ID: 1167529050

View in Genome Browser
Species Human (GRCh38)
Location 19:50003433-50003455
Sequence GACCCTGAGCTGCTGCTCAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 264}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167529041_1167529050 25 Left 1167529041 19:50003385-50003407 CCACCTTTCATCTGCAAAGGCAG 0: 1
1: 0
2: 6
3: 78
4: 449
Right 1167529050 19:50003433-50003455 GACCCTGAGCTGCTGCTCACGGG 0: 1
1: 0
2: 2
3: 21
4: 264
1167529040_1167529050 26 Left 1167529040 19:50003384-50003406 CCCACCTTTCATCTGCAAAGGCA 0: 1
1: 0
2: 1
3: 23
4: 241
Right 1167529050 19:50003433-50003455 GACCCTGAGCTGCTGCTCACGGG 0: 1
1: 0
2: 2
3: 21
4: 264
1167529039_1167529050 27 Left 1167529039 19:50003383-50003405 CCCCACCTTTCATCTGCAAAGGC 0: 1
1: 0
2: 5
3: 15
4: 227
Right 1167529050 19:50003433-50003455 GACCCTGAGCTGCTGCTCACGGG 0: 1
1: 0
2: 2
3: 21
4: 264
1167529042_1167529050 22 Left 1167529042 19:50003388-50003410 CCTTTCATCTGCAAAGGCAGAAG 0: 1
1: 0
2: 2
3: 33
4: 337
Right 1167529050 19:50003433-50003455 GACCCTGAGCTGCTGCTCACGGG 0: 1
1: 0
2: 2
3: 21
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167529050 Original CRISPR GACCCTGAGCTGCTGCTCAC GGG Intronic
900090557 1:918525-918547 GTGCCTGGGCTGCTGCTCCCCGG + Intergenic
900130982 1:1087159-1087181 GTCCCTGAGCTTCTGTTCATGGG + Exonic
900653382 1:3742368-3742390 CACCCTGAGCTTCTGCTGCCAGG + Intergenic
900884207 1:5403903-5403925 GTGTCTGAGCTGCTGCTCTCCGG - Intergenic
901035077 1:6331621-6331643 GACCCTGAGCCCCCGCCCACTGG + Intronic
901322560 1:8348650-8348672 GACCCCCAGCAGCTGCTCAGGGG + Intergenic
901514299 1:9734777-9734799 CACCATGAGCTCCAGCTCACGGG + Intronic
901814665 1:11787387-11787409 GACCCGCAGCTGCTGGACACAGG + Exonic
902566441 1:17314676-17314698 GACCTTGGGCTGCTTCTGACAGG - Intronic
902659471 1:17891153-17891175 GACCCAGAGCTGATGCTCCAGGG - Intergenic
902965992 1:20003143-20003165 CACCGTGAGCTACTTCTCACAGG - Intergenic
903124319 1:21237434-21237456 GACCCTGCCCAGCTGCTCACAGG + Intronic
903191642 1:21659752-21659774 GCCACTGAGCTGCAGCGCACGGG - Intronic
903217890 1:21853074-21853096 GACACAGAGCGGCTGCTCAGAGG + Intronic
904006736 1:27366849-27366871 GGCTCTGAGCTGCCGATCACCGG - Exonic
904036985 1:27564251-27564273 GAGGCTGAGCTGCTGCTCCAAGG - Intronic
904276681 1:29389505-29389527 GACCCTGAGCTGCTGTGCCAGGG + Intergenic
905584483 1:39105841-39105863 GGCCCTGAGCTGCTGCTTCTCGG + Intronic
906041007 1:42787809-42787831 GACCCTGGGCACCTGCTAACTGG + Intronic
906511826 1:46414392-46414414 GGCCCTGAGCTGCTGCTGTTTGG + Intergenic
906733643 1:48104285-48104307 GAGGCTGACCTGCTGCTCCCAGG + Intergenic
908269011 1:62404866-62404888 CACCCTGGGCTGCCTCTCACAGG + Intergenic
