ID: 1167529936

View in Genome Browser
Species Human (GRCh38)
Location 19:50008910-50008932
Sequence CTGGGCAAAGACTGTGTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 1, 2: 1, 3: 17, 4: 220}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167529934_1167529936 -10 Left 1167529934 19:50008897-50008919 CCAAAAGTGTTTTCTGGGCAAAG 0: 1
1: 0
2: 2
3: 28
4: 267
Right 1167529936 19:50008910-50008932 CTGGGCAAAGACTGTGTTGAGGG 0: 1
1: 1
2: 1
3: 17
4: 220
1167529933_1167529936 -9 Left 1167529933 19:50008896-50008918 CCCAAAAGTGTTTTCTGGGCAAA 0: 1
1: 0
2: 0
3: 29
4: 287
Right 1167529936 19:50008910-50008932 CTGGGCAAAGACTGTGTTGAGGG 0: 1
1: 1
2: 1
3: 17
4: 220
1167529932_1167529936 -8 Left 1167529932 19:50008895-50008917 CCCCAAAAGTGTTTTCTGGGCAA 0: 1
1: 0
2: 1
3: 18
4: 239
Right 1167529936 19:50008910-50008932 CTGGGCAAAGACTGTGTTGAGGG 0: 1
1: 1
2: 1
3: 17
4: 220
1167529929_1167529936 3 Left 1167529929 19:50008884-50008906 CCAAGGTTAATCCCCAAAAGTGT 0: 1
1: 0
2: 1
3: 9
4: 125
Right 1167529936 19:50008910-50008932 CTGGGCAAAGACTGTGTTGAGGG 0: 1
1: 1
2: 1
3: 17
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167529936 Original CRISPR CTGGGCAAAGACTGTGTTGA GGG Intronic
900976515 1:6020161-6020183 CTGGGCCAGGACTGTGGGGAGGG - Intronic
901052775 1:6433794-6433816 CTGGGCAAAGACTTGGAGGAAGG - Intronic
901208628 1:7511792-7511814 CTGGGCAGAGACTGTGGAGCTGG + Intronic
904666054 1:32122441-32122463 CTGTGCAAAGACGGTTTTGATGG + Intronic
907114916 1:51959999-51960021 AAGGGCCAAGAATGTGTTGAGGG + Intronic
907607516 1:55833015-55833037 CTGGGGAATGACTGTGTCCAAGG - Intergenic
908666021 1:66492097-66492119 CTGTGCAAAGAAGGTGTTCATGG + Intergenic
909932593 1:81514542-81514564 CTGCGCAAAAAATGTGTTGTGGG - Intronic
910061935 1:83104359-83104381 CTGGGAAAAGTCTTTCTTGAAGG - Intergenic
912032606 1:105267944-105267966 CTTGCCAAAGACTATGTTGAAGG - Intergenic
916347322 1:163808226-163808248 CTGGGGAAGGACAGTGTTTAAGG + Intergenic
916479583 1:165202763-165202785 CTCTGCAAAGCCTGTGCTGAAGG - Exonic
916488702 1:165282118-165282140 CTGGGCAGAGAGTGTGGAGAAGG - Intronic
917612830 1:176706363-176706385 CTGGGAGAAGAGTGTGATGATGG + Exonic
917622951 1:176816774-176816796 ATAGGCACAGACTCTGTTGAAGG - Intronic
917855071 1:179093049-179093071 CTGGGCAAGGACTTGGTTTAAGG + Intronic
918092237 1:181307597-181307619 CCGGGCCATGACTGTGTTGTAGG + Intergenic
918260394 1:182790214-182790236 CTGGGCAGAGAATATCTTGAGGG - Intronic
921061157 1:211585658-211585680 CTAGGCAATGCCTGTGTAGATGG + Intergenic
924076923 1:240348969-240348991 CAGGGCAATGACTGATTTGATGG + Intronic
