51647142 CTCCCTGGGAGTCAGGGCCTCGG + Intergenic
1168266973 19:55228572-55228594 GGCCCTGGGAAGCTGGGTTCTGG - Intronic
1168550435 19:57288953-57288975 CTACTCGGGAAGCTGAGCCCAGG - Intronic
1168721171 19:58555771-58555793 GGGCCTGGGTAGCTGGGCCCAGG - Exonic
925041549 2:735141-735163 CTCTCTGCCCAGCTGGGCCCAGG + Intergenic
925161114 2:1685140-1685162 CTGCCTGGGGAGCTGGCCCCGGG - Intronic
925905588 2:8537993-8538015 CTCCCTGGGAGCCCAGGCCCTGG - Intergenic
926237280 2:11055198-11055220 CCCTCTGGGAGGCTGGGCCTGGG - Intergenic
926711753 2:15887818-15887840 CTCCTTAGCAAGCTGAGCCCAGG + Intergenic
926718683 2:15942882-15942904 CTCCCTGGGGCACTGGACCCCGG + Intronic
927006898 2:18860802-18860824 AACCCTGGGAGGCTGGGGCCAGG + Intergenic
927641330 2:24847547-24847569 ATCCCTGGGCTGCAGGGCCCTGG - Intronic
928910746 2:36418395-36418417 CTACTTGGGAAGCTGAGCCTGGG - Intronic
929133561 2:38602376-38602398 CTCCCCGGGAAGCAGGGCCTCGG - Intronic
929815069 2:45223863-45223885 CTCCATGGGATGCCAGGCCCTGG + Intergenic
929917459 2:46148149-46148171 CTTCCTGGGAAGCAGGGGCTGGG - Intronic
930221727 2:48753061-48753083 CTCCCTGGAGAGCTGTGCCTTGG + Intronic
930664509 2:54088612-54088634 CTTCCTGTGCAGCTTGGCCCTGG - Intronic
932459410 2:71872713-71872735 CCCCTGGGGAAGCTGGGGCCTGG + Intergenic
932490252 2:72115716-72115738 CTCCCTTCGAAGCCTGGCCCTGG + Intergenic
932565893 2:72908821-72908843 CTACTTGGGAGGCTGAGCCCAGG + Intergenic
933729417 2:85445920-85445942 CTGCCTGGGAAGCTGGGAGCTGG + Intergenic
934768361 2:96893235-96893257 CTCCCCAGGAAGCTGAGCCCGGG + Intronic
935783413 2:106527838-106527860 CTCCCTGCGAGGCTGGGTCCTGG - Intergenic
935816826 2:106853576-106853598 ATCCCTGGCACACTGGGCCCAGG - Intronic
935915673 2:107947106-107947128 TTCCCTGGAAAGCAGAGCCCAGG - Intergenic
936083750 2:109452842-109452864 GTCCCTGGGAGGCTGGTCCCGGG + Intronic
936083791 2:109452955-109452977 GTCCCTGGGAGGCTGGTCCCTGG + Intronic
936083807 2:109452999-109453021 GTCCCCGGGAAACTGGTCCCCGG + Intronic
936106259 2:109627055-109627077 CTACTTGGGAGGCTGAGCCCAGG + Intergenic
937311544 2:120906094-120906116 CTACTTGGGGAGCTGGGCCAGGG + Intronic
938726004 2:134109476-134109498 CTCCCTGGGGGGCAGGGCTCGGG - Intergenic
940480025 2:154216897-154216919 TTACCTGGGAGGCTGTGCCCAGG - Intronic
941858553 2:170254637-170254659 CACCCTGGGAAGTTGGGACAAGG - Intronic
942457660 2:176149164-176149186 CTTCCTGGGACACTGGGCCTAGG - Intergenic
942483583 2:176415963-176415985 TTTCATGGGAAGCTGAGCCCTGG - Intergenic
942678296 2:178451087-178451109 CTCCCCGGGTCGCTGGTCCCCGG + Exonic
944333429 2:198500141-198500163 CTTCTTGGTAAGCAGGGCCCAGG - Intronic
944581618 2:201137296-201137318 CTCCCAGGGCAGCCTGGCCCAGG + Intronic
945049039 2:205806186-205806208 CTGCCTGGGAAGGGGGGCTCTGG + Intergenic
945066252 2:205949846-205949868 CCCCCAGGGAAGCCTGGCCCAGG + Intergenic
947542699 2:230989932-230989954 CGGCCTGGGTGGCTGGGCCCCGG - Intergenic
947564317 2:231184337-231184359 CTCCCTGAGAATCTAGGCCCTGG - Intergenic
