ID: 1167526233

View in Genome Browser
Species Human (GRCh38)
Location 19:49985585-49985607
Sequence GCCAGGTCCTGGGTGTCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 273}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167526233 Original CRISPR GCCAGGTCCTGGGTGTCCAC TGG (reversed) Intronic
900104086 1:974818-974840 GGGAGGTCCTGGCCGTCCACAGG + Exonic
900229281 1:1548121-1548143 TCCAGGCCCTGGGAGTCCAATGG - Intronic
900392880 1:2441351-2441373 GCCAGCTCCTGGGCCTGCACTGG + Intronic
900824142 1:4912740-4912762 ACCAGCTCCTGGGTGCCCATGGG + Intergenic
900953429 1:5872564-5872586 GCCTGGCCCTCTGTGTCCACCGG - Intronic
901138930 1:7015397-7015419 TCCAGGTCCTGTGTGTCTTCAGG + Intronic
901829427 1:11883135-11883157 GCCAGGGCTTGGCTGTGCACAGG - Intergenic
903033715 1:20481161-20481183 CCCAGGTGCTGGGAGTCCCCGGG + Intergenic
903039683 1:20519737-20519759 GTCAGTTCCTGGGTGGCCACAGG + Intergenic
903787058 1:25868314-25868336 CCCAGGAGCTAGGTGTCCACAGG - Intronic
904042666 1:27593432-27593454 CCCAGGTCCCTGGTGTCCATGGG + Intronic
905250364 1:36644321-36644343 CCCAGGTCGTGGGAGGCCACAGG - Intergenic
906731976 1:48090146-48090168 GCCGGGCCCTGGGTGGGCACAGG - Intergenic
906938068 1:50231784-50231806 GCCAGGTGCTGGGCCTCCAGTGG - Intergenic
908474160 1:64471488-64471510 GCCGGGACCTAGGTGTCCCCGGG - Intronic
909016251 1:70382944-70382966 GCAAGGTCCTGGGTGACAGCAGG - Intronic
910364325 1:86448019-86448041 GCCAGGACCAAGGTGTCCAGCGG - Intronic
911532124 1:99056149-99056171 GCTAGACCCTGGGCGTCCACTGG + Intergenic
912467006 1:109881309-109881331 ACCAGGTCCTGGGTGGGCAGAGG - Intergenic
913218465 1:116640262-116640284 GACAAGTCCTGGATGTGCACAGG - Intronic
915898419 1:159828972-159828994 CCCAGGTCCTTGGGATCCACTGG - Intronic
916138849 1:161676056-161676078 GCCAGGGCTTGGGTGGCCCCTGG - Intronic
919658036 1:200216101-200216123 TCCAGGTGCTCTGTGTCCACAGG - Intergenic
920528715 1:206686083-206686105 GGAGGGTCCTGGGTGTCCCCCGG + Intronic
923628788 1:235636033-235636055 GCCATTACCTGGGTGTCCCCTGG - Intronic
923787604 1:237083312-237083334 ACCAGATCCTGGGATTCCACGGG - Intronic
1063429719 10:5977754-5977776 GTAAGGTCCTGGGTCCCCACCGG - Intronic
1063464066 10:6231902-6231924 CCCAGGTGATGGGTGCCCACCGG - Intronic
1068560968 10:58513470-58513492 TCCAGTCCCTGGGTGTCCTCCGG - Intronic
1069849749 10:71397154-71397176 GGCAGCTCCTGGGTCTCCGCGGG - Intronic
1070116771 10:73536325-73536347 GGCAGGTCCTGGGTGGAAACTGG + Exonic
1071012172 10:80952324-80952346 GCCAGGTCCTGGTGAACCACTGG + Intergenic
1071555179 10:86596074-86596096 GCCAGGGCTTGGCTGTCCAATGG - Intergenic
1073452400 10:103617616-103617638 GCCGGGACCTTGGAGTCCACAGG + Intronic
1075567044 10:123512390-123512412 GCCAGGCGCTGGGTGGGCACTGG - Intergenic