1063533832 10:6863277-6863299 CTGGGCGAAGCCTCTGTTGTGGG - Intergenic
1065635002 10:27722772-27722794 CTGGGTAGAGGCTGGGTTGAAGG - Intronic
1065695301 10:28374272-28374294 CTGGGCAAAGAGAGGGTGGATGG - Intergenic
1066567832 10:36738786-36738808 CTGGGATAAGATTGTGGTGAGGG + Intergenic
1068554050 10:58438281-58438303 GTGTGCAAAGACAGTGATGATGG + Intergenic
1069515097 10:69070948-69070970 CTGGGCACTGACTGTGTGGCTGG + Intergenic
1071412477 10:85410591-85410613 CTGGGAAAAGAATGTGTTCCTGG + Intergenic
1072922543 10:99588613-99588635 CTGGGGAAAGATTTTGTTTAAGG - Intergenic
1073353845 10:102838072-102838094 ATGAGCAAAGAAGGTGTTGATGG - Intergenic
1073393595 10:103199723-103199745 CTGGACATAGACAGTGGTGAGGG + Intergenic
1073608733 10:104922339-104922361 CTGAGCAAAGTATGTTTTGAGGG + Intronic
1077282256 11:1751077-1751099 CTGGGCAGAGGCTGTGTGGCAGG - Intronic
1077443367 11:2578909-2578931 CTGGGCAGTCACTGTGCTGAGGG - Intronic
1079435442 11:20443115-20443137 CTTACCAAAGAGTGTGTTGAAGG + Intronic
1083633047 11:64105514-64105536 CTGGCCACAGCCTGTGTGGAGGG - Intronic
1083710853 11:64547435-64547457 CGGGGCACAGACTGTGGAGATGG - Intergenic
1083999487 11:66288438-66288460 CTGAGAAAAAACTGTGATGAGGG + Intronic
1084085420 11:66852870-66852892 CTGGGCAGAGGCTGAGTCGAGGG + Intronic
1084567444 11:69939494-69939516 CTGGGAAATGTGTGTGTTGAGGG - Intergenic
1084683460 11:70680347-70680369 CTGGGCTAAGACTGAGGTGTTGG + Intronic
1085487424 11:76877977-76877999 CTGAGAATTGACTGTGTTGATGG + Intronic
1087386546 11:97476825-97476847 CTGTGCAGAGAGTATGTTGAGGG + Intergenic
1087705909 11:101491692-101491714 CAGTGCAAAGACTTTGTTGTTGG - Exonic
1088133641 11:106526881-106526903 ATGGGCAAAGACTGAGGTAAGGG - Intergenic
1088690333 11:112321262-112321284 CTGAGCAAAGTCTGTGGTCATGG - Intergenic
1089394823 11:118129710-118129732 CTGGGCAAGGACTGTAGGGATGG + Intergenic
1089863850 11:121614911-121614933 CTGGGCCAAGACTGACTTGGGGG + Exonic
1091290371 11:134436114-134436136 CTGGGGAGTGACTGTGGTGAGGG - Intergenic
1092089408 12:5792027-5792049 CTGTGCAAATACTGTGATGATGG - Intronic
1093821282 12:23621360-23621382 CTGGACACAGACAGTGGTGATGG + Intronic
1094362654 12:29646790-29646812 CTGGGCAAAAACTGTGTCCCCGG - Intronic
1095050572 12:37550670-37550692 ATGGGAAAAGACTGTAATGATGG + Intergenic
1095305452 12:40633543-40633565 TTGGGCAAAGAATGTGATGTAGG + Intergenic
1096544961 12:52331775-52331797 CTGAGCTAAGACAGTGTTGGAGG - Intergenic
1096772701 12:53946148-53946170 CTGGACAGGGACTTTGTTGAGGG - Exonic
1096844682 12:54399644-54399666 CTGGGCCAAGACTTTCTTGCAGG - Exonic