947591509 2:231388662-231388684 CGCCCTGGACAGCTGGGCCCAGG - Intergenic
947931456 2:233968380-233968402 GTCCCTGGCAGGCTGAGCCCCGG - Intronic
948115842 2:235494041-235494063 CTCCCTGGCACGCAGGGCTCCGG - Intergenic
948197578 2:236106951-236106973 CAACGTGGGAAGCTGGGCCAAGG + Intronic
948476951 2:238226552-238226574 CTCCCTGGGCAGCAGCGCCCTGG - Intronic
948795114 2:240398721-240398743 CTCCCTGGGCTGCTGGGGCCGGG + Intergenic
948812659 2:240492101-240492123 CTGCTTGGGAGGCTGGGCCCAGG - Intronic
948851719 2:240711534-240711556 GTCTCTGGGGAGCTGAGCCCCGG - Intergenic
1168769523 20:406613-406635 CTACTCGGGAAGCTGAGCCCAGG + Intergenic
1168829489 20:837439-837461 CTCCCTCAGGAGCTGGGCACTGG + Intronic
1169488971 20:6055627-6055649 CTCCCAGGGAGCCTGGGCCCAGG + Intergenic
1170508936 20:17057384-17057406 CTCCCTGGCCAGTTGGGCCATGG - Intergenic
1171249421 20:23637287-23637309 CCTCCTGGGACGCTGGGCTCCGG - Intronic
1171331870 20:24347226-24347248 CTACTTGGGAGGCTGAGCCCAGG + Intergenic
1172174529 20:32964167-32964189 CTACCTGGGAAGCTGAGGCGGGG - Intergenic
1172513632 20:35517289-35517311 TTCCCTTGGCAGCTGGACCCTGG - Exonic
1172514529 20:35523706-35523728 CTCCCTGGTCATCTGGGCACTGG - Intronic
1172674120 20:36655271-36655293 TGCTCTGGGCAGCTGGGCCCTGG - Intronic
1172713184 20:36943044-36943066 CTCCCTAGAAAGCAGGGTCCAGG + Intronic
1172977498 20:38918023-38918045 CTCCCTGGGTATCGGGGCCAGGG - Intronic
1173173907 20:40749821-40749843 GTCCAGGGGAAGCTGGGTCCAGG - Intergenic
1173219168 20:41117240-41117262 CTACCTGGGAGGCTGAGCCCAGG + Intronic
1173371869 20:42443698-42443720 CTTTCAGGGAAGGTGGGCCCAGG + Intronic
1174284502 20:49462944-49462966 CTTACTGGGAAGCTGGGCATGGG + Intronic
1174352999 20:49981720-49981742 CTCCCAGGGAAGCTGGGGTGGGG + Intergenic
1174404061 20:50292518-50292540 CTCCCAGGGCAGCCTGGCCCAGG - Intergenic
1174828890 20:53794814-53794836 CTGCCTGGGAAGCTTGCTCCTGG + Intergenic
1175124412 20:56740722-56740744 GTCCCTCGGAGCCTGGGCCCTGG + Intergenic
1175192695 20:57222238-57222260 CTCCCTGTGAAGCCAGGCTCGGG + Intronic
1175983662 20:62753762-62753784 CTCCATTGGAAGCCGGGCCATGG + Intronic
1176060729 20:63171608-63171630 CTCCCTGTGTAACTGGGGCCAGG - Intergenic
1176063477 20:63182400-63182422 CTCCAGGGGAAGCTGAGGCCAGG + Intergenic
1176199758 20:63854987-63855009 GTCCCTGGGGAGCTGGCGCCAGG - Intergenic
1176276919 20:64277937-64277959 GGCCCTGGGCAGCTGGGCACTGG + Intronic
1176276942 20:64278021-64278043 GGCCCTGGGCAGCTGGGCACTGG + Intronic
1176276985 20:64278187-64278209 GGCCCTGGGCAGCTGGGCACTGG + Intronic
1176415887 21:6474565-6474587 CTTGCTGGGTTGCTGGGCCCAGG + Intergenic
1179104741 21:38388833-38388855 ATCCCCGGGCTGCTGGGCCCAGG + Intronic
1179140546 21:38721274-38721296 CTCACTGGGAAGATGGGGCGGGG - Intergenic
1179570418 21:42275310-42275332 CGCCCAGGGATGCTGGGCCCAGG - Intronic
1179581960 21:42349817-42349839 CCGCCTGTGAAGCTGGGTCCTGG + Intronic
1179605838 21:42514470-42514492 CTCCCTGGGCGGCTGGTCCCCGG - Exonic
1179620856 21:42614923-42614945 CTGCCTGGGAAGCTCAGCTCCGG - Intergenic