1076526638 10:131116397-131116419 GCCGGGTCCTGGGTGGCCTGAGG - Intronic
1077057157 11:599761-599783 GCAGGGTCCTGGGTCTCCAGAGG + Intronic
1077209321 11:1361198-1361220 CCCAGCTCCTGGCTTTCCACTGG - Intergenic
1077209323 11:1361208-1361230 GCCAGGAGCTGGGTCTCCAAAGG + Intergenic
1077298543 11:1837080-1837102 GCCAGGTCCAGGTGGGCCACCGG + Exonic
1077364251 11:2155169-2155191 GCCAAGCCCTGGGGGTCCACAGG - Intronic
1078761032 11:14252133-14252155 CCCAGGACCTAGGTGTCCAGTGG - Intronic
1078916156 11:15780750-15780772 GCAAGGTCCTGGGCGACCACAGG - Intergenic
1079001794 11:16763718-16763740 GCCAGGTCCTGAGTGACCGAGGG - Intergenic
1079109039 11:17593800-17593822 GCCAAGCCCTGGGTGTCCTTGGG + Intronic
1079366436 11:19814182-19814204 GGAAGGTCCTGGATGTCAACAGG + Intronic
1080825226 11:35842804-35842826 GTCAGGTCCGGGGTCTCCATGGG + Intergenic
1081567601 11:44269683-44269705 TCCAGGCCCTGGCTGCCCACTGG + Intronic
1081676719 11:44974301-44974323 GCCAGGGCCTGGTTTTTCACAGG + Intergenic
1081794854 11:45812109-45812131 GCCAGGTGCTGGGAGACCAGAGG - Exonic
1081810980 11:45914002-45914024 GCCATGGGCTGGGTGTCCAGAGG + Intronic
1081990513 11:47334977-47334999 CCCAGGCCCTTGGTGTCCAGTGG - Intronic
1083722291 11:64609273-64609295 GCCAGGTCCTGGCGGCCCATGGG - Intronic
1084371225 11:68745520-68745542 GCCAGGGCCTCAGTGCCCACTGG - Intronic
1084415986 11:69033293-69033315 GCCAGGTCCTTGCTGGGCACTGG - Intergenic
1084622301 11:70281298-70281320 GTCAGGGCCTGGGTGACCAGAGG + Intronic
1084929161 11:72540327-72540349 GCCAGGTCCTGGGGCTCTAAAGG + Intergenic
1085636135 11:78160812-78160834 GCCAGTTCCTGAGTCTCCATGGG - Intergenic
1089733150 11:120532120-120532142 CCCAGGGCCTGAGTGGCCACAGG - Intronic
1090392635 11:126398932-126398954 GCCAGGTCTTGGGAGCCCTCAGG - Intronic
1091724935 12:2839619-2839641 GCTAGGCCCTGGGTGTACAGTGG + Intronic
1093215953 12:16361407-16361429 GCCAGGGCATGTGTGTCCAAAGG + Intronic
1095906102 12:47379678-47379700 GCCAGGTCATGGGACTCGACGGG - Intergenic
1096489385 12:52005501-52005523 GCCAGGTACTGGCTGGGCACTGG - Intergenic
1101987501 12:109458907-109458929 GGAAGGTCCTTGTTGTCCACTGG - Intronic
1102143745 12:110638252-110638274 GCCACGTCCTGTGTGGCCACAGG - Intronic
1102287052 12:111666170-111666192 GCCAGGTACTGGGAGTACAGCGG + Intronic
1103418403 12:120760260-120760282 GACAGGAAGTGGGTGTCCACAGG - Intergenic
1103565759 12:121814497-121814519 GCCACGTGCTGGGTGGCCAGTGG + Exonic
1104015661 12:124960102-124960124 GCCATCCCCTGGGTGTCCACGGG + Intronic
1104252321 12:127107284-127107306 GGCAGTGCCTGGCTGTCCACAGG + Intergenic
1104599346 12:130142028-130142050 GCCATTTCCTGTGTGTCCTCGGG + Intergenic
1104795374 12:131513452-131513474 TCCATGCCCTGGCTGTCCACGGG + Intergenic