1097187031 12:57201574-57201596 CGGGACAATGACTGTGTGGATGG + Exonic
1097478058 12:60083832-60083854 CTGGGCACACACAGGGTTGAGGG + Intergenic
1098953040 12:76661481-76661503 CTTTGCAAAGACTTTGATGATGG + Intergenic
1099046740 12:77729882-77729904 CTGGGTAAAGAAGGAGTTGATGG - Intergenic
1100976042 12:100123582-100123604 GTGGGCAAGGACTGGGGTGACGG - Intronic
1102879304 12:116472055-116472077 CTGGGCACAGACAGTGGAGATGG + Intergenic
1104935866 12:132364137-132364159 CTGGCCAAAGCCTGTCCTGACGG - Intergenic
1105235223 13:18544962-18544984 CTGGGCAAAGACATTGTGAATGG + Intergenic
1105309017 13:19189899-19189921 CTGGGCACAGAAAGTGCTGATGG - Intergenic
1109333739 13:60965593-60965615 CTGGGGAAAGAGAGTGTTGCAGG + Intergenic
1111834750 13:93374439-93374461 CAGGGTAAAGACTCTGTTGCAGG - Intronic
1112155617 13:96813604-96813626 CTGGGCATAGAGTGAGCTGAGGG - Intronic
1113341186 13:109427656-109427678 TTGTGAAATGACTGTGTTGAGGG - Intergenic
1115513261 14:34159214-34159236 CTGGGTAAAGAATGAGTTGAAGG + Intronic
1117094390 14:52282546-52282568 CTGGTCAAAGGCTGAGTTGCAGG + Intergenic
1117261281 14:54036225-54036247 CAGGGCAATCACTATGTTGATGG - Intergenic
1118622629 14:67627833-67627855 CTAGGCAAAGACTTTTTTGTGGG - Intronic
1118884640 14:69856192-69856214 CTGGGCAAAGACAGGGTTCCTGG + Intronic
1119642240 14:76324081-76324103 CTGGGCAAGAGCTGTGTTGAGGG + Intronic
1120886050 14:89452547-89452569 CTGGGGAAAGCCCGTTTTGATGG + Intronic
1121930346 14:97966484-97966506 CTGGGTAAAGACATTGATGAGGG + Intronic
1122827534 14:104377465-104377487 CTGGGCAAAGCCTGGGCTGGGGG - Intergenic
1123708176 15:22965835-22965857 CTGGGCCAAGCCCTTGTTGATGG - Intronic
1126665868 15:51076224-51076246 CTGTGGAATGACAGTGTTGAGGG + Intronic
1126802360 15:52310566-52310588 CTGTGCAAAGATTGGGCTGATGG + Exonic
1127994577 15:64145770-64145792 CTGGGGAAAGAATGTCTTGCAGG - Intronic
1129746440 15:78024945-78024967 CTGGGCTGAAACTGTGTTTAGGG + Intronic
1131969914 15:97881613-97881635 GTGGGCAAAGGCTGTGGAGATGG - Intergenic
1132051475 15:98611155-98611177 TTGGGCAAGGCCTCTGTTGAAGG + Intergenic
1132135529 15:99334337-99334359 CTGTGCTAAAACTGTGTTTAGGG + Intronic
1134050829 16:11136065-11136087 CTGGGCAAATACTCTGCTGCTGG - Intronic
1134063175 16:11211150-11211172 CTGGGCAAAGACTGTCCTGGAGG - Intergenic
1134788567 16:16967259-16967281 CTGGGAACAGAGTGAGTTGAGGG - Intergenic
1135133990 16:19874346-19874368 CTTGGCCAAGTCTGAGTTGATGG - Intronic
1136473115 16:30494991-30495013 CTGGGGAAAGACTGTATGCAGGG + Intronic
1139500149 16:67356552-67356574 CTGGGCAAATCCTGTGTTGGGGG + Intronic
1140843914 16:78868434-78868456 CTAGGACAAGACTGTGGTGATGG + Intronic