1179655395 21:42841593-42841615 CTCCCTGGGAACTTGCCCCCAGG - Intergenic
1179691387 21:43082899-43082921 CTTGCTGGGTTGCTGGGCCCAGG + Intergenic
1180063689 21:45402463-45402485 CTTCCTGGGCAGGTGGGGCCTGG - Intergenic
1180144606 21:45912324-45912346 CTCCCTGGGATGATGGCCCCTGG - Intronic
1180834306 22:18922216-18922238 CTGCCTGAGAGGGTGGGCCCTGG - Intronic
1181037057 22:20174770-20174792 CTCCCTGGGAAACAGGACCAGGG - Intergenic
1181049268 22:20231040-20231062 GGCCTGGGGAAGCTGGGCCCAGG - Intergenic
1181430350 22:22877702-22877724 CTCCCTGGCAGGCTGGTCCCAGG + Intronic
1181432132 22:22888087-22888109 ACCCCTGAGGAGCTGGGCCCTGG + Exonic
1181513473 22:23399100-23399122 CTCCCTGGGTGGCCGGGCCCTGG - Intergenic
1181924828 22:26349729-26349751 CTCTCTGGGAGGCTGAGGCCAGG - Intronic
1182422583 22:30255879-30255901 TCCCCAGGAAAGCTGGGCCCAGG + Intergenic
1183521539 22:38298580-38298602 CACCATGGGCAGCAGGGCCCAGG - Intronic
1184192946 22:42907163-42907185 CTTCCTGAGAAGCTCTGCCCTGG - Intronic
1184232925 22:43168257-43168279 TCCCCTGGGAATCAGGGCCCAGG - Intronic
1184429033 22:44430451-44430473 CTCCATGGGCAGCGGGACCCTGG - Intergenic
1184639855 22:45864776-45864798 CTTCCTGGGGAGCAGGGCCGGGG - Intergenic
1184646186 22:45896710-45896732 CTCCCTGAGAACCTGGGTTCAGG + Intergenic
1184670131 22:46007922-46007944 CTTCCCGGGGAGCTGGGGCCTGG + Intergenic
1184746822 22:46461037-46461059 CTCCCTGGTAAGCCGAGCTCGGG - Intronic
1184754613 22:46508842-46508864 GAACCTGGGAAACTGGGCCCCGG + Intronic
1185239289 22:49734054-49734076 CACCCTGGGAAGCTCTTCCCGGG + Intergenic
1203284395 22_KI270734v1_random:147515-147537 CTGCCTGAGAGGGTGGGCCCTGG - Intergenic
949414673 3:3800972-3800994 CTGCCTGGCAAGCTGGGGCTCGG + Intronic
950831531 3:15879768-15879790 CTCCCAGGGCAGCCTGGCCCAGG - Intergenic
953472865 3:43181606-43181628 CCCCCAGGAAAGCTGGCCCCAGG + Intergenic
953566013 3:44032685-44032707 CCCCATGGGAAGCTGAGACCTGG - Intergenic
953919656 3:46943209-46943231 CTCCCAGGGCTGCTGGGACCTGG + Intronic
954283743 3:49603067-49603089 CTCACTGGGCAGCTGGGGCCTGG + Intronic
954314896 3:49795720-49795742 ATCCCTGAGAATCTGGCCCCCGG - Exonic
954445905 3:50546820-50546842 CTCCTGGGGGAGCTGGGCACTGG - Intergenic
954624079 3:52012974-52012996 CTTCCTGGGCAGCTGGCCCCAGG + Intergenic
960195261 3:114759174-114759196 CACCCTGACAAGCTGTGCCCTGG - Intronic
960502529 3:118454863-118454885 CTCCCTGGGATGAAGTGCCCAGG - Intergenic
961013046 3:123448576-123448598 CTCCCCCGGAAGCCGGGCCGGGG + Exonic
961379485 3:126487757-126487779 CTCCCAGGGCAGCTGGGCTGGGG - Intronic
961523914 3:127484470-127484492 CTCACAGGGTTGCTGGGCCCTGG - Intergenic
961649168 3:128408865-128408887 TTCTCTGGGCAGCTGGGTCCAGG + Intergenic
961832040 3:129627856-129627878 CAACCTGGGAAGCTGAGGCCCGG - Intergenic
961936770 3:130592940-130592962 CTCCTTGTGAGGCTGGGCCTGGG - Intronic
962251914 3:133840828-133840850 CTCCCTGGGAAGGTAGGCAAGGG - Intronic
962307853 3:134304493-134304515 CTCCCTGTGTGGCTGGGTCCAGG + Intergenic
962471273 3:135711382-135711404 CTATCTGGGCAGCTGGACCCTGG - Intergenic
