ID: 1167533746

View in Genome Browser
Species Human (GRCh38)
Location 19:50035764-50035786
Sequence CAGGCTGAGCATTAGAGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 226}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167533743_1167533746 -4 Left 1167533743 19:50035745-50035767 CCTTATTTTAGAGAAGAGGCAGG 0: 1
1: 0
2: 7
3: 57
4: 461
Right 1167533746 19:50035764-50035786 CAGGCTGAGCATTAGAGAGGTGG 0: 1
1: 0
2: 1
3: 20
4: 226
1167533741_1167533746 6 Left 1167533741 19:50035735-50035757 CCTATAGCAGCCTTATTTTAGAG 0: 1
1: 0
2: 0
3: 9
4: 127
Right 1167533746 19:50035764-50035786 CAGGCTGAGCATTAGAGAGGTGG 0: 1
1: 0
2: 1
3: 20
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167533746 Original CRISPR CAGGCTGAGCATTAGAGAGG TGG Intronic
900297195 1:1957729-1957751 CAGGCTGAGCAGGAGGGAGCCGG + Intronic
900695224 1:4005533-4005555 CAGGCTGGGCATGAGGGAGGGGG + Intergenic
902626242 1:17678068-17678090 AAGACTGAGCCATAGAGAGGGGG - Intronic
903904727 1:26676580-26676602 CAGGCTGATCATTTGAGATCAGG - Intergenic
904166717 1:28561222-28561244 AAAGCTGAGGCTTAGAGAGGGGG + Intronic
904526514 1:31137659-31137681 GAGGCTGATCACTTGAGAGGAGG + Intergenic
904732789 1:32607252-32607274 CAGGTTGAGCATGCTAGAGGTGG - Intronic
904927047 1:34057553-34057575 AAGGCTGAGCCAGAGAGAGGTGG + Intronic
905268308 1:36770187-36770209 CAGGATGGGAAATAGAGAGGAGG - Intergenic
905797396 1:40823361-40823383 AAGGCTGGGCATTCGAGAGTGGG + Intronic
907314715 1:53560921-53560943 CAGGCAGAGCTCCAGAGAGGAGG + Intronic
907579464 1:55558576-55558598 CACTCTGAGCAATAGAGATGTGG - Intergenic
908473675 1:64469575-64469597 AAGACTGAGGCTTAGAGAGGTGG - Intergenic
909380834 1:74996621-74996643 CAGACTGAGCATTGCAGAGCAGG + Intergenic
910042807 1:82873945-82873967 AAGGCTTAGCAGGAGAGAGGAGG + Intergenic
910452312 1:87359829-87359851 AAGGCAGAGCATTATATAGGAGG + Intergenic
910771530 1:90836291-90836313 CTGGCTGATCATCTGAGAGGAGG - Intergenic
912209545 1:107543425-107543447 CAGGCGGATCATTTGAGATGAGG + Intergenic
912567880 1:110601471-110601493 CAGGATGAACTGTAGAGAGGAGG + Intronic
913488155 1:119352826-119352848 AAGGGTGAGCAATGGAGAGGAGG + Intergenic
915107952 1:153546052-153546074 CAGCCTGAGTTTTAGAGAGGTGG + Intronic
915252226 1:154598729-154598751 CAGGCTGAGCCTTAAGGAGTAGG - Intronic
916346744 1:163800835-163800857 CAGGATGGGCAGTAGAGAGCTGG - Intergenic
918222803 1:182451270-182451292 CAGACTGAGCGTGTGAGAGGAGG - Intronic
919766218 1:201129011-201129033 GAGGCTGAGGCTCAGAGAGGAGG + Intergenic
922730204 1:227945587-227945609 CAGGCAGAGCTTTTGAGAGGGGG + Intronic
924057650 1:240139719-240139741 CAGGCTGAGGTTTGGAGACGAGG + Intronic
1064292829 10:14051322-14051344 CAGGATGAACATTAGAGATACGG - Intronic
1064648564 10:17485021-17485043 CAGGCTGGGCAACAGAGAGATGG + Intergenic
1070974721 10:80597283-80597305 CAGGCTGAGATTTTGAGGGGAGG - Intronic
1072661436 10:97366147-97366169 CCGGCTGATCATAAGGGAGGAGG - Exonic
1072787951 10:98296920-98296942 CAGGCAGAGAATCAGAGAGCTGG - Intergenic
1072797568 10:98367647-98367669 CAGACTGAGGCTCAGAGAGGAGG - Intergenic
