ID: 1167532154

View in Genome Browser
Species Human (GRCh38)
Location 19:50024920-50024942
Sequence CGCAGGTGGGGCGATTGCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 157}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167532154 Original CRISPR CGCAGGTGGGGCGATTGCCT AGG Intronic
900107618 1:991271-991293 CTGAGGTGGGGCGACTGCTTAGG - Intergenic
903216198 1:21844489-21844511 AGATGGTGGGGCCATTGCCTGGG - Intronic
905662003 1:39734903-39734925 CCGAGGTGGGCGGATTGCCTGGG - Intronic
907252575 1:53151113-53151135 CCGAGGTGGGTGGATTGCCTGGG + Intergenic
914350436 1:146835384-146835406 CTGAGGTGGGAGGATTGCCTGGG + Intergenic
919904150 1:202066403-202066425 CCAAGGTGGGAGGATTGCCTGGG - Intergenic
922621858 1:226994747-226994769 CCAAGGTGGTGGGATTGCCTGGG + Intronic
1064004680 10:11690475-11690497 CCCAGGTGGGATGATTGCTTGGG + Intergenic
1064746981 10:18488040-18488062 CTCAGGTGGTCCGCTTGCCTCGG + Intronic
1065464237 10:26001886-26001908 CTGAGGTGGGAGGATTGCCTGGG + Intronic
1067204491 10:44201338-44201360 CCGAGGTGGGCGGATTGCCTGGG + Intergenic
1068144208 10:53045465-53045487 CACAGGTGGGAGAATTGCCTGGG - Intergenic
1070892800 10:79954569-79954591 TGCAGGTGGGCAGGTTGCCTTGG + Intronic
1072214890 10:93279760-93279782 CCAAGGTGGGAGGATTGCCTAGG + Intergenic
1072568397 10:96637454-96637476 CTCAGGTGGGAGGATCGCCTGGG - Intronic
1073319415 10:102605406-102605428 CTGAGGTGGGAGGATTGCCTGGG + Intronic
1074826880 10:117221090-117221112 GGCAGGAGGGGCGCTTGCTTTGG - Intergenic
1076116821 10:127906959-127906981 CGCAGGTGGGGCGGGCGCCCTGG + Intergenic
1076758738 10:132589468-132589490 GACAGGAGGGGCGAGTGCCTCGG - Intronic
1077245000 11:1532487-1532509 CCCAGGTGGGGCTGTTGTCTCGG - Intergenic
1077251669 11:1563492-1563514 CGGAGGTGGGGGGACTTCCTCGG + Intronic
1077298854 11:1838131-1838153 GGCTGGGGGGGCGATGGCCTCGG + Intergenic
1077377250 11:2210840-2210862 CGCTGGTGGGGCAAGTGCCAGGG + Intergenic
1077527332 11:3075077-3075099 TGCAGGTGTGGCGATTCCCAGGG - Intergenic
1080338666 11:31231056-31231078 CTGAGGTGGGAGGATTGCCTGGG - Intronic
1095750751 12:45707947-45707969 CTGAGGTGGGAAGATTGCCTGGG + Intergenic
1101877337 12:108604438-108604460 AGCGGGTGGGGCGGGTGCCTGGG + Intergenic
1102539067 12:113605396-113605418 CCAAGGTGGGGTGATTGCTTGGG - Intergenic
1103930429 12:124447915-124447937 CTGAGGTGGGAGGATTGCCTGGG - Intronic
1105354040 13:19641727-19641749 CTCAGGTGATGCGCTTGCCTCGG + Intronic
1106544123 13:30715608-30715630 GGCAGCTGGGGCCATTTCCTGGG - Intronic
1107521206 13:41183520-41183542 CCAAGGTGGGTGGATTGCCTGGG - Intergenic
1109393292 13:61721304-61721326 CTCAGGTGGTCCGCTTGCCTCGG + Intergenic
1114070197 14:19099442-19099464 CGCCGGTGGCGCCTTTGCCTGGG + Intergenic
1114092067 14:19300560-19300582 CGCCGGTGGCGCCTTTGCCTGGG - Intergenic
1115984864 14:39094494-39094516 CCAAGGTGGGAGGATTGCCTGGG - Intronic
1116991636 14:51283592-51283614 AGTAGGTGGGGCTATTTCCTTGG + Intergenic