908471358 1:64447128-64447150 GAGCCTGAGAGTCTGCTCACGGG + Intergenic
908789159 1:67764273-67764295 GTCCCCCAGCTGCAGCTCACTGG - Intronic
910935087 1:92480821-92480843 GCCCCTGCGCTGCAGCTCCCTGG + Exonic
913247043 1:116879125-116879147 GCGCCTGAGCTGCTGCTGACTGG - Intergenic
915938032 1:160100163-160100185 GACTCTGAGAAGATGCTCACGGG + Intergenic
916486188 1:165261081-165261103 GACCCTGAGCTTCTGTGCACAGG - Intronic
918140906 1:181718898-181718920 GACCCAGTTCTGCTGCTAACTGG - Intronic
920234535 1:204494165-204494187 GAGCCTGAGCTCCTGCCCGCCGG - Intronic
921008142 1:211114137-211114159 GTCCCTGCTCTGCTGGTCACTGG - Intronic
922157522 1:223051845-223051867 GACCCTAAGCCACTGCCCACAGG - Intergenic
924222361 1:241891123-241891145 GACCCTGAGGTTCTGTTCTCAGG - Intronic
1062819189 10:521501-521523 GTCCCAGCCCTGCTGCTCACTGG + Intronic
1063124035 10:3124454-3124476 GAACCTGAGTTGCTGCTCTGGGG - Intronic
1063367373 10:5499464-5499486 GCCTCCGAGCTGCTGCCCACCGG + Exonic
1063370167 10:5516067-5516089 GAGCCTTAGCAGCTGCTCCCAGG + Intergenic
1063908642 10:10806526-10806548 CACCCAGAGCTGCTGCTACCAGG - Intergenic
1064148969 10:12847625-12847647 GACACTGAGGTGCTGCTATCTGG - Intergenic
1065472990 10:26102626-26102648 GACCCTCAGCTGCAGGTCATTGG + Intronic
1067272306 10:44803069-44803091 CACCCTGTGCTTCTGCCCACTGG + Intergenic
1067476276 10:46568920-46568942 CACCCTGGGCTGCTGATCTCTGG + Intergenic
1067618461 10:47772860-47772882 CACCCTGGGCTGCTGATCTCTGG - Intergenic
1067712808 10:48663894-48663916 GACCCTGCACACCTGCTCACTGG - Intergenic
1068703692 10:60048799-60048821 GTCCCAGAGCTGCTGCTGTCTGG + Intronic
1069902897 10:71716071-71716093 GAGCCGGAGCTGGGGCTCACTGG + Exonic
1074055718 10:109921858-109921880 GTCCCTGATCTGATGCTCACTGG - Intronic
1075210977 10:120490772-120490794 CCACCTGTGCTGCTGCTCACTGG + Intronic
1076080460 10:127575968-127575990 CCCCCTGACCTGCTGCTCAACGG + Intergenic
1076370406 10:129949379-129949401 GAGCCTGGGATGCTGCTCACTGG - Intronic
1076484663 10:130808363-130808385 GGCCCAGAGCTGCTGCAAACTGG - Intergenic
1076501692 10:130942182-130942204 GACCCTGGTGTGCTGGTCACAGG - Intergenic
1076597188 10:131631120-131631142 GTCCCTGAGCTGATTCACACGGG + Intergenic
1076883635 10:133251656-133251678 GTCCCTGTCCTCCTGCTCACAGG - Intergenic
1077047695 11:553630-553652 GACCCTGAGAGCCTGTTCACTGG - Intronic
1078196038 11:9137933-9137955 GACGCTGCGCTGCAGCTCTCTGG + Intronic
1079186797 11:18245555-18245577 GAGGGTGAGCTGTTGCTCACTGG - Intronic
1079752190 11:24213138-24213160 GGCACTGATCTGATGCTCACTGG - Intergenic
1084466811 11:69328108-69328130 CACCCGGAGAGGCTGCTCACAGG + Intronic
1084499930 11:69529469-69529491 GTCCTTGAGTTGCTGCTCAGAGG + Intergenic
