ID: 1167528846

View in Genome Browser
Species Human (GRCh38)
Location 19:50002266-50002288
Sequence TGCCCTCAAGAAGCTCCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167528842_1167528846 -8 Left 1167528842 19:50002251-50002273 CCCAGAAGCCATCCTTGCCCTCA No data
Right 1167528846 19:50002266-50002288 TGCCCTCAAGAAGCTCCAGCTGG No data
1167528843_1167528846 -9 Left 1167528843 19:50002252-50002274 CCAGAAGCCATCCTTGCCCTCAA No data
Right 1167528846 19:50002266-50002288 TGCCCTCAAGAAGCTCCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167528846 Original CRISPR TGCCCTCAAGAAGCTCCAGC TGG Intronic