1121546400 14:94766892-94766914 CTCAGGGGGCGAGATTGCCTTGG - Intergenic
1121822715 14:96984374-96984396 TGCTGGTGGGGAGATGGCCTTGG + Intergenic
1122898712 14:104773233-104773255 CGCAGGTGGGGCGCACACCTCGG + Exonic
1127419534 15:58791516-58791538 CTCAGGTGGGAGGATTGCTTGGG + Intronic
1130956680 15:88631781-88631803 AGCAGGTGGGGCGCTGGCCTCGG + Exonic
1131162577 15:90117248-90117270 CTGAGGTGGGAGGATTGCCTGGG - Intergenic
1133290689 16:4718712-4718734 AGCAGGTGGCCCGATGGCCTGGG - Intronic
1137651362 16:50123218-50123240 CTGAGGTGGGAGGATTGCCTGGG + Intergenic
1137703496 16:50517571-50517593 GGCAGGTGGGGCTGGTGCCTGGG + Intergenic
1139983602 16:70880155-70880177 CTGAGGTGGGAGGATTGCCTGGG - Intronic
1140516740 16:75548633-75548655 CCCAGGTGGGTGGATTGCTTGGG + Intronic
1141423525 16:83931726-83931748 TGCACGTGGGGCGAGTGCCAGGG - Intronic
1143836017 17:9693600-9693622 CTGAGGTGGGTGGATTGCCTGGG + Intronic
1144038273 17:11386699-11386721 CTCAGGCGGGGCGCTGGCCTTGG + Intronic
1146149793 17:30457762-30457784 CTGAGGTGGGGGGATTGCTTGGG - Intronic
1146509329 17:33432280-33432302 CCCAGGTGGGAGGATTGCTTGGG + Intronic
1148128330 17:45248031-45248053 CGCACCTGGGGCGGGTGCCTGGG + Intergenic
1148562136 17:48612201-48612223 GGCAGGTGGTGCGAGTCCCTCGG - Intronic
1149830133 17:59864729-59864751 CAGAGGTGGGACGATTGCTTGGG - Intronic
1151562189 17:74876561-74876583 CCAAGGTGGGTGGATTGCCTGGG + Intergenic
1152541369 17:80978241-80978263 CCGAGGTGGGAGGATTGCCTGGG + Intergenic
1152573230 17:81129482-81129504 AGCGGGTGGGGCCATTGCCCAGG + Intronic
1152846545 17:82603471-82603493 CGCCGGTGGGGAGCTTGGCTGGG + Exonic
1154991074 18:21599237-21599259 CGGAGGTGGGAGGATTGCTTGGG + Intronic
1155322430 18:24632314-24632336 CGCAGGTGGGGAGTCTCCCTTGG + Intergenic
1162079543 19:8209840-8209862 CGCAGCTGGGGCCCTGGCCTCGG + Intronic
1165870126 19:38965873-38965895 CTGAGGTGGGCAGATTGCCTGGG - Intronic
1166753401 19:45176089-45176111 CTGAGGTGGGAGGATTGCCTGGG - Intronic
1167532154 19:50024920-50024942 CGCAGGTGGGGCGATTGCCTAGG + Intronic
926195043 2:10758485-10758507 CTGAGGTGGGAGGATTGCCTGGG + Intronic
926400018 2:12487643-12487665 CACACATGGGGCGAATGCCTGGG - Intergenic
929473546 2:42221506-42221528 CTCAGGTGGGAGGATTGCTTGGG - Intronic
932198939 2:69808893-69808915 CGGAGGTGGGCAGATTGCTTGGG - Intronic
932245603 2:70193708-70193730 CTGAGGTGGGAGGATTGCCTGGG - Intronic
932383070 2:71303602-71303624 CAGAGGTGGGGGGATTGCTTGGG - Intronic
932682238 2:73836296-73836318 AGGAGGTGAGGCGATTGCCGAGG + Intronic
933333894 2:80929473-80929495 CCGAGGTGGGCAGATTGCCTGGG + Intergenic
933696561 2:85223178-85223200 CTGAGGTGGGGGGATTGCTTGGG - Intronic
937931200 2:127206405-127206427 CTGAGGTGGGAGGATTGCCTGGG - Intronic
940635758 2:156294638-156294660 CTGAGGTGGGCGGATTGCCTGGG - Intergenic
944256301 2:197626463-197626485 CTGAGGTGGGAGGATTGCCTCGG + Intronic
944456360 2:199898954-199898976 CTGAGGTGGGAGGATTGCCTGGG + Intergenic
944889263 2:204100078-204100100 CTCAGGTGGGCCGCCTGCCTCGG + Intergenic