963015915 3:140823716-140823738 CTTCCTGGCAGGCTGTGCCCAGG - Intergenic
963067570 3:141275446-141275468 CTCCCTTGGAGTCTGGGCCAGGG - Intronic
965580469 3:170262589-170262611 CTCCCTAGGAGGCTGAGGCCCGG - Intronic
965614911 3:170584655-170584677 CTCGCAGGGAATGTGGGCCCTGG + Intronic
967388119 3:188929878-188929900 CTCCCCCAGAAGATGGGCCCAGG + Intergenic
968177945 3:196567859-196567881 CTACTTGGGAGGCTGAGCCCGGG - Intronic
968484078 4:850367-850389 CTCCCTCGGAGTCTGGGGCCTGG - Intronic
968695527 4:2024177-2024199 CTCCCTGGGGAGCTGAGAGCTGG + Intronic
968984561 4:3868136-3868158 CTGCCTGGGAAGCACGGCCCTGG + Intergenic
969117056 4:4877178-4877200 CTTCCTGGAACGCTGTGCCCTGG + Intergenic
969271463 4:6106079-6106101 ATCCATGGGAACGTGGGCCCAGG - Intronic
969291883 4:6245447-6245469 CCCCCTGGGAGGCTGTGCCCTGG + Intergenic
969365773 4:6693590-6693612 CTCCCTGGGTAAGTGGGCACGGG - Exonic
969670634 4:8588215-8588237 CTCTCTGGACACCTGGGCCCTGG - Intronic
972963841 4:44486153-44486175 CTGACTGGGATGCTGGGCTCAGG - Intergenic
973334146 4:48938749-48938771 CTCCCTGAAAAGCTTGGCCCAGG - Intergenic
976085539 4:81403740-81403762 CTTCCTAGGATGCTGGGGCCAGG - Intergenic
976759284 4:88530959-88530981 CTGCTTGGGAAGCTGAGGCCAGG - Intronic
981280620 4:142954498-142954520 CTCCCTGGGGGGCAGGGCTCGGG + Intergenic
981356583 4:143796484-143796506 CTCTCAGGGAGGCTGGGACCAGG + Intergenic
981368120 4:143927083-143927105 CTCTCAGGGAGGCTGGGACCAGG + Intergenic
981377912 4:144037355-144037377 CTCTCAGGGAGGCTGGGACCAGG + Intergenic
982026702 4:151258828-151258850 CTCCCTGGGATCCTGAGTCCAGG + Intronic
985020216 4:185680929-185680951 CTTCCTGGGACACTGGGCCCAGG + Intronic
985268459 4:188172305-188172327 CTCTTCGGGTAGCTGGGCCCTGG + Intergenic
985601345 5:836110-836132 CTCTCTTGGAGGCTGGGCACAGG - Intronic
985644372 5:1078113-1078135 CTCCTTGGAAAGCTGAGGCCCGG + Intronic
986199293 5:5567159-5567181 TTACCTGGGAAGCAGGTCCCAGG - Intergenic
986204403 5:5610341-5610363 CTCCCTGAAAAGGTGGGCCTGGG - Intergenic
986248414 5:6032060-6032082 CTCAGTGGGCAGCTGGGTCCTGG + Intergenic
986686329 5:10278338-10278360 GTCCATGGGAAGGTGGTCCCAGG - Intronic
986712756 5:10499696-10499718 GTGCTTAGGAAGCTGGGCCCAGG + Intergenic
989180301 5:38569630-38569652 CTCCCATGGAAACTGGTCCCTGG + Intronic
990279579 5:54235580-54235602 CTACTTGGGAGGCTGAGCCCAGG - Intronic
994109858 5:95989394-95989416 CTCACTGGGGAGCTGGTCCTTGG - Intergenic
995456698 5:112360308-112360330 CTCCCTCTGATGCTGAGCCCAGG + Intronic
995737069 5:115312900-115312922 CTCCCCGGGAAGATGTGACCCGG + Intergenic
996538880 5:124608341-124608363 CTCCCTTGGATGCTGAGACCTGG - Intergenic
997310304 5:132874126-132874148 AGCCCTGGGAAGCTGGGCAGAGG + Intronic
997368876 5:133343381-133343403 CTCCCTGGGAGGCTGGCCCACGG + Intronic
997426697 5:133807927-133807949 GTGCCTGGGAAGCTGAGCGCAGG - Intergenic
997459300 5:134041505-134041527 CTCCCTGAGCAGCTGGTCCTGGG - Intergenic
998613331 5:143712815-143712837 CTACCTGGGGAACTGGGCCTTGG + Intergenic