1086733926 11:90282916-90282938 CACCCTGAGCAGCTCATCACAGG + Intergenic
1089221202 11:116873461-116873483 GGCTCTGTGCTGCTACTCACTGG + Exonic
1089785578 11:120904684-120904706 GATCCTGAGTGGCTGCTCAGTGG - Intronic
1091393621 12:140678-140700 CTCCCTGAGCTGTTCCTCACAGG - Intronic
1091685170 12:2556336-2556358 CACCCTGAGCTTCTGCCCAGAGG + Intronic
1091773394 12:3168422-3168444 GACGCTGAGCAGCTGCAGACAGG - Intronic
1091851905 12:3706270-3706292 GATGCTGAGCTGCGTCTCACAGG + Intronic
1092261292 12:6954572-6954594 GACGCTGAGCTGTTACTCACTGG - Intronic
1092970864 12:13693533-13693555 AACCCAGGGCTGCTTCTCACAGG + Intronic
1096127291 12:49129333-49129355 CACCCTGAGCAGCTCATCACAGG - Exonic
1096530011 12:52236481-52236503 CTCCCTGAGCAGCTGCACACAGG - Intronic
1096917730 12:55051332-55051354 GACCCAGCTCTCCTGCTCACAGG - Intergenic
1098140834 12:67448831-67448853 GGCCCTGAGCATCTGCTTACAGG + Intergenic
1099218944 12:79889413-79889435 GGCTCTGAGCTGCTCCCCACTGG + Intronic
1102955239 12:117054636-117054658 GAAACTGGGGTGCTGCTCACGGG - Intronic
1103629590 12:122248832-122248854 GACCCTTGGCCTCTGCTCACAGG + Intronic
1104613491 12:130249783-130249805 TGCCCTGGGCTGCTGCTCTCAGG + Intergenic
1104769736 12:131353905-131353927 GACCCTGAGTTGCTGCTGCAAGG - Intergenic
1105307362 13:19178337-19178359 CACCCAGAGCAGCTGATCACCGG - Exonic
1105631038 13:22168655-22168677 GAACCTGGGCTGCTGCGCAGAGG + Intergenic
1106386601 13:29291515-29291537 GACCCTCAGCTGTGGCTCCCTGG + Intronic
1109389193 13:61670990-61671012 GACTGGGAGCTTCTGCTCACTGG + Intergenic
1112319914 13:98396331-98396353 GACTCTGAGATGCTGATCCCCGG + Intronic
1113065847 13:106373885-106373907 GCCCCTGATCAGCTTCTCACTGG - Intergenic
1113640252 13:111952240-111952262 CACACTGACCAGCTGCTCACAGG - Intergenic
1113755682 13:112809063-112809085 TCCCCAGAGCTGCTGCTCTCAGG - Intronic
1117656604 14:57962353-57962375 GACCCTGACTAGCTGCTCCCGGG + Intronic
1118512471 14:66490630-66490652 GGCCCTGAGAAGCTGCTGACTGG + Intergenic
1120019849 14:79516079-79516101 GAGCCAGAGCTGTGGCTCACTGG - Intronic
1120818730 14:88891962-88891984 GAACAGGAGATGCTGCTCACAGG - Intergenic
1121144845 14:91574536-91574558 GACCCAGCTCTTCTGCTCACTGG - Intergenic
1121224277 14:92309780-92309802 GACTCTGTGCAGCTGCCCACAGG + Intergenic
1122125490 14:99576406-99576428 TCCCGGGAGCTGCTGCTCACAGG - Intronic
1122539536 14:102490189-102490211 GATCCTGTGCTGCTTCCCACTGG + Intronic
1122599065 14:102912357-102912379 GACCCTGGGGTGCTGCTCCTAGG - Intergenic
1122664477 14:103319154-103319176 GAACCTGTGCTCCTGCTTACTGG - Intergenic
1122823970 14:104360735-104360757 GGCACTCACCTGCTGCTCACAGG - Intergenic