948023272 2:234754798-234754820 CTCAGGTGGGGTGGTTGTCTGGG - Intergenic
948152081 2:235752410-235752432 CCAAGGTGGGCAGATTGCCTGGG - Intronic
948672044 2:239574984-239575006 AGCAGGTGGGGGGTTTCCCTGGG + Intergenic
1170487603 20:16835303-16835325 CTCAGGTGGTCCGCTTGCCTCGG + Intergenic
1177908547 21:27001083-27001105 CCAAGGTGGGAGGATTGCCTGGG + Intergenic
1178930000 21:36809835-36809857 CTCAGGTGGGAGGATTGCTTGGG - Intronic
1180488667 22:15822004-15822026 CGCCGGTGGCGCCTTTGCCTGGG + Intergenic
1180980950 22:19877726-19877748 TGGAGCTGGGGCCATTGCCTGGG - Intronic
1181160177 22:20955407-20955429 CCAAGGTGGGAGGATTGCCTGGG - Intergenic
1182365564 22:29776655-29776677 CTAAGGTGGGTGGATTGCCTGGG - Intergenic
1183474762 22:38030095-38030117 TGCAGCTGGGAAGATTGCCTGGG + Intronic
1184538446 22:45103543-45103565 CTCAGGTGAGCCGACTGCCTTGG - Intergenic
950224312 3:11221317-11221339 CCGAGGTGGGTGGATTGCCTGGG + Intronic
952788523 3:37178686-37178708 CCCAGGTGGGAGGATTGCTTGGG + Intronic
953558684 3:43967464-43967486 CCTAGGTGGAGCGATTGCCCTGG - Intergenic
954561657 3:51561965-51561987 CTGAGGTGGGGGGATTGCTTGGG - Intronic
954633160 3:52057618-52057640 CGCAGGCGGCGCGCTTGCGTAGG + Intergenic
955038870 3:55295019-55295041 CTAAGGTGGGGGGATTGCTTGGG + Intergenic
955322886 3:57986875-57986897 CTGAGGCGGGGGGATTGCCTGGG - Intergenic
958068734 3:88580960-88580982 CATAGGTGGGACAATTGCCTTGG + Intergenic
961450861 3:127001720-127001742 CGCAGGTGCGGTGATTGCTGTGG + Intronic
962216141 3:133523530-133523552 CCAAGGTGGGTGGATTGCCTGGG + Intergenic
965703830 3:171485833-171485855 CCAAGGTGGGGGGATTGCTTGGG - Intergenic
968916348 4:3498598-3498620 GGCAGGTGGGGTGAGGGCCTGGG - Intronic
970203430 4:13632417-13632439 CCGAGGTGGGCGGATTGCCTGGG - Intergenic
970249794 4:14102309-14102331 GGCACGTGGGGGGATTGCCAGGG - Intergenic
972086602 4:35225055-35225077 GGAAGGTGGGAGGATTGCCTGGG - Intergenic
972563058 4:40245900-40245922 CTCTGGTGGGAGGATTGCCTCGG + Exonic
979596567 4:122541496-122541518 CGAGGGTGGGGCGTTTGCCAGGG - Intergenic
981313786 4:143322076-143322098 CTCAGGTGGGAAGATTGCTTAGG - Intergenic
981700514 4:147602622-147602644 CTGAGGTGGGGGGATTGCTTGGG - Intergenic
981968888 4:150640088-150640110 CCAAGGCGGGTCGATTGCCTAGG - Intronic
982358322 4:154492105-154492127 CGCAGGCGGGGCGTCTGCCTGGG + Intergenic
984995560 4:185426796-185426818 CGCAGGTGATGCGTCTGCCTTGG - Intronic
985008979 4:185562917-185562939 CTGAGGTGGGAGGATTGCCTGGG + Intergenic
985228993 4:187794784-187794806 CTCAGGTGAGTGGATTGCCTGGG - Intergenic
985965162 5:3333901-3333923 CGCTGGTGGGGGGATGGACTTGG + Intergenic
992641941 5:78775289-78775311 CTGAGGTGGGAGGATTGCCTGGG - Intergenic
994004286 5:94819362-94819384 CTCAGGTGATCCGATTGCCTCGG + Intronic
994992867 5:107019610-107019632 CTGAGGTGGGAGGATTGCCTGGG + Intergenic
995049402 5:107685030-107685052 CTCAGGTGATGCGCTTGCCTTGG + Intergenic
997265240 5:132491177-132491199 CGCAGGTGAGGGGATCGCCCGGG + Intergenic