1106621237 13:31373093-31373115 GCCAGGTCATGGTTGGCAACAGG + Intergenic
1107088534 13:36450857-36450879 GCCAGATGCTGGGAGTCCAGGGG - Intergenic
1112607501 13:100921523-100921545 CCCAGGTCATGGGTGTGCAGTGG + Intergenic
1113088784 13:106595788-106595810 GCCTGCTCCTGGGTGTCAAAGGG - Intergenic
1114616340 14:24070495-24070517 GCCAGGTGCTGGGGCTACACAGG - Intergenic
1116223094 14:42113252-42113274 GCCAGATACAGAGTGTCCACTGG + Intergenic
1118888550 14:69887684-69887706 GCCAGGGCCTGGGTCTGCTCTGG - Intronic
1121111824 14:91317857-91317879 GCCAGGTCCTGTTTGTACAGAGG + Intronic
1121740911 14:96251824-96251846 GCCAGGCCCTGTGTGGGCACAGG - Intronic
1122136869 14:99638474-99638496 GAGAGGCGCTGGGTGTCCACTGG + Intergenic
1122151243 14:99727243-99727265 GCCGGGCCCTGGGTGGGCACAGG - Exonic
1122406261 14:101502891-101502913 GCCAGGATCTGGGTGTCCTCAGG + Intergenic
1122606288 14:102948873-102948895 GCCAGTCCCTGGCTGTGCACAGG - Intronic
1122889791 14:104726951-104726973 GCCAGAGCCTGGGTGTCCAGAGG - Intronic
1202897938 14_GL000194v1_random:20831-20853 CCTAGGGCCTGGTTGTCCACTGG - Intergenic
1125502468 15:40248180-40248202 GCCAGGCCCTTGGGGTCCCCAGG - Intronic
1125524946 15:40368762-40368784 CCCAGGTCCTGGGTGCCATCGGG - Exonic
1126106884 15:45152516-45152538 GGCAGGGCCTGGGTGTCCCTGGG + Exonic
1127871839 15:63080402-63080424 CCCAGGTCCTGTGTCTCCCCAGG + Intergenic
1128390739 15:67180865-67180887 TCCAGGTACTGGGTGGCCCCTGG + Intronic
1128541584 15:68538450-68538472 GGCTGGTCCTGGGTGTACCCTGG + Intergenic
1129264794 15:74387806-74387828 GCCAGGTTCTGGGAGTGCCCGGG + Intergenic
1129373912 15:75115755-75115777 GCCAGATACAGAGTGTCCACTGG + Intronic
1130225718 15:82056927-82056949 GCCAGGTACTGTGTGGGCACTGG + Intergenic
1130271868 15:82455930-82455952 GGCAGGGTCTGGCTGTCCACAGG - Intergenic
1130464218 15:84183317-84183339 GGCAGGGTCTGGCTGTCCACAGG - Intergenic
1130488468 15:84411502-84411524 GGCAGGGTCTGGCTGTCCACAGG + Intergenic
1130500048 15:84490218-84490240 GGCAGGGTCTGGCTGTCCACAGG + Intergenic
1130586516 15:85187952-85187974 GGCAGGGTCTGGCTGTCCACAGG - Intergenic
1131269783 15:90940035-90940057 GCCAGGAACTGGGTGTACAGAGG + Intronic
1132029970 15:98431288-98431310 CACAGGTCCTGGCTATCCACAGG - Intergenic
1132809435 16:1790518-1790540 GACAGGTCCTCAGTGTCCTCAGG - Exonic
1133054180 16:3137290-3137312 GCCTGGTCCTGGGCCTCCAAGGG - Exonic
1133282225 16:4673302-4673324 GCCAGGTGCTGAGTTTGCACTGG + Intronic
1133324989 16:4936920-4936942 TCCAGGTCCTGTGCGCCCACAGG + Intronic
1136294182 16:29292243-29292265 GCCAGGTCCACGCTGACCACAGG + Intergenic
1136451173 16:30355063-30355085 GCCAGGTCCTGGGTCTGCCGGGG - Intronic