1123123471 14:105928766-105928788 GCCCTTGAGCTGCAGCTCAGGGG + Intronic
1123123472 14:105928767-105928789 CCCCCTGAGCTGCAGCTCAAGGG - Intronic
1123406117 15:20020270-20020292 GCCCTTGAGCTGCAGCTCAGGGG + Intergenic
1123406118 15:20020271-20020293 TCCCCTGAGCTGCAGCTCAAGGG - Intergenic
1123515447 15:21026918-21026940 GCCCTTGAGCTGCAGCTCAGGGG + Intergenic
1123515448 15:21026919-21026941 TCCCCTGAGCTGCAGCTCAAGGG - Intergenic
1125009027 15:34850118-34850140 CACCCTGAGCAGCTCATCACAGG - Intergenic
1125095242 15:35842830-35842852 GACCCAGAGCAGCTGCTCTCTGG - Intergenic
1125259947 15:37812123-37812145 GACTCTGAGAACCTGCTCACAGG + Intergenic
1131070332 15:89461784-89461806 TATCCTGAGCTGCTGCCCAGTGG - Intergenic
1132359402 15:101200369-101200391 GAGCCTGGCCTGCTTCTCACAGG + Intronic
1132405846 15:101541513-101541535 GACCCTGATCTGTGCCTCACAGG - Intergenic
1132675333 16:1119021-1119043 GAGGCTGGGCAGCTGCTCACAGG - Intergenic
1132732880 16:1371510-1371532 CACCCTCACCTGCTGCTCCCAGG + Intronic
1133631808 16:7629148-7629170 GGCCCTGGGCTGCTTCTCCCTGG + Intronic
1137440691 16:48496718-48496740 GCCACGGAGCTGCAGCTCACGGG + Intergenic
1137864223 16:51876617-51876639 GGCCCGTAGCTGCTGCTCCCTGG - Intergenic
1138814979 16:60193700-60193722 GACACTCAGCTGCTGTTTACTGG - Intergenic
1141497249 16:84418732-84418754 GAGTCTGAACAGCTGCTCACAGG - Intronic
1142067042 16:88068626-88068648 GACCCCGAGCTGGCGCCCACTGG - Intronic
1142111295 16:88333036-88333058 GTCCTTGTGCTGCTGCTCATTGG + Intergenic
1142306039 16:89286288-89286310 GACCGTGAGGGGCTGCTCTCGGG - Intronic
1142363376 16:89637605-89637627 GACCCATACCTGCTGCTCCCTGG + Intronic
1142517728 17:443608-443630 GACCCTATGCTGCTTCTCACTGG - Intronic
1143462386 17:7112287-7112309 GACACTGATCAGCTGCTCACCGG - Intronic
1144407397 17:14965302-14965324 GACCCTGATCTGCAACTAACTGG - Intergenic
1144707281 17:17377974-17377996 GACCCTAAGGTGCTGCCCAGAGG - Intergenic
1145246879 17:21275428-21275450 GACCCGTAGCTGCTGCACCCGGG + Intergenic
1145868390 17:28255272-28255294 GCCCCTGTCCTGCTGCTCTCTGG - Intergenic
1147040737 17:37716660-37716682 CACCCTGAGCAGCTCCTCTCTGG - Intronic
1148872575 17:50667491-50667513 TCCCCTGACCTCCTGCTCACAGG - Intronic
1149353367 17:55814439-55814461 GACACTGAGCAGCTGCTCCTGGG + Intronic
1149497343 17:57127614-57127636 GAGCCTGAGATTCTGCTCCCAGG - Intergenic
1152461617 17:80444975-80444997 GACCCTCAGCTGGGGCTCAGGGG - Intergenic
1152701612 17:81822544-81822566 GACCCTGAGGTGCTGCTGCTGGG - Exonic
1152771412 17:82171912-82171934 CTCCCTGAGCTGGTGCTCACAGG - Intronic
1152813733 17:82394769-82394791 GATGCTGAGCTGCTGCTCTGTGG - Intronic
1152926124 17:83088553-83088575 GGCCCTGGGCACCTGCTCACTGG - Intronic