1141138050 16:81479291-81479313 GTGGGCAATGAATGTCTTGAGGG + Intronic
1142402051 16:89864186-89864208 CCAGGCAATGACTGTGGTGATGG - Intronic
1144475148 17:15581355-15581377 CTGGGCCATGAGTATGTTGAGGG - Intronic
1144936454 17:18902909-18902931 CTCGGTAAAGACTGAGTGGAGGG - Intronic
1145897611 17:28469548-28469570 CCGGGCACAGACTGTCTGGACGG - Intronic
1146300423 17:31685054-31685076 CTGGCCAATGACTGTGGTTAGGG + Intergenic
1148603270 17:48909350-48909372 CTGGGAAAAGACTGTGTGGAGGG - Intronic
1148752295 17:49952190-49952212 CTGAGCAAAGAGTCTGTGGATGG - Intergenic
1150264333 17:63822233-63822255 CTGAGCATAGACTGAGGTGAGGG - Intronic
1150742863 17:67793583-67793605 GTGCACAAAGGCTGTGTTGATGG - Intergenic
1153602507 18:6795307-6795329 GAGGGCACAGCCTGTGTTGATGG + Intronic
1153633568 18:7094802-7094824 CTGGGCACTGCCTGTGTGGATGG - Intronic
1154514316 18:15145045-15145067 CTGGGCAAAGACATTGTGAATGG - Intergenic
1156498010 18:37538520-37538542 CTGGGTAAAGACAGCGTTGTGGG - Intronic
1158452513 18:57579964-57579986 CTGGGAAAAGCCAGTGTGGAAGG - Intronic
1163692958 19:18746985-18747007 CTGGGCTGAGAGTGTGTTGTTGG + Intronic
1164708234 19:30335994-30336016 CTTGGCAAAGACTGGGGTGAGGG + Intronic
1164749501 19:30642040-30642062 CTCTGCAATGGCTGTGTTGATGG + Intronic
1164854141 19:31507464-31507486 CAGGGAGAAGACTGTGTAGATGG - Intergenic
1167529936 19:50008910-50008932 CTGGGCAAAGACTGTGTTGAGGG + Intronic
1168002402 19:53459626-53459648 TTGGGACAAGACAGTGTTGAAGG + Intergenic
925399222 2:3559598-3559620 CTGAGCAAATACAGTTTTGAAGG + Intergenic
925975844 2:9141440-9141462 CTGGGCACTCACTGTGTGGATGG + Intergenic
930116664 2:47723987-47724009 CTAGTAAAAGTCTGTGTTGATGG - Intronic
931186254 2:59954246-59954268 CAGGGCTTAGGCTGTGTTGAGGG + Intergenic
931302483 2:60994115-60994137 CTGGCCAAAGACTATTTTGCTGG + Intronic
931827895 2:66020206-66020228 CTGGGCAAAGACTGTGTAGAAGG + Intergenic
932619199 2:73255917-73255939 CTGGGGAAAGGCTGTGGTGCTGG + Exonic
934612882 2:95753825-95753847 CTGGGTACAGCCTGTGTTGTAGG + Intergenic
934648024 2:96070598-96070620 CTGGGTACAGCCTGTGTGGAGGG - Intergenic
934841399 2:97626420-97626442 CTGGGTACAGCCTGTGTTGTAGG - Intergenic
935148668 2:100414152-100414174 CTGGGCAAAGACTGTGGTCTGGG + Intronic
935177585 2:100663380-100663402 CTGGGCAGAGACTGTGAATAAGG - Intergenic
935851383 2:107223720-107223742 CTGAGCACAGGCTGTGTTAAGGG - Intergenic
937428347 2:121817948-121817970 CAGGGCAAAGATGGTGTTGGGGG + Intergenic
938514558 2:131989655-131989677 CTGGGCAAAGACATTGTGAATGG - Intergenic
938610724 2:132945101-132945123 CTGGGGAAAGGCTGTGCTGCTGG + Intronic