1136459039 16:30398540-30398562 GCCAGAGCCTGGGGGCCCACAGG + Exonic
1137702611 16:50507793-50507815 GGCAGGGCCTGGGTGTCTTCTGG + Intergenic
1138348384 16:56333667-56333689 ACCAGCTCATGGATGTCCACAGG - Intronic
1138537562 16:57668037-57668059 GCTAGGGGCTGGGTGGCCACAGG - Intergenic
1138810072 16:60139395-60139417 GCGATGTACTGGGTTTCCACAGG + Intergenic
1139506070 16:67398662-67398684 GCAGGGGCCTGGGTCTCCACGGG + Exonic
1141200496 16:81894068-81894090 GCTGGGTCCTAGGTGTGCACAGG + Intronic
1142100087 16:88266289-88266311 GCCAGGTCCACGCTGACCACAGG + Intergenic
1142189856 16:88712787-88712809 GCCAGGTTCTGGGGGTCCAGCGG - Exonic
1142254639 16:89007785-89007807 GCCAAGTCCCCTGTGTCCACTGG - Intergenic
1142292681 16:89200157-89200179 CCAAGGCCCTGGGTGTCCCCGGG - Intronic
1144584863 17:16481984-16482006 GCCAGGTGCGCGGTGTCTACTGG + Intronic
1145235077 17:21202492-21202514 TCCAGGACCGGGGTTTCCACTGG - Intronic
1145294397 17:21576258-21576280 AACAGGCCCTGGGTGGCCACTGG - Intergenic
1145369435 17:22296922-22296944 AACAGGCCCTGGGTGGCCACTGG + Intergenic
1146185651 17:30722544-30722566 GGCAGGTGGTGGGTGTCCCCTGG - Intergenic
1146949349 17:36894858-36894880 GCCCCGACCTGGGTGCCCACTGG - Intergenic
1147550322 17:41437386-41437408 GCCAGCCCCTGTGGGTCCACAGG + Exonic
1149862344 17:60129050-60129072 GCAGGGTCCTGGGGGCCCACAGG - Intergenic
1150235720 17:63591437-63591459 GACAGGAGCTGGGCGTCCACAGG - Exonic
1150724722 17:67642379-67642401 GCAAGCTCCTGGGTGCCCAGAGG + Intronic
1150789012 17:68185042-68185064 GGCAGGTGCTGGCTGTCCAGAGG + Intergenic
1151714004 17:75822379-75822401 TCCAGGGACTGGCTGTCCACTGG - Intronic
1151727990 17:75895466-75895488 GCCAGGCCCTGGGGGTCAGCAGG - Intronic
1151852144 17:76697322-76697344 GCCAAGTTCAGGGTGTCCGCAGG - Intronic
1152737446 17:82004408-82004430 GCCGGGACCTGGGGGTCCACCGG + Intronic
1154337913 18:13480877-13480899 GCCAGGACGTGGGTTTTCACTGG - Intronic
1156448551 18:37253956-37253978 ACGAGGGCCTGGGTTTCCACGGG + Intronic
1158606184 18:58898489-58898511 GCAAGGACCTGGGTGAACACAGG - Intronic
1160182863 18:76650894-76650916 GCTAGGTCCCTGGTGCCCACAGG + Intergenic
1160707188 19:535180-535202 TCCAGGGCCTGGGTGACCACAGG + Intronic
1160912783 19:1482525-1482547 GCCTGGTCCTGGTAGTCCCCGGG + Intronic
1161023255 19:2021721-2021743 GCCAGGACATGGCTGTCCCCAGG - Intronic
1161348119 19:3778009-3778031 CGCAGGTCTGGGGTGTCCACGGG + Exonic
1161401421 19:4067456-4067478 GCCAGGCCCTGGGCCTCCCCGGG + Intergenic
1161501771 19:4620151-4620173 GCCAGGTGCTGTGTGACCTCGGG - Intergenic
1162391006 19:10390239-10390261 GCCCTGACCTGGGTGTTCACAGG + Intergenic
1162973127 19:14193176-14193198 GGCAGGTGGTGGGTGTCCCCCGG + Intronic
1163714043 19:18863809-18863831 GCTAAGTCCTGGGTGGCCTCTGG + Intronic