1155472404 18:26204787-26204809 CATCCTGAGCAGCTGCTCTCTGG + Intergenic
1159911711 18:74152133-74152155 GACACTGAGCTGCTGCTTCAGGG + Intronic
1160620665 18:80168157-80168179 TCACCTGAGCTGCAGCTCACTGG - Intronic
1161914576 19:7218961-7218983 GACCCTTGGCTGGAGCTCACTGG - Intronic
1162671436 19:12260829-12260851 GAGTTTGAGCTGCTGCTTACTGG - Intronic
1163980068 19:20890989-20891011 GACAGTGAGCAGCTTCTCACTGG - Intergenic
1164146577 19:22516290-22516312 GACACAGAGGTGCTGCCCACTGG + Intronic
1164618855 19:29682005-29682027 AACCCTGAGCTGATGCTCCAAGG - Intergenic
1165270728 19:34705590-34705612 GACCCTCAGCTGCAGGTCATTGG + Intergenic
1165687156 19:37831631-37831653 GAAGCTGAGTTGCTGCTCTCTGG - Intergenic
1165710853 19:38009806-38009828 GACCCTGTCCTCCTGGTCACTGG - Intronic
1166435905 19:42766411-42766433 AACCCTGAGCTCCAGCTCAGTGG - Intronic
1166851991 19:45765601-45765623 GACCCTGAGGGGCTGCTCCTGGG - Exonic
1167466402 19:49652823-49652845 GAGCCTGAGCCGCTGCTGACTGG - Exonic
1167529050 19:50003433-50003455 GACCCTGAGCTGCTGCTCACGGG + Intronic
925336157 2:3100741-3100763 AACGCTGAGCTCCTGCTCTCAGG + Intergenic
925609923 2:5693848-5693870 GCCCCCCAGCTGCTGCTCGCTGG - Exonic
925688435 2:6495772-6495794 GAGCCTGACCTGCACCTCACGGG - Intergenic
926057163 2:9780785-9780807 GTCCCTGAACTGCTGTTTACAGG + Intergenic
926646433 2:15294589-15294611 GACCCAGGGATGCTGCTCATGGG + Intronic
931578951 2:63752582-63752604 GAGCCTGAGCAGCTCTTCACTGG - Intronic
932214480 2:69958131-69958153 GACTATGAGCAGCTGCTCTCTGG - Intergenic
933383170 2:81577024-81577046 GCCTATGAGCTGCTGCTCCCTGG + Intergenic
934942222 2:98510960-98510982 GCCCCCGAGCTTGTGCTCACTGG - Intronic
937243209 2:120475777-120475799 AACCTGGAGCTGCTGCTCCCCGG - Intergenic
938199306 2:129360179-129360201 GAAGCTGGGCTGCTGGTCACAGG + Intergenic
938298727 2:130195170-130195192 CACCCAGAGCAGCTGATCACCGG - Exonic
938457995 2:131479343-131479365 CACCCGGAGCAGCTGATCACCGG + Exonic
939251849 2:139691036-139691058 GAGCCTGTGCTGCTGTTCAAAGG - Intergenic
941065189 2:160893741-160893763 GTCCCTGGGCTGCTGCTCCCTGG - Intergenic
942210559 2:173665182-173665204 GACCCTGTGCTGTGGCACACAGG - Intergenic
942441719 2:176043658-176043680 GACCAGGAGCTGCTGGTCTCAGG + Intergenic
945771586 2:214049754-214049776 CATCCTGAGATACTGCTCACAGG - Intronic
947077132 2:226357116-226357138 GCCCTTGAGCTGCAGTTCACAGG + Intergenic
948029186 2:234802412-234802434 GACCCAGTGCTGCAGCTCATGGG + Intergenic
948447050 2:238040912-238040934 GAGCCACAGCTGCTGCTCTCAGG - Intronic
948614225 2:239188052-239188074 GACCCTGAGGGGCTGCTTGCGGG - Intronic
1170018739 20:11812586-11812608 GAGCCTGAGCAGCGGCTCAAAGG + Intergenic