998850234 5:146344853-146344875 CCCACTGAGAAGCTTGGCCCCGG + Intergenic
999532426 5:152479012-152479034 CTAACTGGGAGGCTGAGCCCAGG - Intergenic
1000322078 5:160142480-160142502 CTACTTGGGAAGCTGAGGCCAGG - Intergenic
1001319706 5:170670484-170670506 CTCCCAGGGAAACTGAGCTCAGG - Intronic
1001701015 5:173706432-173706454 GGCCTGGGGAAGCTGGGCCCTGG - Intergenic
1001984234 5:176060668-176060690 CTGCCTGGGCGGCTGGCCCCGGG - Intronic
1002233241 5:177783397-177783419 CTGCCTGGGCGGCTGGCCCCGGG + Intronic
1002262737 5:178006384-178006406 CTGCCTGGGCGGCTGGCCCCGGG - Intronic
1002571157 5:180140070-180140092 CTCCCAGGGGACCTGGGGCCTGG + Intronic
1002643482 5:180641471-180641493 CTTTCTGGGCAGCTGAGCCCAGG + Intronic
1003192570 6:3887477-3887499 TTCCCTGGGAACCTGGGCCACGG - Intergenic
1003563403 6:7202486-7202508 TGCCCTGGGAAGCTGGTCTCTGG + Intronic
1003860108 6:10315175-10315197 GTCCCTGAGCAGCTGGGACCTGG + Intergenic
1004731839 6:18366516-18366538 CTCCCAGGGCAGCCTGGCCCAGG + Intergenic
1005838540 6:29725080-29725102 CACCCTGAGGTGCTGGGCCCTGG + Exonic
1005852078 6:29829467-29829489 CACCCTGAGGTGCTGGGCCCTGG + Exonic
1005859448 6:29889378-29889400 CACCCTGAGGTGCTGGGCCCTGG + Intergenic
1005864596 6:29928102-29928124 CACCCTGAGGTGCTGGGCCCTGG + Intergenic
1005867012 6:29944171-29944193 CACCCTGAGGTGCTGGGCCCTGG + Exonic
1005905910 6:30261253-30261275 CACCCTGAGGTGCTGGGCCCTGG + Intergenic
1005915930 6:30351448-30351470 CACCCTGAGGTGCTGGGCCCTGG + Intergenic
1005932013 6:30491186-30491208 CACCCTGAGGTGCTGGGCCCTGG + Exonic
1005981306 6:30839154-30839176 CTCCCTGGCATGATGGACCCAGG + Intergenic
1006042927 6:31270414-31270436 CACCCTGAGGTGCTGGGCCCTGG - Exonic
1006052513 6:31355521-31355543 CACCCTGAGGTGCTGGGCCCTGG - Exonic
1006106205 6:31718525-31718547 TTCCCTGGGAGGCTGGGCTGGGG - Intergenic
1006305379 6:33215351-33215373 CACCCTGGGAAGCTGCTCACAGG + Intergenic
1006402400 6:33825466-33825488 CTCTCTGGCAAGCCTGGCCCTGG - Intergenic
1006502319 6:34466558-34466580 TTCCTTGGGAAGCTGGGGCCTGG + Intronic
1006524108 6:34589173-34589195 CTCCATGGGAAGCTTGAACCAGG - Exonic
1006827035 6:36942697-36942719 CTAACTGGGAGGCTGAGCCCAGG + Intergenic
1007225767 6:40312884-40312906 CTGCCTAGGAAACTGGTCCCTGG - Intergenic
1007241086 6:40425621-40425643 CTTCCTGACAGGCTGGGCCCTGG + Intronic
1007405800 6:41635549-41635571 GCCCCGGGGAAGCTGGGCCTGGG + Intergenic
1007686578 6:43670690-43670712 CTCCTTGGGCAGCCAGGCCCAGG - Intronic
1008081795 6:47203061-47203083 TTGCCTGGAAAGGTGGGCCCAGG - Intergenic
1008964274 6:57298523-57298545 GGCCCTGGGAAGCAGGGCTCGGG + Intergenic
1009596691 6:65745528-65745550 TTCCCTGGGAGGCTCTGCCCAGG - Intergenic
1010378856 6:75204941-75204963 CTCCCTGGGACTCTGGGCCAGGG - Intronic
1010672966 6:78708718-78708740 CTCCCTGGCAAACCAGGCCCTGG + Intergenic
1011137819 6:84118389-84118411 CTCCCTGGGATGGAGTGCCCTGG - Intergenic
1012145044 6:95670272-95670294 CTCCCTGTGGGGCTGGGCTCTGG + Intergenic
1013009884 6:106110380-106110402 GGCCCTGGGAAGCTGGGTCAGGG + Intergenic