1166300119 19:41908368-41908390 GCCAGGGGCTGGGGGTCCAGAGG - Intronic
1166417253 19:42604887-42604909 GCCAGGAAGTGGGTGTCCTCAGG + Intronic
1166648271 19:44549137-44549159 GCCAAGTTCTGGGCTTCCACCGG + Intergenic
1166745015 19:45137554-45137576 GCCTGGTCCCGGGTGTTCCCAGG - Intronic
1166938737 19:46350435-46350457 CCCAGGTCCTGGGGGGCAACAGG - Intronic
1166996793 19:46723247-46723269 GCCACGTCCTGGAGGGCCACGGG - Exonic
1167001887 19:46750370-46750392 GCCAGGTCCTGGCTACCCTCAGG - Intronic
1167526233 19:49985585-49985607 GCCAGGTCCTGGGTGTCCACTGG - Intronic
1168315610 19:55483521-55483543 GCCAGGCCCTGGGGGTCTAGGGG + Exonic
925026376 2:610356-610378 GCCAGGTCCTGGGTTCGCCCTGG - Intergenic
927515398 2:23669063-23669085 ACCTGGTCCTGTGTGACCACAGG + Intronic
929141480 2:38670307-38670329 GCCAGGTCTTTGGTGGCAACTGG - Intronic
929435587 2:41926343-41926365 TCCAGGTCCAGGGTGGTCACAGG - Intergenic
930051721 2:47221190-47221212 GGCGGGTGCTGGCTGTCCACTGG - Intergenic
934876359 2:97924458-97924480 GTCAGGACATGGGGGTCCACTGG + Intronic
936014540 2:108947714-108947736 GCCAAGTCCTGGGGCTGCACAGG + Intronic
940048247 2:149433357-149433379 GCCATGTCCTGTGTGTGCACAGG - Intronic
942248240 2:174026346-174026368 GCTAGGCCCTGGCTGCCCACAGG - Intergenic
945293694 2:208149752-208149774 GCTAGGGCCTGGGTATCTACTGG - Intergenic
947907019 2:233772308-233772330 GCCAGGTCCAGCGGCTCCACCGG - Exonic
948587509 2:239028416-239028438 GCCAGGTCCTGGGGGTCAGAGGG + Intergenic
1168897691 20:1335096-1335118 GAGAGGACCTGTGTGTCCACAGG - Intronic
1169068472 20:2707597-2707619 GCCTGGTGCTGGGTGGGCACAGG + Intronic
1169387730 20:5165448-5165470 GCCAGGTGCTGGGGGTACAGTGG + Intronic
1170420346 20:16186356-16186378 GCCAGGTCATGGAGGACCACAGG + Intergenic
1170868849 20:20186139-20186161 GACAGGTACAGGGTGTCCTCTGG - Intronic
1171212351 20:23326761-23326783 GCCAAGTCCTGGGTTTCCAGTGG - Intergenic
1171361307 20:24588257-24588279 TCCAGGTGCTGGGGGTCCAGAGG + Intronic
1173579617 20:44137699-44137721 GCCAGGTACTGGAGGTCCAGAGG + Intronic
1173625390 20:44468523-44468545 GCCACCTCCTGTGTGGCCACAGG + Intergenic
1174384114 20:50176549-50176571 GCTGGGTGCTGGGTGCCCACCGG - Intergenic
1174459547 20:50672879-50672901 GACAGATCCTTGATGTCCACAGG + Intronic
1174560697 20:51428717-51428739 GGGAGGACCTGTGTGTCCACTGG + Intronic
1175344643 20:58263964-58263986 GCCAGGTCCTGAGGGTGCACTGG - Intergenic
1175523843 20:59620004-59620026 TCCAGGTCCTGTGTGCCAACAGG - Intronic
1175806181 20:61830476-61830498 GCCAGGTCCTGGGGGGCCTTGGG - Intronic
1175975400 20:62708297-62708319 CCCCACTCCTGGGTGTCCACAGG - Intergenic
1175991254 20:62790659-62790681 GCCAGGTCCTGGGTCTCCCCTGG + Intergenic
1176047614 20:63100951-63100973 GCTTGGTCCAGGGTGTCCACTGG + Intergenic
