ID: 1167525176

View in Genome Browser
Species Human (GRCh38)
Location 19:49979113-49979135
Sequence GTGTCTCCATATGACCCCAT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 104}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167525176_1167525177 5 Left 1167525176 19:49979113-49979135 CCAATGGGGTCATATGGAGACAC 0: 1
1: 0
2: 0
3: 9
4: 104
Right 1167525177 19:49979141-49979163 GATCCTGCAGCAAAGCTTCTAGG 0: 1
1: 0
2: 1
3: 10
4: 197
1167525176_1167525181 28 Left 1167525176 19:49979113-49979135 CCAATGGGGTCATATGGAGACAC 0: 1
1: 0
2: 0
3: 9
4: 104
Right 1167525181 19:49979164-49979186 TTGTTCCTCAGCATGGCGTAGGG 0: 1
1: 0
2: 2
3: 6
4: 91
1167525176_1167525179 21 Left 1167525176 19:49979113-49979135 CCAATGGGGTCATATGGAGACAC 0: 1
1: 0
2: 0
3: 9
4: 104
Right 1167525179 19:49979157-49979179 TTCTAGGTTGTTCCTCAGCATGG 0: 1
1: 0
2: 2
3: 18
4: 124
1167525176_1167525180 27 Left 1167525176 19:49979113-49979135 CCAATGGGGTCATATGGAGACAC 0: 1
1: 0
2: 0
3: 9
4: 104
Right 1167525180 19:49979163-49979185 GTTGTTCCTCAGCATGGCGTAGG 0: 1
1: 0
2: 0
3: 5
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167525176 Original CRISPR GTGTCTCCATATGACCCCAT TGG (reversed) Exonic
902255735 1:15187493-15187515 GGGGCTCCATCTGCCCCCATGGG - Intronic
911832522 1:102571095-102571117 GTGCTTCCATATGAACCTATGGG + Intergenic
912507127 1:110163974-110163996 GTATCTCCATGTGACTCCAGGGG - Intronic
912571016 1:110621070-110621092 GCGCCTCCATATGACCCTCTTGG + Intronic
1063890926 10:10627669-10627691 GTGTCTTAAGTTGACCCCATAGG - Intergenic
1068779360 10:60903056-60903078 GTCTCTCCGTATGTTCCCATAGG - Intronic
1070235877 10:74625669-74625691 TTGTCTCACTATAACCCCATGGG - Intronic
1071460094 10:85885566-85885588 GTGTCTCCAAATTATCCCATTGG - Intronic
1072455373 10:95570929-95570951 GTTTCACCTGATGACCCCATAGG + Intergenic
1074091567 10:110264031-110264053 ATGGCTCCAGATGAACCCATTGG - Intronic
1075472250 10:122699947-122699969 GTGTGTCCATTTCACCCCAGGGG - Intergenic
1076787555 10:132758578-132758600 GGGTCCCCAGCTGACCCCATGGG + Intronic
1078662347 11:13297602-13297624 GTGTCCCCATGTGTCCCCAGGGG + Intronic
1079132752 11:17757394-17757416 GTGTCTTCTGATGACCCCAGAGG + Intronic
1081747439 11:45482968-45482990 GTTTCTCCATATGAACACATAGG + Intergenic
1081836254 11:46157572-46157594 ATGTCTCCTTATGCCCCCCTTGG + Intergenic
1081922415 11:46791092-46791114 GGGTCTACAGATTACCCCATGGG - Intronic
1086960843 11:92978975-92978997 GAGTCTCCATAGGACCCGCTGGG - Intronic
1087989145 11:104726127-104726149 GTGTCTCTGTGTGACTCCATTGG + Intergenic
1089287462 11:117416899-117416921 GTGCCTTCATAGGGCCCCATAGG - Intergenic
1092005050 12:5062055-5062077 GTGCCACCATAAGGCCCCATAGG - Intergenic
1097798362 12:63887191-63887213 GAGCCTCCACATGACCCCACTGG - Intronic
1097802976 12:63935195-63935217 GACTCTCCATATGACTTCATGGG - Intronic
1098838009 12:75444757-75444779 GTGCCTCCATATTGCCACATGGG + Intergenic
1099634741 12:85199439-85199461 GTCTCTCTATTTGGCCCCATTGG + Intronic
1101547758 12:105732607-105732629 GTGACTGCATAAGACCACATGGG + Intergenic
1102491256 12:113290824-113290846 GGGTCACCATATGACCGCTTGGG - Intronic