1170661756 20:18348602-18348624 TACCTTCACCTGCTGCTCACTGG + Intergenic
1170722927 20:18900210-18900232 GACCCTGATATGGGGCTCACAGG - Intergenic
1171208524 20:23299597-23299619 TAACATAAGCTGCTGCTCACAGG + Intergenic
1171249484 20:23637527-23637549 GACCCCGTGCTGCTCCTCTCCGG - Intronic
1171465976 20:25328302-25328324 CACCCTGGGCTGCAGCTCTCAGG - Intronic
1173461019 20:43243470-43243492 GACCCTTAGCCCCTGCTCATTGG + Intergenic
1174128639 20:48326656-48326678 GACCCTGACCTGCTGAGCACAGG + Intergenic
1176027110 20:62991433-62991455 GAACCTGAGCTGCTGCTCAGAGG + Intergenic
1176085176 20:63292641-63292663 GACCCTGGGCTGCTCCCAACTGG - Intergenic
1177072369 21:16526624-16526646 AACCCTGAGCTGGTCATCACAGG + Intergenic
1178788626 21:35677346-35677368 GGCCCTGACCTGCTTCTCTCAGG - Intronic
1179586661 21:42377729-42377751 GACCCTGAGGGGCTGCTCTGAGG + Intronic
1179923557 21:44520564-44520586 GACCAGGAGCCGCGGCTCACAGG - Intronic
1180214307 21:46314891-46314913 GATGCAGAGCTGCTGCACACGGG + Intronic
1181474809 22:23161546-23161568 CAGCCTGGGCTGCTGCTAACTGG + Exonic
1181767170 22:25100227-25100249 CACCCAGACCTGCTGGTCACTGG + Intronic
1182027180 22:27129309-27129331 GATGCTGACCTGCTGCTTACGGG + Intergenic
1182093846 22:27613383-27613405 GAGCAAGAGCTGCTGCCCACTGG - Intergenic
1183341454 22:37284063-37284085 GTCCCTGCTCTGCTGCTGACTGG - Intronic
1183381433 22:37492322-37492344 GGCCATGCTCTGCTGCTCACTGG - Intronic
1183507259 22:38215962-38215984 GAGCCCGAGCTCCTGCTCCCTGG + Exonic
1183526425 22:38325909-38325931 GACCCTGAGAAGCTTCCCACCGG - Intronic
1184426270 22:44410895-44410917 CGCCCTGAGTTGTTGCTCACTGG + Intergenic
1184458605 22:44625059-44625081 TACCCTGAGCTGCTGCCCAAGGG + Intergenic
1185059307 22:48597789-48597811 CAGGCTGAGCTGCTGCTCTCTGG + Intronic
1185335499 22:50269407-50269429 GCCGCTTAGCTGCTGCCCACTGG - Intronic
950446952 3:13043961-13043983 GTCCAGGAGCTGCTGCTCAGGGG + Intronic
951097182 3:18645744-18645766 AACCCTGAGCTGCAGGTAACAGG - Intergenic
954449192 3:50562663-50562685 GGCCCTGAGCTGGTGGTCTCCGG + Intronic
954753483 3:52826686-52826708 GAGCCTGGGCTGGGGCTCACAGG + Intronic
960101870 3:113750823-113750845 GCCCCAAACCTGCTGCTCACAGG - Intronic
960718469 3:120601729-120601751 AACCCTGAGCTGCAGCCCCCAGG + Intronic
960803279 3:121559747-121559769 GACACTTAGCTGGTGCCCACTGG - Intergenic
961629829 3:128288437-128288459 GACCCTGATTTGCAGATCACTGG - Intronic
961663896 3:128484755-128484777 GACCCTGAGCCGGGGCTCAGCGG + Intronic
966526065 3:180920725-180920747 GACCTTGAGCTCCTGATCTCAGG + Intronic
967411407 3:189169845-189169867 GTCCCTGCTCAGCTGCTCACTGG - Intronic
968597318 4:1492147-1492169 GCCCCTGTGCTGCTGGTAACAGG - Intergenic