1176229604 20:64025406-64025428 GGCAGAGCCTGCGTGTCCACTGG + Intronic
1176617619 21:9036820-9036842 CCTAGGGCCTGGTTGTCCACTGG - Intergenic
1179954027 21:44727916-44727938 GCCAGGCCCTGGGAGCCCAGGGG - Intergenic
1180039897 21:45270522-45270544 GCAACCTCCTGGCTGTCCACAGG + Intronic
1180160721 21:45997704-45997726 GGCAGGTCCTGGGGCTCCTCTGG - Exonic
1180839970 22:18954698-18954720 GCCAGGGCCTGGGTGTCCTGGGG - Intergenic
1181313945 22:21960147-21960169 GGCAGGTCCTGGGGGTCCTGGGG + Intronic
1181843542 22:25686740-25686762 TCCAGGTGGTGGGTGTCCCCAGG - Intronic
1182558867 22:31143410-31143432 GCCAGGGCCAGGGTGTCAGCTGG + Intergenic
1183324532 22:37184190-37184212 GCCAGGTGCCAGGTGACCACTGG + Intronic
1183393000 22:37556497-37556519 TCCAGCTCTTGAGTGTCCACTGG - Intergenic
1183518632 22:38283214-38283236 GCCAGGTCCTGGGTTTTCTCAGG + Intergenic
1184094701 22:42310308-42310330 GCCAGGTCCTGGGGATCTAGTGG + Intronic
1184258058 22:43298278-43298300 GACAGGTCCTGGGAGACCCCAGG - Intronic
1184289450 22:43490532-43490554 GCCAGCTCCTGGGGGTCCACAGG + Intronic
1184582432 22:45426600-45426622 TCGAGGTCCTGGCAGTCCACTGG + Intronic
1184805524 22:46792815-46792837 GCCAGCTCCTGGCTCTCCCCAGG - Intronic
1184886893 22:47352032-47352054 GCCAGGTCCTTTGTGCCCAGTGG + Intergenic
1185131819 22:49043669-49043691 CCCAGCGCCTGGGTGCCCACAGG - Intergenic
1185324559 22:50219378-50219400 GACTGGACCTGGGGGTCCACGGG + Exonic
949299566 3:2568023-2568045 GCTAGGTGCTGGGTGTGCAGAGG - Intronic
951812454 3:26715759-26715781 GCCAGTTCCTGGGCTCCCACAGG + Intergenic
952690148 3:36196007-36196029 GCCGGAACCTGGGTCTCCACTGG - Intergenic
953891010 3:46751499-46751521 GCCAGGCCTTGGGCTTCCACAGG + Intronic
953970335 3:47342333-47342355 GCCAGGACTTGGGGGACCACAGG + Intronic
953980926 3:47412715-47412737 ACCAGGTCCTGGGAGTCCTGAGG - Exonic
954295126 3:49670222-49670244 ACCTGGTCCTGGGTGGCCAGAGG - Exonic
954783989 3:53080009-53080031 GCCATGTGTTGGGTGGCCACAGG - Intronic
961824755 3:129593160-129593182 CCCAGCTCCTGGCTGTCCTCGGG + Intronic
962686974 3:137857245-137857267 GCCAAGTCCTGGGAGTGCACTGG - Intergenic
962928362 3:140015472-140015494 GCCAGAATCTGGGTGTACACTGG + Intronic
965784882 3:172324981-172325003 GCCAGGGCCTGGGAGTCAGCTGG - Intronic
968085688 3:195872954-195872976 GCAAGGCCCTAGGTGTCCCCCGG - Intronic
968547877 4:1207902-1207924 GCCAGGGCGTGGGTGTTCCCCGG - Intronic
968664963 4:1816015-1816037 ACCAGGTCCAGGGTTTCCACGGG + Intronic
968689527 4:1983561-1983583 GGCAGGGCCTGGGGGTGCACCGG - Intronic
969708922 4:8831679-8831701 GGCAGGGCCTTGGTGTCCCCTGG + Intergenic
970254349 4:14151993-14152015 GCCATCTCCTGGGTATCTACAGG - Intergenic
