ID: 1167529682

View in Genome Browser
Species Human (GRCh38)
Location 19:50007513-50007535
Sequence TCGTCTCAGCACCAGGACAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 122}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167529682_1167529685 -1 Left 1167529682 19:50007513-50007535 CCACTGTCCTGGTGCTGAGACGA 0: 1
1: 0
2: 0
3: 11
4: 122
Right 1167529685 19:50007535-50007557 ACCCAGTCCCTGGCCGCCCATGG 0: 1
1: 0
2: 2
3: 18
4: 215
1167529682_1167529693 30 Left 1167529682 19:50007513-50007535 CCACTGTCCTGGTGCTGAGACGA 0: 1
1: 0
2: 0
3: 11
4: 122
Right 1167529693 19:50007566-50007588 TACCTTCATAGAGAATGCCCTGG 0: 1
1: 0
2: 0
3: 10
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167529682 Original CRISPR TCGTCTCAGCACCAGGACAG TGG (reversed) Intronic
900437055 1:2635762-2635784 TCGTCCCAGCAGCCGGAAAGAGG - Intergenic
902247939 1:15133988-15134010 TGGTCTCAGCAGCAGGAAGGCGG - Intergenic
908683689 1:66690905-66690927 TCGTCACAGCATAAGGAAAGAGG - Intronic
914389722 1:147209027-147209049 TTTCCTCAGCACCAGGAGAGGGG - Exonic
916027002 1:160841655-160841677 GCAGCTCAGCAGCAGGACAGTGG - Exonic
916151459 1:161796102-161796124 TCGTCTCAGCAAGGAGACAGTGG + Intronic
919922100 1:202172010-202172032 GGGCCCCAGCACCAGGACAGCGG + Intergenic
920577269 1:207070673-207070695 TCCTGGCAGCATCAGGACAGTGG + Intronic
920806738 1:209241707-209241729 TCAGCTCAGCACCAGCACACTGG - Intergenic
921790523 1:219284843-219284865 TTGTCTCACCACCAGTGCAGTGG - Intergenic
924703512 1:246478598-246478620 ACGTACCAGCTCCAGGACAGAGG - Intronic
924703556 1:246478973-246478995 ATGTATCAGCTCCAGGACAGAGG - Intronic
924703560 1:246479020-246479042 ATGTATCAGCTCCAGGACAGAGG - Intronic
924703580 1:246479209-246479231 TTGTACCAGCTCCAGGACAGAGG - Intronic
1063386873 10:5621301-5621323 AGGCCTCAGCAGCAGGACAGTGG + Intergenic
1064615518 10:17151401-17151423 CAGTCACAGAACCAGGACAGAGG + Intronic
1065937932 10:30537587-30537609 TCCTCTCATCACCAGGCAAGGGG + Intergenic
1066192734 10:33070673-33070695 TAGTCTCAGCCCCAGGAAAGAGG - Intergenic
1068445903 10:57122787-57122809 TGGTCTCATCATCAGGATAGTGG + Intergenic
1072059733 10:91798442-91798464 TCGTTTCAGGACCCGGACGGCGG + Exonic
1074545149 10:114396406-114396428 TCGTCACTGCACCAGGCCAGCGG - Intronic
1076004268 10:126935488-126935510 ACGTCCCAGCAGCAGCACAGAGG - Intronic
1076093930 10:127714767-127714789 TCATCTCTGAGCCAGGACAGGGG + Intergenic
1077758772 11:5066888-5066910 TGGTCTCAGAACCAGGACATGGG + Intergenic
1080047694 11:27826765-27826787 TTGTGTCAGCGCCAGGAGAGAGG + Intergenic
1081994074 11:47352496-47352518 GCCTCTGAGCCCCAGGACAGGGG - Intronic
1093506126 12:19868799-19868821 TCAGCTCAGCAGCAGGACACCGG - Intergenic
1093899219 12:24610811-24610833 TTTTCTCAGCACCATGACAATGG + Intergenic
1101910825 12:108858970-108858992 AGGTCACAGCCCCAGGACAGAGG - Intronic
1103833860 12:123803297-123803319 TCGTCTAAGCTCCAGGCCAGAGG + Intronic
1109083435 13:57938321-57938343 TCTTCCCAGCTCCAGGTCAGAGG + Intergenic
1113207781 13:107937548-107937570 TTGTCTGAGAACCAGGACAGGGG + Intergenic
1113372071 13:109733510-109733532 TTGTCTCAGGACCATGGCAGGGG - Intergenic
1115642610 14:35344275-35344297 TCGCCCCAGAACCAGAACAGAGG - Intergenic
1115688308 14:35819496-35819518 TTGTCTCAGACCCAGCACAGTGG - Intergenic
1118885068 14:69859479-69859501 TCCCCTCAGCATGAGGACAGTGG + Intronic
1122183879 14:99974694-99974716 GCCTCTCTGCACCGGGACAGTGG + Intronic