938649897 2:133372202-133372224 ATGGGCAAAGACGGTGGTGATGG + Intronic
946642316 2:221797595-221797617 TTTGGCAAAGATTGTGTTTAGGG + Intergenic
948097594 2:235348805-235348827 CATGCCAAATACTGTGTTGAGGG + Intergenic
948609498 2:239157820-239157842 CAGTGCAAAGAATGTGCTGAAGG + Intronic
1170405340 20:16029739-16029761 CTGGGGAAAGACTGAGTAAAAGG - Intronic
1171361246 20:24587756-24587778 CTGGGCAAAGAGCATGTTGGTGG + Intronic
1171545085 20:25994144-25994166 ATGGGAAAAGACTGTAATGATGG + Intergenic
1172636865 20:36415905-36415927 CTAGGAAAAGTCTGAGTTGAGGG - Intronic
1172977449 20:38917754-38917776 CTGGGGAGATACTATGTTGAAGG - Intronic
1175525804 20:59632548-59632570 CTGAGCAAAGACAATTTTGAAGG + Intronic
1176779215 21:13173245-13173267 CTGGGCAAAGACATTGTGAATGG + Intergenic
1177040415 21:16102851-16102873 CTGAGCAAAGACTCAATTGAAGG + Intergenic
1177976860 21:27862283-27862305 CTGGGCAAAGACATTGTGAATGG + Intergenic
1178300581 21:31449701-31449723 CTGGGCAGAAACTTTGTGGAGGG - Intronic
1178635489 21:34298620-34298642 TTGGACAAAGACTTTGATGAAGG + Intergenic
1180053385 21:45344178-45344200 CTGAGCCAAGACTGGGTTCACGG - Intergenic
1180124362 21:45778926-45778948 GTGGCCAAAGCCTGGGTTGATGG + Intronic
1182038778 22:27219972-27219994 CTGGGCAAAAAGTGAGTGGAAGG + Intergenic
1183679237 22:39317502-39317524 CTCAGCAAAGACAGTCTTGAAGG + Exonic
1184768970 22:46587021-46587043 CTGGACAAAGCCCGTGCTGATGG + Intronic
949103842 3:179856-179878 ATGGGCAAAGCCACTGTTGATGG - Intergenic
950798650 3:15531676-15531698 CCTGGCAAAGGCTTTGTTGAGGG - Intergenic
951742544 3:25940335-25940357 CTTGGCAGCAACTGTGTTGATGG + Intergenic
952304659 3:32135284-32135306 CTGAGCAAGGCCAGTGTTGAAGG + Intronic
953025316 3:39141759-39141781 ATGGACACAGGCTGTGTTGAGGG - Intergenic
954306382 3:49727716-49727738 CTGGGCAAACACTGTCTGGAAGG + Intronic
954796437 3:53163623-53163645 ATGGGCCAAGATTGTGTTAAAGG - Intronic
956300450 3:67766177-67766199 GTGTGCAAAGACTGGGTAGAGGG + Intergenic
962743150 3:138377839-138377861 ATGGGCAGAAACTGTGTGGAAGG + Intronic
963184747 3:142401773-142401795 CTAGGCTAAGATTGTGTAGACGG - Intronic
963446032 3:145409165-145409187 CTGGGTCAAGACTATTTTGATGG - Intergenic
965675485 3:171191145-171191167 CTGTACAGAGACTGTGTAGATGG - Intronic
966943345 3:184760486-184760508 CTGGGCTTAGACTGTGTTCCTGG - Intergenic
970372163 4:15418846-15418868 CTGGGCAGACTCTGTGCTGAGGG - Intronic
974280216 4:59782198-59782220 CTGGGCAAATAATGAGTAGAAGG + Intergenic
975924354 4:79431446-79431468 CTGGGCAGAGATTGGGGTGAGGG - Intergenic
976371552 4:84294496-84294518 CAGAGGAAAGACAGTGTTGAAGG - Intergenic