1104145673 12:126031523-126031545 TAATCTCCATATAACCCCATGGG + Intergenic
1107633233 13:42364288-42364310 GTGCCTCCAGTTCACCCCATTGG + Intergenic
1108019552 13:46113162-46113184 GTAACTCCATATGCCTCCATAGG + Intergenic
1108527359 13:51297135-51297157 ATGTCTCCACAGTACCCCATGGG + Intergenic
1108802775 13:54120016-54120038 TTGTCTCCCTATGACCTCAAGGG - Intergenic
1114720046 14:24871932-24871954 GTGCCTCCATCTGACTCCATGGG + Intronic
1117055720 14:51910345-51910367 GTGACTCCCTCTGACCACATTGG - Intronic
1122424352 14:101597035-101597057 GTGTCTTCCTGTGACCCCCTGGG - Intergenic
1122834343 14:104423676-104423698 CTGTCTCCATATTTCCACATGGG - Intergenic
1122862293 14:104588034-104588056 GTGTGTCCAGATGACCCCAGGGG - Intronic
1124902051 15:33833037-33833059 GAGTCTCCATAGGACCACGTAGG + Intronic
1129065066 15:72895671-72895693 GTAACTCCATATGCCTCCATAGG - Intergenic
1133187406 16:4109887-4109909 GAGTTTGCATTTGACCCCATAGG - Intronic
1134237250 16:12476654-12476676 GTTTCTCCATCTCACTCCATCGG + Intronic
1137714246 16:50588429-50588451 GTTTCTGCATCTGACCCCACTGG + Intronic
1149582871 17:57763410-57763432 ATGTCTCCAGATGTCACCATAGG + Intergenic
1150104531 17:62452581-62452603 TTGTCTCAATATGGACCCATGGG + Intergenic
1150493042 17:65587482-65587504 CTGTCTCCAGATTTCCCCATGGG - Intronic
1152133434 17:78490866-78490888 GTGTCGCCTTAGGACCCCACGGG - Intronic
1158171578 18:54606184-54606206 CAGTTTCCATATAACCCCATGGG - Intergenic
1159926199 18:74271311-74271333 CTGTCTACAGATGACCCAATGGG + Intronic
1160572533 18:79827761-79827783 GTCTCTCCATGTGGCTCCATAGG + Intergenic
1164363828 19:27550510-27550532 TTTTCACCATAGGACCCCATGGG - Intergenic
1167525176 19:49979113-49979135 GTGTCTCCATATGACCCCATTGG - Exonic
1168655166 19:58122244-58122266 ATGTCTCCATATGTCCCCTGGGG + Intergenic
929613770 2:43292144-43292166 CTGTGTCCATCTGACCCCAAAGG - Exonic
937992564 2:127672716-127672738 CTGTCTGCAGATGAACCCATGGG - Intronic
947739018 2:232476452-232476474 GTTTCTCCACATGGCCCCTTGGG - Intergenic
1173500197 20:43547721-43547743 TTGTCCCCACATGACCTCATTGG - Intronic
1173730563 20:45325508-45325530 GTGTCTCCTCCTGACCCCAGTGG - Exonic
1176295700 21:5071003-5071025 GTGTGCCCATGTGACGCCATGGG + Intergenic
1179137224 21:38690221-38690243 GTGTCTTCATATCAACCCAAAGG - Intergenic
1179861347 21:44191121-44191143 GTGTGCCCATGTGACGCCATGGG - Intergenic
1181362687 22:22350442-22350464 CTTTCTCCACATGAACCCATGGG - Intergenic
1185251655 22:49805200-49805222 GTGGCTCCATGTGCCCCCAAGGG - Intronic
951569164 3:24044179-24044201 GTGTCTCCATCTGTCCACATGGG - Intergenic
953227831 3:41036544-41036566 GTGTCTCCTTATGTACCCCTTGG + Intergenic
953454632 3:43031883-43031905 TTGTCTCCATGTGATCCCATGGG - Intronic
960595485 3:119404236-119404258 CTGTCTCTAAAAGACCCCATGGG - Intronic
961959124 3:130835587-130835609 CTGTATCCATTTGACCCTATGGG + Intergenic
969889120 4:10243384-10243406 GTATCTCCATCAGAGCCCATAGG - Intergenic
970412901 4:15827101-15827123 GGATCACCATATGACCTCATGGG - Intronic
971980130 4:33741299-33741321 GTGTCTCCATCATTCCCCATGGG + Intergenic