1122715255 14:103693113-103693135 AACTCTCAGCACCAGCACAGGGG - Intergenic
1130235766 15:82132214-82132236 CTGCCTCAGCACCAGGACACAGG - Intronic
1131664755 15:94558420-94558442 TCGTTTCACCTTCAGGACAGTGG - Intergenic
1132981703 16:2741527-2741549 TCATCTGAGCTCCAGGACATTGG - Intergenic
1138582335 16:57949649-57949671 TAGGGTCACCACCAGGACAGTGG - Intronic
1141177345 16:81729768-81729790 AAGTCTCAGCACTAGGGCAGTGG + Intergenic
1141553041 16:84819014-84819036 TCATCTCCGCACCAAGACACCGG - Intergenic
1141665840 16:85464721-85464743 TGGCCTCTGCACCTGGACAGGGG - Intergenic
1142079175 16:88139331-88139353 TCGTCACATCCCCAGGCCAGGGG - Intergenic
1142129796 16:88427444-88427466 TCGTCCTAGCGCCAGGACGGAGG + Intergenic
1150272661 17:63876654-63876676 TCCTCCCAGCACCAGCAAAGAGG + Intronic
1151408350 17:73903811-73903833 AGGTCTCAGCACCAGGGAAGAGG - Intergenic
1151971219 17:77458372-77458394 TCCACTGAGCACAAGGACAGCGG - Intronic
1152103886 17:78317955-78317977 ACCTCCCAGCACCAGGCCAGGGG + Intergenic
1152217692 17:79044024-79044046 ACGACTCAGGACCAGGCCAGAGG - Exonic
1157324696 18:46660291-46660313 TGGTCTCAGGAGCAGGACATGGG + Intergenic
1160576272 18:79855728-79855750 CCGTCACAGCACGAGGGCAGAGG - Intergenic
1161172662 19:2820653-2820675 CTGTCTTATCACCAGGACAGCGG - Intronic
1161772482 19:6238654-6238676 TCTTCCCAGCTCCAGGACAGGGG - Intronic
1162117859 19:8442518-8442540 TCCTCTAAGGACCAGCACAGTGG + Intronic
1163012126 19:14433144-14433166 TCGTCTCGGGACCCGGAAAGAGG + Intronic
1163500958 19:17675883-17675905 TCTTCTGAGCATCAGGAGAGGGG - Intronic
1167529682 19:50007513-50007535 TCGTCTCAGCACCAGGACAGTGG - Intronic
934620184 2:95798860-95798882 CCCTCCCAGCCCCAGGACAGAGG - Intergenic
934640704 2:96025697-96025719 CCCTCCCAGCCCCAGGACAGAGG + Intronic
934950817 2:98574196-98574218 GGGTCTCTGCAGCAGGACAGAGG + Intronic
938232338 2:129671898-129671920 TCAACTCAGCTCCAAGACAGAGG + Intergenic
938795622 2:134716646-134716668 TCCTCTCACCAGCAGGAAAGAGG + Intronic
944109265 2:196114484-196114506 TCATGTCAGCACCTGGGCAGTGG - Intergenic
946151773 2:217778658-217778680 TGGGCTCAGCAGCAGAACAGAGG + Intergenic
946301727 2:218828145-218828167 GTGTCTCAGCACAAGGACACTGG - Intronic
946870362 2:224079041-224079063 TCCTGTGAGCACCAAGACAGTGG - Intergenic
947057941 2:226128517-226128539 TCAGCTCAGCACCTGGACATTGG - Intergenic
947566706 2:231198737-231198759 TCCTCCCAGCACCAGGACGGCGG - Intronic
948785907 2:240352869-240352891 TAGTCAAAGGACCAGGACAGAGG + Intergenic
1172835177 20:37868838-37868860 TCTTCTCAGACCCAGGAGAGAGG - Intronic
1173516715 20:43669515-43669537 TGGGCTCTGCTCCAGGACAGGGG - Intronic
1175965895 20:62660130-62660152 TGGTCTCAGGACCAGGCCACAGG + Intronic
1176118197 20:63442340-63442362 TGGTCCCAGCACAGGGACAGGGG + Intronic
1178109917 21:29359839-29359861 TCTTCACAGGCCCAGGACAGAGG + Intronic
1179548502 21:42127607-42127629 TCATCTGAGAACAAGGACAGCGG + Intronic
1179656355 21:42847541-42847563 GCGTCTCTCCACCAGGACCGCGG - Intronic
1179786480 21:43733287-43733309 TGCTGTCAACACCAGGACAGCGG - Intronic
1179809900 21:43864385-43864407 CCCTCTCAGCCCCAGGACAGCGG - Intergenic
1182368374 22:29793663-29793685 CCTTCTCAGCACCAGGAAGGAGG - Exonic
1183305922 22:37083203-37083225 TCGTGTCAGCGTCAGGAAAGAGG - Intronic
1183324226 22:37182820-37182842 TCTTCTCTGGGCCAGGACAGGGG - Intronic
1184096164 22:42317666-42317688 TAGACTCAGCCGCAGGACAGCGG + Intronic
949682735 3:6534286-6534308 TAGTCTCAGCCACAGGACTGGGG + Intergenic