978088367 4:104683661-104683683 CTGGTCAAGGGCTGTGTGGAAGG + Intergenic
981045095 4:140257434-140257456 CTGGGCACAGGCTTTGTTCAAGG + Intronic
981940227 4:150274209-150274231 CTGGGCAAATACTGAAATGAAGG + Intronic
982404662 4:155006341-155006363 CTGGGGAAACACAGTGTTGTAGG + Intergenic
983033574 4:162834544-162834566 CTGGGCAAATACTGTGATAACGG + Intergenic
983366236 4:166793876-166793898 CTGGGGAAAGATTGTATGGATGG - Intronic
984725622 4:183017472-183017494 CTGGGCCATGACAGTGTTGATGG + Intergenic
986434867 5:7719628-7719650 CTGGGGAAAGACTGAGCAGATGG - Intronic
987117178 5:14735007-14735029 CTCTGCAAAGACCTTGTTGAGGG + Intronic
990369920 5:55107261-55107283 CTTGGCATTGAGTGTGTTGAAGG - Intronic
992950115 5:81850431-81850453 CTGGGCAAAGAGAGTATTGGGGG + Intergenic
993946223 5:94119960-94119982 ATGGTAAAAGACTGTTTTGAAGG + Intergenic
994445299 5:99864585-99864607 CAAGGCAAAGACTCTGTTTATGG - Intergenic
996583293 5:125055784-125055806 CAGGGCAGAGACTAGGTTGAAGG + Intergenic
996818352 5:127597911-127597933 CTGGGCAAAACATGTGTTGGAGG + Intergenic
1000290387 5:159864584-159864606 CGAGGCAAGGGCTGTGTTGAGGG - Intergenic
1004091133 6:12503025-12503047 CTGGGCAAAGACTTGGAGGAAGG - Intergenic
1007097621 6:39223614-39223636 TTGGACAAAGACTGTCTTGGAGG + Intronic
1007183899 6:39951051-39951073 CTGGGCACAACATGTGTTGAGGG + Intergenic
1007518033 6:42429032-42429054 CTGGGCACAGATGGGGTTGAAGG - Intronic
1008024730 6:46622235-46622257 CTGGGACTAGACAGTGTTGATGG + Intronic
1008213964 6:48761712-48761734 CTGAGCACAAACTGTGTAGAAGG - Intergenic
1011792213 6:90910769-90910791 AAAGGCAAAGACTGTGTTTAGGG + Intergenic
1012030101 6:94049023-94049045 TTGGGCAATGTCTGTGTTTAAGG - Intergenic
1012119013 6:95340097-95340119 CTGGGCAAAGACTATGATGCAGG - Intergenic
1015553647 6:134438630-134438652 CTGTAGAAAGTCTGTGTTGAAGG + Intergenic
1015734220 6:136380524-136380546 CTGGGGAAAAAATGTATTGATGG + Intronic
1015965194 6:138691007-138691029 CTTGACAAAGAATGTGATGAGGG - Intronic
1017237600 6:152132702-152132724 CAGGGCAAAGCATGTGTTCATGG + Intronic
1018083590 6:160279449-160279471 TCGGGCAGTGACTGTGTTGAGGG - Intergenic
1018823682 6:167393355-167393377 CTGTGCAAAGACTGTTCTGATGG + Intergenic
1018852989 6:167654585-167654607 CGGAGCAAAGACCGTGTTGGAGG - Intergenic
1019504311 7:1383201-1383223 CTGGGCACAGACCGTGGGGAGGG + Intergenic
1020067727 7:5201856-5201878 ATGGACAAAGAATGTTTTGAGGG + Intronic
1020279263 7:6642185-6642207 CTGGGTACAGAATGTCTTGATGG + Intronic
1021121274 7:16798398-16798420 CTGGGGAAGGACTGAGTTGGGGG + Intronic