968856067 4:3123565-3123587 TAGCCTCAGCTGCTGCTCAGGGG + Intronic
968919221 4:3514081-3514103 GGACCTGAGCTCCTGCCCACGGG + Intronic
969455883 4:7299318-7299340 GGCCCTGGACTGCTGCTCAGTGG - Intronic
969573963 4:8025676-8025698 GACCCACAGAGGCTGCTCACAGG + Intronic
973600359 4:52536750-52536772 GCCCCAGAGCTGGTGCTCTCTGG + Intergenic
977295293 4:95202781-95202803 GCCCCTGTGCTGCTCCTCGCTGG - Exonic
977484221 4:97621644-97621666 GGCCCTGAGCTTCTTTTCACTGG - Intronic
983368243 4:166823989-166824011 GTCCCTAAGCTGCTGCTTCCAGG + Intronic
983648606 4:170016899-170016921 TACCCTGAGCCTCTGTTCACAGG - Intronic
983904712 4:173170118-173170140 GACCCTGACCTGCTTCCCCCCGG + Intronic
985617607 5:933235-933257 GGGCCTGACCTGCTGCTCAGGGG - Intergenic
985647697 5:1092886-1092908 GGCCCTGAGGTGACGCTCACAGG - Intronic
988688687 5:33550114-33550136 GAACCTGGGCTGCTGCACAAGGG - Intronic
989604715 5:43232888-43232910 CACCCTGAGCAGCTCATCACAGG - Intronic
990296432 5:54406101-54406123 GACCCTGAGGCCCTGATCACAGG + Intergenic
992000615 5:72432552-72432574 CACCCTCAGCTGCTGCTCAGTGG - Intergenic
992475657 5:77099526-77099548 GAACCTGAGCTGCTGTGCAGAGG + Intergenic
994239907 5:97407447-97407469 GACCCTGGGCTCCTGCACAGCGG + Intergenic
997537284 5:134632676-134632698 GATCCATAGCTGCTGCCCACCGG + Intronic
997574673 5:134965450-134965472 GAGCATGAGCTGCTGCTGAAAGG + Exonic
997819755 5:137054519-137054541 GTCCCTTAGCTGCTGCTCATGGG + Intronic
999475756 5:151897352-151897374 GACCATGAGCTGCTGGACAGAGG + Intronic
1001425284 5:171618545-171618567 GACCCTGAGCTGCTGCAGATAGG - Intergenic
1001814506 5:174656900-174656922 GATCCTGAGCTGCTGCTTCAAGG + Intergenic
1002704406 5:181150628-181150650 GACCAGGAGCTGCTGTTCTCAGG + Intergenic
1006181182 6:32154269-32154291 GGGCCTGGGCTGCTGCTCACGGG + Exonic
1006305379 6:33215351-33215373 CACCCTGGGAAGCTGCTCACAGG + Intergenic
1012989539 6:105911230-105911252 GACCCTGAGCTCCTGAGCAGAGG + Intergenic
1017588884 6:155957081-155957103 GACCCTAAGCTGGAGCTCAAGGG + Intergenic
1018915155 6:168128518-168128540 GCCCCTGGGCTGCTGCTTAGAGG - Intergenic
1018980318 6:168596571-168596593 CATCCTCAGCTGCTGCTCTCCGG + Intronic
1019109937 6:169701856-169701878 GAACCCGAGCTGCTGCTCTGGGG - Intronic
1019159264 6:170058261-170058283 AACACTGAGCTGCTCCTCTCCGG - Intergenic
1019504645 7:1384942-1384964 GTCCCTGAGCTGGGGCTCGCAGG - Intergenic
1020261478 7:6532815-6532837 GACCCTGGGCGTCTGCTCCCTGG - Intronic
1021497616 7:21293320-21293342 AAGCCTGAGCTGCTGCACCCAGG + Intergenic
1023725332 7:43137315-43137337 GAACCTGAGCTGCAGATCACAGG - Intronic
1023806662 7:43877493-43877515 GCCTCGGAGCTGCTGCTGACAGG - Exonic
1024088201 7:45914680-45914702 GGCCCTGAGCTGCAGCTCCTGGG + Intronic