1013131027 6:107232930-107232952 CTCCTTGGGAGGCTGAGCCCAGG - Intronic
1015701490 6:136040191-136040213 TTCCCAGGGAAGCTGCACCCTGG + Intronic
1016250163 6:142031363-142031385 ATCCCTGCGGAGCTGTGCCCAGG + Intergenic
1017844328 6:158242894-158242916 CTACTTGGGAAGCTGGGGCAAGG - Intronic
1018170450 6:161139679-161139701 TTCCCTTGGAAGCAGGGCCTCGG - Intronic
1018312497 6:162525405-162525427 CCCCCTGAAATGCTGGGCCCAGG + Intronic
1018390098 6:163335553-163335575 CACTCTGGGAAGCTGCGGCCAGG + Intergenic
1018645982 6:165948853-165948875 CTCACTGGGACTCTGGGCCAAGG - Intronic
1019118754 6:169786530-169786552 CTCCCTGGGACACAAGGCCCTGG - Intergenic
1019405905 7:883948-883970 TTCCCTGGGCAGCTGGGAGCCGG - Intronic
1019500233 7:1360909-1360931 CCACCTGGGAGGCTGGGGCCAGG + Intergenic
1019513224 7:1428869-1428891 GTCCCCGGGGAGCAGGGCCCTGG + Intronic
1019515854 7:1439921-1439943 GTACCTGGGAGGCTGGGTCCTGG + Exonic
1019547554 7:1585820-1585842 CGGCCAGGGAAGGTGGGCCCTGG - Intergenic
1019563012 7:1667254-1667276 CTCCCTGGGCAGCCTGGCCCCGG - Intergenic
1019918657 7:4149485-4149507 CTCCCCGGGGAACGGGGCCCTGG + Intronic
1020034920 7:4959026-4959048 TTCCATGGGAATCTGGCCCCGGG + Exonic
1020125527 7:5530826-5530848 CGCCTTGGGGTGCTGGGCCCGGG + Intronic
1020251769 7:6474881-6474903 CGCTTTGGGAAGCTGGGCCCAGG - Intronic
1021106814 7:16646618-16646640 CTCCCGGGGAGGCTGGGGCCGGG + Intronic
1021820590 7:24494237-24494259 CGCCCTGGGCTCCTGGGCCCAGG - Intergenic
1021868214 7:24979676-24979698 CTCCCGGGGAAGGAGGACCCGGG - Intronic
1021987231 7:26108462-26108484 CTACTTGGGAAGCTGAGGCCGGG + Intergenic
1022473264 7:30694571-30694593 GTCCCTGGCAGCCTGGGCCCAGG - Intronic
1022681730 7:32554936-32554958 CTACCAGGGAAACTAGGCCCTGG - Intronic
1022732051 7:33036333-33036355 CACCCACGGAAGCTGGGCCAGGG - Intronic
1023162443 7:37310129-37310151 CTCTCTGCAAAGCTGGCCCCAGG - Intronic
1023945201 7:44797201-44797223 CTTCCTGGGAAGCTGTCCCCTGG + Intronic
1025940135 7:66070530-66070552 CTACCTGAGAAGCTGGCCCAAGG + Intergenic
1026863635 7:73809802-73809824 CTCCCAGTGAAACCGGGCCCTGG - Intronic
1026976715 7:74503188-74503210 CTCCCTGGGCAGCGGGGCCCTGG - Intronic
1028005007 7:85554225-85554247 CTCCCTGGAAAGCTGGACCTTGG + Intergenic
1028621142 7:92830926-92830948 CTCCCTGTGAAGCTGCTCCATGG + Intronic
1029312383 7:99679264-99679286 CTTCATGGGAAGCTGTCCCCTGG - Intronic
1029363435 7:100102516-100102538 CACATTGGGAAGCTGGGCCCAGG + Intronic
1029419592 7:100466028-100466050 CTCCCTGGCAGCCTGGGCTCCGG - Intronic
1029439221 7:100578020-100578042 TTCCCTGGGATGCTGGGCAGAGG + Intronic
1029979246 7:104862726-104862748 CTCCTTGGAAAGCTGGCCCCAGG - Intronic
1030210572 7:106991824-106991846 ATCCCTGGAAATTTGGGCCCAGG + Intergenic
1031254294 7:119428338-119428360 CTCCCTGGGATGCAGTGCCCAGG + Intergenic
1032018183 7:128392789-128392811 CTCCCAGGGCAGCCTGGCCCCGG + Exonic
1033210040 7:139453751-139453773 CTGGCTGGGAAGCAAGGCCCCGG - Intronic
1034479821 7:151310956-151310978 CTACCTGGGAGGCTGGGACATGG + Intergenic