953732778 3:45464469-45464491 CTGTCTCAGCCCCAGAACAGAGG + Intronic
955632788 3:60992610-60992632 TCGGCTTAGCAGCAGGACAATGG + Intronic
957041961 3:75342489-75342511 TGGTCTCTACACCAGTACAGTGG - Intergenic
961046684 3:123713294-123713316 TGGTCTCTACACCAGTACAGTGG - Intronic
968283863 3:197496804-197496826 TCCTGGCAGCACCAGGCCAGAGG - Intergenic
968826979 4:2905843-2905865 AGGTCTCAGCACCACGACATGGG - Intronic
969586569 4:8097470-8097492 TCCACTCACCACCAGGCCAGGGG - Intronic
969842768 4:9894793-9894815 TCATTTCAGCACCAGGTCACTGG - Intronic
971083134 4:23238888-23238910 TCATCTCAATACCAGGATAGAGG + Intergenic
983099952 4:163612969-163612991 AGGGCTCAGCACCATGACAGGGG + Intronic
985096437 4:186417043-186417065 TGGTGGCACCACCAGGACAGGGG + Intergenic
988554543 5:32224795-32224817 TTGTCTCTGCAGCAGGGCAGGGG + Intergenic
993661667 5:90645191-90645213 CAGTCTCAGCACCGGGACACGGG + Intronic
994329211 5:98486567-98486589 TAGTCTCTGCACAAGGAGAGAGG + Intergenic
997486621 5:134236377-134236399 TGGCCTCAGCACCAGCACATGGG - Intergenic
999247052 5:150160622-150160644 CCCTCTCAGCCCCAGGACCGTGG + Intergenic
1001529995 5:172454694-172454716 GCGGCTCAGCACCGGGACAAAGG - Intergenic
1002256136 5:177959612-177959634 GCGTCACAGCCCCAGGACAGCGG + Intergenic
1004176641 6:13345877-13345899 TTGCCTCATCACCAGGACAATGG + Intergenic
1006429594 6:33987645-33987667 TCGCCTCTGCCCCAGGACACAGG - Intergenic
1007343546 6:41209359-41209381 TCCTCTCAGGACAAAGACAGAGG + Intergenic
1015299810 6:131640291-131640313 TCTTCTAAGCACCATGACAAGGG + Intronic
1018278576 6:162159735-162159757 TGGTATTAGCATCAGGACAGAGG + Intronic
1019080687 6:169427510-169427532 TCATCTCAGATCCAGGAGAGAGG + Intergenic
1024943808 7:54788912-54788934 CTGTCTCAGCTCCACGACAGTGG + Intergenic
1027168131 7:75850571-75850593 TCTTGTCAGCACCAGGCCATGGG + Intronic
1028884562 7:95917160-95917182 TCGTCATTGCACCAGGTCAGGGG - Intronic
1028938381 7:96490964-96490986 TGGTCTCAGCTCCAGCACACAGG + Intronic
1034479559 7:151308983-151309005 TCCTCTCAGCACATGGACACGGG - Intergenic
1035489852 7:159265393-159265415 TAGTGTCAGCATCAGCACAGAGG + Intergenic
1035748915 8:1981706-1981728 GTGTCCCAGCTCCAGGACAGGGG - Intronic
1037088662 8:14885256-14885278 TATTCTCAGTACCAGCACAGTGG + Intronic
1037905543 8:22714056-22714078 TCGTCTCTGTCCCAGGACAGGGG + Intronic
1038038852 8:23707315-23707337 GCTTCTCAGCCCCAGGACCGAGG + Intergenic
1045563892 8:103294228-103294250 ATGTCTCAGCATCAGGTCAGTGG + Intergenic
1046608508 8:116397198-116397220 TCATCAAAGCACCAGGAAAGGGG + Intergenic
1048646434 8:136426470-136426492 TCGCCTGACCACCAGTACAGTGG - Intergenic
1049448870 8:142648030-142648052 TCGTCACATCTCCAGGGCAGGGG - Intergenic
1049588955 8:143446892-143446914 TTCTATCAGCACCAAGACAGTGG + Intronic
1049661393 8:143821157-143821179 TGGGCTCAGCCCCAGGACTGAGG - Intronic
1053363737 9:37508271-37508293 TCCTCTGGGCACCAGGGCAGTGG + Intergenic
1059257685 9:112945833-112945855 TCGTCTCACCTGCAGGAGAGAGG - Intergenic
1059564840 9:115373535-115373557 AGGTCTCACCACCAGGAGAGTGG + Intronic
1060103343 9:120858361-120858383 TCCCCTCAGTACCAGGAAAGTGG + Intronic
1061817685 9:133206498-133206520 ACGGCCCAGCACCAGGACAGGGG + Intronic
1191862080 X:65673956-65673978 TCATGTCACCACCAGCACAGAGG - Intronic
1195135880 X:101906861-101906883 TGGTCTCAGCACCAGGCCCCAGG + Intronic
1195963624 X:110410204-110410226 TCGTCCCACCACCAATACAGGGG - Intronic