972775428 4:42235414-42235436 GGCATTTACTGGGTGTCCACAGG - Intergenic
973610863 4:52634980-52635002 GCCAGATCCAGGGTGTCTATGGG - Intronic
979016628 4:115442274-115442296 GCCAGGAATTTGGTGTCCACAGG + Intergenic
979722074 4:123912051-123912073 GCCAGGCCCTGGGTCTACAATGG - Intergenic
980130324 4:128811475-128811497 GGCAGGTGCTGGGTGGCCCCGGG + Intronic
980134183 4:128844649-128844671 GCCAGGGAGTTGGTGTCCACTGG + Intronic
983649017 4:170020359-170020381 GCCACATCCTGGGTTTCCCCTGG + Intronic
985480627 5:108063-108085 ACCAGGTCCTGCGTCTCCAGTGG + Intergenic
986178908 5:5375681-5375703 CCCAGGTCCTGAGAGTGCACTGG + Intergenic
986452514 5:7880754-7880776 GCCAGCTGCTGAGTGGCCACTGG + Intronic
988699631 5:33660668-33660690 ATCAGGTCCTCGGTGTCCCCAGG + Intronic
989029856 5:37107617-37107639 ACCAGGGCCTGTCTGTCCACTGG - Exonic
991962464 5:72058800-72058822 GTCAGGGCATGGGTATCCACAGG + Intergenic
995532435 5:113105002-113105024 ACCAGGCCCTGGATGTCCAGCGG - Intronic
998007299 5:138665513-138665535 GCCAGGCCCTGGGTGCCTCCCGG - Intronic
998282791 5:140828532-140828554 GCCAGATTCTGTGTTTCCACTGG + Exonic
999260212 5:150233681-150233703 GCCAGGTTCTGGGTCTCCTAGGG - Intronic
999637961 5:153641973-153641995 GCCAGATACTGGGTGTCGAATGG + Intronic
1000014471 5:157265697-157265719 GCCAGGACTTGGGTGTGCACTGG - Intergenic
1001457536 5:171876354-171876376 GCCGTGTCCTGGTTGGCCACCGG - Exonic
1002198141 5:177512253-177512275 GCCAGAACCTGGGTGGCCACAGG + Intronic
1002438508 5:179250691-179250713 GCAAGGCCCTGGGAGGCCACTGG + Intronic
1003422864 6:5973954-5973976 GCCAGGGCCAGGGTGTCACCAGG - Intergenic
1004065394 6:12239053-12239075 GCCAGGAACTGGGTATTCACAGG - Intergenic
1004332092 6:14731129-14731151 GCCTGGGCCTGGGGCTCCACTGG + Intergenic
1004786416 6:18972834-18972856 ACCAGGTACTGGGTCTCCACAGG - Intergenic
1006164144 6:32054581-32054603 CTCAGGTCCTGGCTGTCCCCTGG + Intronic
1006164770 6:32057779-32057801 CTCAGGTCCTGGCTGTCCCCTGG + Intronic
1010164857 6:72903588-72903610 ACCTGGTCCTGAGTGACCACTGG - Intronic
1012940348 6:105408782-105408804 GCAAGGTCCTGGAAGTCCACAGG - Intergenic
1013631358 6:111989210-111989232 GACATGTCCTGGGTGTACTCTGG - Intergenic
1017771791 6:157649937-157649959 GCCAGGCGCTGGGGGTGCACGGG + Intronic
1017771803 6:157649977-157649999 GCCAGGCGCTGGGGGTGCACGGG + Intronic
1017771815 6:157650017-157650039 GCCAGGCGCTGGGGGTGCACGGG + Intronic
1017771837 6:157650097-157650119 GCCAGGCACTGGGGGTGCACGGG + Intronic
1017777035 6:157688577-157688599 GCCAGGTGCTGAGAATCCACAGG + Intergenic
1017983401 6:159422147-159422169 GCCTGGTCCTGGGTGGACAGAGG - Intergenic
1018711567 6:166501285-166501307 GCGAGGCTCTGGGTCTCCACAGG - Intronic
1020070837 7:5226039-5226061 GCCAGCTCCGGGGTCTTCACTGG - Intronic