1034566865 7:151922242-151922264 CTGCCTGGGAGGAGGGGCCCAGG + Intergenic
1035327854 7:158076390-158076412 CTCCCTGGGGAGCTGGTGCATGG + Intronic
1035568083 8:654965-654987 CCCCCTGGGGAGTTGCGCCCTGG + Intronic
1035728288 8:1838236-1838258 TTCCCTGGGACGCTGGCACCAGG - Intronic
1037552243 8:19985824-19985846 CCCCCTGGGAAGCAGGGCTATGG + Intergenic
1037731390 8:21526598-21526620 CCCACAGGCAAGCTGGGCCCTGG + Intergenic
1037786937 8:21908933-21908955 CCCCCTGGGTGCCTGGGCCCAGG + Exonic
1037946478 8:22992841-22992863 CTTCCTGGGAGGCAGGGCCAGGG + Intronic
1038251476 8:25908930-25908952 CGCCCTGGGATTCTGGGGCCGGG - Intronic
1038255258 8:25945359-25945381 CTCCGTGGGTAGCTGGGCTAAGG + Intronic
1039131989 8:34275593-34275615 CTCCTTGGGAACCAGGGCCAGGG + Intergenic
1039377140 8:37045735-37045757 CTGCCTAGGAAGCAGGGCCCAGG + Intergenic
1040385829 8:46914399-46914421 CTCCCTGGGACACTGGCCACAGG + Intergenic
1041094759 8:54338981-54339003 CTCACTGTGGAGCTGGGCCTTGG + Intergenic
1041140760 8:54816831-54816853 CTCCCTGGGCTGTTGGGACCTGG - Intergenic
1042169464 8:65977921-65977943 CTTCCTGTGAAGCAGGGCTCGGG - Intergenic
1042637402 8:70893981-70894003 CTCCCTGGCATCTTGGGCCCAGG + Intergenic
1043456541 8:80417723-80417745 CTACCTGGGAGGCTGAGGCCTGG + Intergenic
1044569433 8:93700681-93700703 GGCCCTGGGCAGCTGGGCTCGGG - Intronic
1044593939 8:93940636-93940658 CTCCCTGCGTGGCTGGGTCCAGG + Intergenic
1044843541 8:96358807-96358829 CTCCCTGGGAAACTGAACCCTGG + Intergenic
1044853587 8:96452511-96452533 CTCCCTGTGAGGCAGGGCTCCGG + Intergenic
1045257240 8:100536734-100536756 TTCCTTGGGAACCAGGGCCCTGG - Intronic
1045429725 8:102102592-102102614 ATGCCTCGGAAGCTGGGCTCCGG - Intronic
1045509885 8:102806291-102806313 CTCCCTCAGAAACTTGGCCCAGG + Intergenic
1047275539 8:123402302-123402324 CTCCCAGGGCAGCCTGGCCCAGG - Intronic
1047844885 8:128794793-128794815 CTTCCAGGGAGGCTGCGCCCGGG + Intergenic
1048331172 8:133471748-133471770 GTACCTGGAAAGCTGGGCCCAGG + Intronic
1048952187 8:139505372-139505394 GTCCCTGGGAAGCAGGAGCCAGG + Intergenic
1049006171 8:139857031-139857053 CGCCCTGGGAATCTGGGCGGGGG + Intronic
1049317574 8:141977439-141977461 CTCACTGAGGACCTGGGCCCAGG + Intergenic
1049428634 8:142549153-142549175 CCCTCTGGGAAGCAGGGCCTGGG - Intergenic
1049472759 8:142783659-142783681 CGCCCTGGGGAGATGGGCCTTGG + Intergenic
1049604804 8:143524325-143524347 CTCCCTGGGAGTCTGGGCTAAGG + Intronic
1049617838 8:143583637-143583659 ATCCCTGGGTGGGTGGGCCCAGG - Intronic
1051000103 9:12271364-12271386 TTTCCTGGGAAGCTATGCCCAGG - Intergenic
1051130687 9:13856646-13856668 CTCCTTGAGAGGCTGGGACCAGG + Intergenic
1052941158 9:34132963-34132985 CTCCCAGGGCAGCCTGGCCCAGG + Intergenic
1053153316 9:35756664-35756686 CATCCTGGAAGGCTGGGCCCTGG + Exonic
1053302513 9:36962037-36962059 CTACCTGGGTGGGTGGGCCCAGG - Intronic
1056281418 9:85044691-85044713 CTCCCTGGGAAGCAGACACCGGG + Intergenic
1056578074 9:87870860-87870882 CTCCCTGGGAACCTGGACTATGG - Intergenic
1056581453 9:87890064-87890086 CTCCCTGGGCAGAAGGCCCCTGG - Intergenic