973194904 4:47428564-47428586 GTGTCACCATATGCCCTCCTGGG + Intergenic
978507686 4:109477692-109477714 ATATCTCCATATGACCTAATTGG + Intronic
994691102 5:103020512-103020534 GGGACTCCATATGAACCCAGTGG - Intronic
995233694 5:109800275-109800297 GTGTTCTCATATGACTCCATGGG + Intronic
996304980 5:122036723-122036745 GTGTGTCCATATGACCCAACTGG + Intronic
997119050 5:131155657-131155679 GAGTCTCCAAATGACTGCATCGG - Intergenic
997794472 5:136794947-136794969 GAGTCCCCAAGTGACCCCATGGG - Intergenic
1002875216 6:1204114-1204136 GTGTCTCCAGGACACCCCATAGG - Intergenic
1005441551 6:25874439-25874461 GTGTCTCCTCAGGACCTCATAGG + Intronic
1007215647 6:40235285-40235307 GGGTCTCCAGCTGCCCCCATCGG + Intergenic
1019074202 6:169374062-169374084 GTCTCTCCATGTGATCTCATAGG + Intergenic
1022006326 7:26268968-26268990 GAGTTACCATATGACCCCTTGGG - Intergenic
1023480994 7:40634439-40634461 GTGCCTCCATGTGATCCCACAGG + Intronic
1029715312 7:102322280-102322302 ATGTCTCCATATTAGCCCTTAGG + Intergenic
1032033699 7:128505790-128505812 TTGTCTCAATATGGACCCATGGG + Intronic
1032768520 7:135023921-135023943 GTGCCTCCATCTGGCCCCTTGGG - Intronic
1032803604 7:135335637-135335659 GTGGCCCCATTTGACCCCAGTGG - Intergenic
1035720005 8:1784747-1784769 GTGTCCCCATATCAGCCCTTGGG - Exonic
1040568787 8:48590363-48590385 AATTCTCCATATGACCTCATGGG - Intergenic
1042115133 8:65422952-65422974 ATGTCTTCATATGACATCATGGG - Intergenic
1043002248 8:74773199-74773221 GTTTCTACTTATTACCCCATGGG - Intronic
1043227257 8:77748061-77748083 GGGTCTCCAGCTAACCCCATTGG + Intergenic
1045950321 8:107844392-107844414 GTTTCTCTAAATGTCCCCATGGG + Intergenic
1047726032 8:127684708-127684730 GGGTGACCATATGACCCAATTGG + Intergenic
1051922793 9:22287545-22287567 GTGTCTTCATATTCCCTCATAGG + Intergenic
1052504119 9:29330317-29330339 GTGTCTGCATGCGACTCCATGGG - Intergenic
1053349413 9:37403204-37403226 GTTTTTCCACATGACCTCATGGG + Intergenic
1053912708 9:42922371-42922393 GTGCCTGCATCTGACCCCCTTGG + Intergenic
1057022028 9:91706835-91706857 GTGTCTCCATCTGATGCCCTTGG + Intronic
1057678389 9:97153587-97153609 GTGCCTGCATCTGACCCCCTTGG - Intergenic
1061130629 9:128705946-128705968 GTGTCTCCTTATGAGCCCAATGG - Intronic
1061419030 9:130463404-130463426 GTGTCTCCATTTGCCCACAGAGG + Intronic
1061934669 9:133850695-133850717 GTGTCTCCAGGTGACCCCAGTGG - Intronic
1187932113 X:24303048-24303070 GTGTCTCCCTATGAAGCCAAGGG + Intergenic
1189193929 X:39135965-39135987 GTATCCCCATATGACCCTAGAGG - Intergenic
1191665532 X:63698633-63698655 GTGTGCCCAGATGACCTCATTGG - Intronic
1196909468 X:120470762-120470784 GTGACTCCATACTACCCCCTAGG - Intergenic
1200868662 Y:8073846-8073868 GTGTGTCCATATGAGCACGTAGG - Intergenic
1202245803 Y:22818849-22818871 GTGAATCCATATGAGCCTATAGG + Intergenic
1202267735 Y:23038530-23038552 GTGAGTCCATATGAGCCTATGGG + Intergenic
1202398791 Y:24452597-24452619 GTGAATCCATATGAGCCTATAGG + Intergenic
1202420727 Y:24672274-24672296 GTGAGTCCATATGAGCCTATGGG + Intergenic
1202450059 Y:24997808-24997830 GTGAGTCCATATGAGCCTATGGG - Intergenic
1202471989 Y:25217489-25217511 GTGAATCCATATGAGCCTATAGG - Intergenic