1023409071 7:39870104-39870126 TCCAGGCCCTGGGTAACCACCGG - Intergenic
1023822260 7:43986756-43986778 GCCAGGGCCTGGGACTCCAGGGG - Intergenic
1023981502 7:45073262-45073284 GCCTGGTCCTGGGGCTCCCCGGG - Intronic
1024046502 7:45589234-45589256 GCCAGGCCCTGGGTGGCACCAGG - Intronic
1024186160 7:46950160-46950182 TCCAGTTCCTGGGTGTCCTTTGG - Intergenic
1024239714 7:47424867-47424889 GCCAGGTCCACAGTGCCCACAGG + Intronic
1024260496 7:47570710-47570732 GCCAGCCCCTGGCTGTCCAGAGG + Intronic
1026895620 7:74008402-74008424 GCCCGGTCCTGGGAGGCCATGGG - Intergenic
1029600252 7:101559112-101559134 GCCAGGCCCGGGGTGACCACAGG + Intergenic
1029750525 7:102540170-102540192 GCCAGGGCCTGGGACTCCAGGGG - Intronic
1029768478 7:102639278-102639300 GCCAGGGCCTGGGACTCCAGGGG - Intronic
1033043578 7:137940267-137940289 GGAATGTCCTGGGTGTCCCCTGG - Intronic
1035077565 7:156190997-156191019 GCCAGGTGCTCTGTTTCCACTGG + Intergenic
1035383009 7:158452416-158452438 GGCAGGTCCATGGTCTCCACTGG - Intronic
1037762204 8:21748984-21749006 GCCATATCCTGGGTGTCCAGGGG - Intronic
1039194159 8:35011918-35011940 GCCAGCTCCTCAGTGCCCACTGG + Intergenic
1046017218 8:108619515-108619537 GCCAGGTGCTGGGAGACCCCTGG + Intronic
1046986806 8:120397533-120397555 GCCAGCTCCAAGGAGTCCACTGG + Intronic
1048960190 8:139570066-139570088 GCCAGGTACTTGGTGGCCATGGG + Intergenic
1051350205 9:16191906-16191928 GACAGGTCCTGGCTGCCCACAGG - Intergenic
1053306358 9:36986939-36986961 CCCAGTGCCTGGGTGTCCAGAGG + Intronic
1058715385 9:107718072-107718094 GCCAGCTCCTGGGTCTACCCTGG + Intergenic
1060110113 9:120900966-120900988 GCCACCTCACGGGTGTCCACAGG - Intergenic
1061598304 9:131647070-131647092 GCCATATACTGGGTGTCCAAAGG - Intronic
1061669485 9:132180557-132180579 GCCAGGAACTGGGTGGCCCCGGG + Intronic
1062142691 9:134968496-134968518 TCCAGGTCCTGGTTGTCCCTAGG - Intergenic
1062573348 9:137195460-137195482 GGCAGATCCTGGGTGGCCAGAGG - Intronic
1188834742 X:34942955-34942977 ACCCAGTTCTGGGTGTCCACAGG - Exonic
1189007126 X:37008534-37008556 ACCCAGTTCTGGGTGTCCACAGG - Exonic
1189723716 X:43947449-43947471 GCCAGTTCCTGGATTTCTACAGG + Intergenic
1192086390 X:68102256-68102278 GCCTGCTCCTGGGTGACTACTGG + Intronic
1193353132 X:80484630-80484652 TCCAGGTCCAGGGTGGCCATGGG + Intergenic
1195406002 X:104514071-104514093 CCCAGCTCCTAGGTGGCCACAGG - Intergenic
1200090276 X:153632758-153632780 GCCAGGGCCAGGCTGGCCACAGG - Intergenic
1200252214 X:154559704-154559726 TCCAGGTCCTGGGTGGCCTCTGG - Intronic
1200265554 X:154644712-154644734 TCCAGGTCCTGGGTGGCCTCTGG + Intergenic
1202377031 Y:24247036-24247058 GGCAGGGGCTGGCTGTCCACAGG - Intergenic
1202493749 Y:25423085-25423107 GGCAGGGGCTGGCTGTCCACAGG + Intergenic