1001576858 5:172770491-172770513 TGCAGGTGGGGCGATCCCCCGGG + Intronic
1002061819 5:176629871-176629893 CGCGGGAGGGGCCACTGCCTCGG + Exonic
1002629256 5:180558875-180558897 CTGAGGTGGGGGGATTGCTTGGG - Intronic
1003472426 6:6449695-6449717 CTCAGGTGGTCCGCTTGCCTCGG + Intergenic
1006108870 6:31732774-31732796 CTCAGGTGGTGCGCTAGCCTCGG + Intronic
1007651654 6:43426228-43426250 CTCAGGTGATGCGCTTGCCTTGG - Intergenic
1014864909 6:126517253-126517275 CTCAGGTGGGTGGATTACCTGGG - Intergenic
1019333741 7:472967-472989 CTGAGGTGGGAAGATTGCCTGGG - Intergenic
1021868406 7:24980329-24980351 AGGAGGTGGGGCGATGTCCTCGG + Intronic
1023907349 7:44531988-44532010 TGGAGGTGGGGAGGTTGCCTAGG - Intronic
1025284741 7:57652286-57652308 CATGGGTGGGGGGATTGCCTAGG - Intergenic
1026611409 7:71863158-71863180 CTGAGGTGGGGAGATTGCTTGGG + Intronic
1026738959 7:72966546-72966568 AGAAGGTGGGGAGCTTGCCTAGG - Intronic
1026789974 7:73325179-73325201 AGAAGGTGGGGAGCTTGCCTAGG - Intronic
1026822132 7:73557133-73557155 CGCAGGCGGGGCCACTGCCCAGG + Intronic
1026963203 7:74422986-74423008 CTGAGGTGGGAAGATTGCCTGGG - Intergenic
1027104774 7:75398527-75398549 AGAAGGTGGGGAGCTTGCCTAGG + Intronic
1028269313 7:88768482-88768504 CCCAGGTGGGCAGATTGCCTGGG + Intronic
1028305205 7:89254877-89254899 CCAAGGTGGGTGGATTGCCTGGG - Intronic
1029439381 7:100578632-100578654 CCCAGGTGAGGCGGGTGCCTGGG - Exonic
1031902771 7:127428884-127428906 CACAGATGGGGAGATTCCCTCGG - Intronic
1033096215 7:138433724-138433746 CTCAGGTGGAAGGATTGCCTGGG + Intergenic
1035581835 8:744982-745004 GGCAGGTGTGGGGATGGCCTGGG - Intergenic
1039462948 8:37761502-37761524 CGGAGGTGGGAGGATTGCTTGGG + Intergenic
1040501729 8:48010962-48010984 CCAAGGTGGGCGGATTGCCTGGG - Intronic
1041552414 8:59118045-59118067 CGGAGGTGGGGCGCTGGCCTGGG - Intronic
1041658756 8:60380136-60380158 CTGAGGTGGGAGGATTGCCTGGG - Intergenic
1042895604 8:73664148-73664170 CTGAGGTGGGAGGATTGCCTGGG - Intronic
1042930186 8:74005716-74005738 CGCAGGTGGGGTGATAGCATGGG + Intronic
1049725050 8:144141936-144141958 CACAGGTCGGCCCATTGCCTGGG + Intergenic
1056963583 9:91147507-91147529 CTCAGGAGGGGCCTTTGCCTGGG - Intergenic
1059876785 9:118644172-118644194 GGTAGGTGGGAAGATTGCCTTGG - Intergenic
1061133008 9:128718706-128718728 CGCAGGTGAGGAGATTTCCTGGG - Intronic
1061561988 9:131410439-131410461 GGCAGGTGGGGCCATTCTCTGGG + Intronic
1062525079 9:136974913-136974935 CGCAGGCAGGGGGATGGCCTTGG + Intergenic
1186229354 X:7436795-7436817 CTGAGGTGGGATGATTGCCTGGG - Intergenic
1186367350 X:8909625-8909647 CTGAGGCGGGACGATTGCCTGGG - Intergenic
1186456452 X:9713659-9713681 CCGAGGTGGGTAGATTGCCTGGG - Intronic
1188148216 X:26640495-26640517 CTGAGGTGGGCAGATTGCCTAGG - Intergenic
1188590154 X:31823671-31823693 CTGAGGTGGGAGGATTGCCTAGG - Intronic
1194496787 X:94625801-94625823 CCGAGGTGGGTGGATTGCCTGGG + Intergenic
1196219430 X:113094890-113094912 CTAAGGTGGGGGGATTGCTTGGG + Intergenic