1024655222 7:51446454-51446476 GGCGGGGAGCTGCTGCTCACCGG - Intergenic
1025024207 7:55503130-55503152 CACTCTGAGCAGCTGCTGACAGG + Intronic
1026870278 7:73846865-73846887 GCCCCTGTGCTGCTGACCACTGG - Intergenic
1026899645 7:74029696-74029718 GACCCGGGGCTGCTGCTTTCAGG - Intronic
1029220088 7:98981842-98981864 GAAGCTGAGCTGCTGCTCCTCGG - Exonic
1033588854 7:142794139-142794161 GCCCCTGAGCTGCTTCTTTCAGG + Intergenic
1035246648 7:157566708-157566730 GCACCTGAGCTGCTGTTCACTGG - Intronic
1035729404 8:1843849-1843871 GTCCCTGAGCGGCCGCTCAGAGG - Intronic
1036017106 8:4797151-4797173 GAGCCTGAGATGCTGCTGCCTGG - Intronic
1037110985 8:15164337-15164359 GGCTGGGAGCTGCTGCTCACCGG - Intronic
1040470357 8:47731346-47731368 TCCCCTGAGCTGCTGCACACAGG + Intronic
1041784486 8:61616369-61616391 GCCCCAAATCTGCTGCTCACAGG - Intronic
1043158615 8:76817947-76817969 AACCCAGAGCTGTTGCTCAGTGG - Intronic
1044626330 8:94237595-94237617 AACCCTCAGCTGCATCTCACAGG - Intergenic
1047204587 8:122793074-122793096 GAGCCTGAATCGCTGCTCACAGG + Intronic
1047928278 8:129701937-129701959 GATCCTGGGCAGCTGCTCAGGGG + Intergenic
1049156907 8:141072875-141072897 GAGCCACAGCTGCTCCTCACAGG - Intergenic
1049159154 8:141086365-141086387 TTCCCTGCCCTGCTGCTCACAGG - Intergenic
1049340697 8:142111027-142111049 GCCCCTGATCTGCTGGTCAGAGG - Intergenic
1049531002 8:143155178-143155200 GTTTCTGAGCCGCTGCTCACTGG - Intergenic
1049738698 8:144223735-144223757 CACCCTGAGCTGCAGCCCGCTGG + Intronic
1051168019 9:14286313-14286335 GACTCTGCGCTGCTCCTAACTGG - Intronic
1055668542 9:78576306-78576328 GCCCTTGAGCTGCTGCTTGCGGG + Intergenic
1056721036 9:89072252-89072274 GACCTTGAGCTGCTTATGACAGG + Intronic
1057782943 9:98064756-98064778 GTCCCTCAGCTGCTGCTGCCTGG + Intronic
1059409255 9:114121980-114122002 GACCCTGAGCTGCTGCTCGGGGG - Intergenic
1060545163 9:124455014-124455036 GACCCAGAGCTGTTGTTGACAGG + Exonic
1060793840 9:126502002-126502024 GACCATGAGCTGCAGCTCCTTGG - Intronic
1060974174 9:127754979-127755001 GCCGCTGAGCTGCAGCTCCCCGG + Intronic
1061242611 9:129383302-129383324 GTCCCTGCGCTGCGGCTCCCGGG - Intergenic
1061545832 9:131303804-131303826 GTCCCTGAGCTTCGTCTCACAGG + Intronic
1185857485 X:3549720-3549742 GACCCTGCGGTGCTCCACACAGG + Intergenic
1186442163 X:9595546-9595568 GGCCCTGACCAGCTGCTCTCAGG - Intronic
1189478647 X:41376344-41376366 GGTCCTGGGATGCTGCTCACAGG - Intergenic
1189494835 X:41499616-41499638 GAGCCTCAGCTGCTGCCCTCAGG + Intergenic
1192190573 X:68988929-68988951 GTCCCTGATCTGCTGCTTCCTGG - Intergenic
1192565982 X:72163981-72164003 GGGCCTGAGCAGCTGCTCAAGGG - Intergenic
1196456119 X:115892805-115892827 GGCCCTGAGCTGATGCTTCCTGG + Intergenic