1022269760 7:28794765-28794787 CTGGGCAGAGACAGTGGTGGTGG - Intronic
1025296494 7:57779213-57779235 ATGGGAAAAGACTGTAATGATGG + Intergenic
1027363520 7:77433304-77433326 AGGGGCTAAGACTGTGTTGGTGG + Intergenic
1027836932 7:83255761-83255783 GTTGGCAAAGGCGGTGTTGAGGG - Intergenic
1027858022 7:83537852-83537874 CTGGGAAAAGACAGTGGTGGTGG - Intronic
1028385737 7:90251033-90251055 CTGGGAGAAGACTGGGTTGGAGG - Intronic
1028601561 7:92606302-92606324 CTGGGCACAGACTGTGCTCATGG - Exonic
1029514256 7:101016086-101016108 CTGGGCTCCCACTGTGTTGAAGG - Intronic
1030450389 7:109702492-109702514 TTGGGAAAAGAGTGGGTTGAAGG + Intergenic
1030473577 7:109999305-109999327 CTCAGCAAAGACAGTCTTGAAGG + Intergenic
1030592193 7:111495482-111495504 CTGATCAAAGACTATGCTGAAGG + Intronic
1032980150 7:137272443-137272465 CTTGGCAAAGGCTTTGTTGAGGG - Intronic
1037597877 8:20369561-20369583 ATGGGCAAAGACTGGGTGGGAGG - Intergenic
1041342061 8:56856481-56856503 GTGGGAAAAGATTGTGTTGGAGG + Intergenic
1049537076 8:143187429-143187451 CTGGACAAAGACTGCATTCAGGG + Intergenic
1051285575 9:15492647-15492669 CTGTGCTAGGACTGTGTGGAAGG - Intronic
1053444540 9:38141717-38141739 CTGGGAAAAGACCGTGGTGGAGG + Intergenic
1054835436 9:69671718-69671740 CTGGAGAAAGAATGTGATGATGG - Intronic
1054953170 9:70876780-70876802 CTGGGTAAAGAATGGGTTGTGGG - Intronic
1056203273 9:84296699-84296721 CTAGGCAAAGGCTATGCTGAAGG + Intronic
1057428813 9:94976192-94976214 CTGGGCAAAGGTTCTGTGGAAGG - Intronic
1058261391 9:102837155-102837177 ATGGGCAAACTCTGTGTTGCTGG + Intergenic
1059086868 9:111312916-111312938 CTGGAAATAGACTGTGGTGATGG - Intergenic
1059889555 9:118786215-118786237 CTGAGAAAAGAGTGTGTGGAGGG - Intergenic
1061766292 9:132883664-132883686 CCTGGCAAAGAATGTGTTCATGG + Intronic
1061822941 9:133238633-133238655 CAGGGTCAAGGCTGTGTTGAGGG + Intergenic
1186023528 X:5283637-5283659 CTGGGCAAAGGGTGTCCTGAGGG + Intergenic
1186303333 X:8225942-8225964 CTGGAAAAAGACAGTTTTGATGG + Intergenic
1188215504 X:27471598-27471620 GTGGGCAAAGAATTTTTTGAGGG - Intergenic
1189236475 X:39490855-39490877 CTGGACCATGACTGTCTTGAAGG + Intergenic
1189390796 X:40574873-40574895 CTGGGGATGGACTGTGGTGATGG + Intergenic
1190356498 X:49610478-49610500 CTGGGCAAAGTGCGTGGTGAAGG + Intergenic
1194225513 X:91251858-91251880 CTGGTTGAAAACTGTGTTGATGG + Intergenic
1199799835 X:151239508-151239530 CTGTGCAAAGAATGTGAGGAAGG - Intergenic
1199858861 X:151781645-151781667 CTGAGCCAAGAGTGGGTTGAGGG - Intergenic
1200855924 Y:7938130-7938152 CAGGGCTAAGACAGTGTAGAAGG + Intergenic
1201600963 Y:15728093-15728115 CTAGTCAAAGAAAGTGTTGATGG - Intergenic