1057128115 9:92635060-92635082 CCTCCTGGGAAGCTGTGCCTTGG + Intronic
1057268158 9:93632231-93632253 CTCCCTGGGCAGCTGGCCGTAGG - Intronic
1057758083 9:97853111-97853133 CTACCTGGGGAGGTGCGCCCGGG + Intergenic
1058200126 9:102028523-102028545 CTCCCTGGGACACAGTGCCCAGG - Intergenic
1059395397 9:114031293-114031315 CTCCCTGGGACTCTCAGCCCAGG + Intronic
1060214476 9:121730439-121730461 TTCCTTGGGAAGCTTGGCTCAGG + Intronic
1060937120 9:127522170-127522192 CTTTGTGGGCAGCTGGGCCCAGG + Intronic
1061042928 9:128150106-128150128 CTAGCTGGGCAGCAGGGCCCAGG - Intronic
1061179251 9:129014206-129014228 CTCCCTGGGAACCAGAGCTCGGG + Intronic
1061191689 9:129086049-129086071 GTCCCTGGGAAGCTGGCACATGG + Intronic
1061279040 9:129586627-129586649 CCAGCTGAGAAGCTGGGCCCAGG + Intergenic
1061727893 9:132591072-132591094 CTCTCTGGGGAGGTGGGCGCAGG + Intergenic
1061762329 9:132859345-132859367 CTGCCTGGGAGGCTGAGCCTGGG - Intronic
1061811099 9:133163259-133163281 CTCTCCGGGAGGCAGGGCCCGGG + Intronic
1061861033 9:133468963-133468985 CTCCAGGGGAAGCTGCTCCCAGG - Exonic
1061864961 9:133487439-133487461 CTCCCTGGGGACCCCGGCCCTGG - Intergenic
1061892891 9:133632017-133632039 CTCCCAGGGAAGCAGAACCCAGG - Intergenic
1062173320 9:135147515-135147537 CTCCCTGGGCAGGTGTGCCCAGG + Intergenic
1062307000 9:135913280-135913302 CTCCCCAGAAGGCTGGGCCCTGG - Intergenic
1062316571 9:135970241-135970263 CACCCTGGGAAGCTGCTCCCAGG - Intergenic
1062382742 9:136295235-136295257 CTCGCTGGGTTGCTGGGCCAGGG + Intronic
1062510405 9:136902270-136902292 CTCCCTGGGGAGGTGGCCCAGGG + Intronic
1188006186 X:25017076-25017098 ATCCCTGGGAACCTGCACCCAGG - Intergenic
1188255617 X:27959328-27959350 CTCTGTGGGAAGCTAGGCTCAGG - Intergenic
1189104310 X:38220692-38220714 CTACCTGGGAAGCTGCGGCTGGG + Exonic
1189240702 X:39522317-39522339 CTTGCTGGGAAACTGGGACCTGG - Intergenic
1189658990 X:43277901-43277923 CTCCCAGGGCAGCCTGGCCCAGG + Intergenic
1189818359 X:44846250-44846272 CTCCCTGGATACCTGGGCTCTGG + Intergenic
1190827361 X:54029709-54029731 CTGCCTGGGGCACTGGGCCCAGG - Intronic
1190937366 X:55008767-55008789 GGCCCTGGAAATCTGGGCCCAGG - Exonic
1191889340 X:65924988-65925010 CTCCCTGGGATGGAGTGCCCAGG - Intergenic
1191996892 X:67105342-67105364 CCCCCTAGGAAGCTGGGGCAGGG + Intergenic
1194160027 X:90438081-90438103 GACCCTGGGAAACTTGGCCCTGG + Intergenic
1195687849 X:107601985-107602007 CTCCCCCGGAGGCTGGGCACTGG - Exonic
1195753389 X:108178613-108178635 CCCCCAGGGCATCTGGGCCCAGG + Intronic
1196555884 X:117084017-117084039 CTCCCTGGGAGGAAGGGTCCAGG - Intergenic
1198236280 X:134738525-134738547 CTCTCTGGGTACCTGGGTCCAGG - Intronic
1199284734 X:146043341-146043363 CTACCTGGGAGGCTGAGGCCAGG - Intergenic
1200506319 Y:4015034-4015056 GACCCTGGGAAACTTGGCCCTGG + Intergenic
1201729254 Y:17187501-17187523 CTCCCTGGGAACCGGTCCCCAGG + Intergenic
1201858112 Y:18567749-18567771 CTGCCTGGGTGGCTGGGCCATGG + Intronic
1201875209 Y:18752632-18752654 CTGCCTGGGTGGCTGGGCCATGG - Intronic