1072805879 10:98423884-98423906 CAGCCTGAGCACGAGAGAGGAGG + Exonic
1072818211 10:98530622-98530644 CAGTCTCTGCATTAGAGAGGTGG + Intronic
1073381832 10:103083852-103083874 CAGGCTTAGCATAGCAGAGGAGG - Exonic
1073629839 10:105137270-105137292 CAGGGTGACCTATAGAGAGGTGG + Intronic
1075257835 10:120939459-120939481 CAGACGGAGCCTTAGAGGGGAGG - Intergenic
1075336832 10:121614821-121614843 GAAGCTGAGCATGAGATAGGAGG - Intergenic
1075663325 10:124213419-124213441 GAGGGTGAGCTTTGGAGAGGGGG + Intergenic
1077376063 11:2205566-2205588 GAGGCTGGGCAGTAGGGAGGTGG - Intergenic
1077483405 11:2827091-2827113 CAGGCTGGGCTGCAGAGAGGAGG + Intronic
1077523110 11:3047963-3047985 CATTCTGAGCATTAGTGACGAGG - Exonic
1077994823 11:7444125-7444147 CACCCTGAGGATTAGAGAGCAGG - Intronic
1078487991 11:11741746-11741768 CTTGCTGAGCATTGGTGAGGTGG - Intergenic
1079573262 11:21970785-21970807 CAGGCTGAGACTAAGAGGGGTGG + Intergenic
1079975794 11:27090263-27090285 CTGGCTGAGAAATAGAGAGACGG + Intronic
1081346216 11:41989855-41989877 CAGTCTGATAATTAGTGAGGAGG - Intergenic
1081989438 11:47329832-47329854 CTGCCTGAGCATCAGGGAGGGGG + Exonic
1083624872 11:64067298-64067320 GAGGCTGAGCAGTGGGGAGGAGG - Intronic
1083844025 11:65320820-65320842 CTGGCTGAGGGTTGGAGAGGAGG + Exonic
1085252154 11:75151000-75151022 GAGGCTGAGCCTCAGGGAGGCGG + Exonic
1085702242 11:78755647-78755669 CAGGCTGAGGAGCAGAGAGCAGG - Intronic
1088616207 11:111631443-111631465 CAGGTTGAGGATTAGAATGGTGG + Intronic
1089767163 11:120776367-120776389 CCTGCTGGGCATTGGAGAGGAGG + Intronic
1089789466 11:120932319-120932341 TACACTGAGCATTAGAGAGGAGG + Intronic
1090785180 11:130042360-130042382 GAGGCTAAGCGTGAGAGAGGCGG + Intergenic
1091415339 12:278005-278027 CAGGCTGAGTATTTGACAAGAGG + Intergenic
1091757088 12:3060851-3060873 AAGGCTGAGCACTTGAGATGAGG - Intergenic
1091978955 12:4850282-4850304 CAGGCTGAGGGTCCGAGAGGGGG + Intronic
1095114078 12:38331409-38331431 AAAGCTTAGCATTAGGGAGGTGG - Intergenic
1095723848 12:45430729-45430751 TAGGCTGAGCAAAAGTGAGGGGG - Exonic
1096530471 12:52239524-52239546 CAGGCTAAGGATTCGGGAGGAGG + Intronic
1097396369 12:59079962-59079984 TAGGGTGTGCATTTGAGAGGTGG + Intergenic
1097637644 12:62142244-62142266 CAGGCAGAGCATTAGGGGTGTGG - Intronic
1099435700 12:82642640-82642662 GAGGCAGAGCATTAGGTAGGGGG + Intergenic
1100883690 12:99045925-99045947 CAGGCAGAGTATTAGAGAGCAGG + Intronic
1101232446 12:102755268-102755290 CAGGGTGAGAAGTGGAGAGGTGG - Intergenic
1102122771 12:110455353-110455375 CAGGCTGATCATTTGAGATCAGG - Intronic
1102861310 12:116338759-116338781 AAGGCCGAGCAGCAGAGAGGTGG + Intergenic
1103419225 12:120766740-120766762 CAAGCTGAGGCTCAGAGAGGTGG - Intronic
1103931554 12:124453411-124453433 GAGGCTGAGCAAGAGAGAGCTGG - Intronic
1104762001 12:131302554-131302576 CTGGCTGATTATTAGTGAGGGGG - Intergenic
1104817774 12:131658230-131658252 CTGGCTGATTATTAGTGAGGGGG + Intergenic
1105527382 13:21188444-21188466 CAGGCAGGGCATTTGAAAGGAGG - Intergenic
1107456364 13:40559508-40559530 CAGGCTGAGGGTTAGTGAGCAGG - Exonic
1108945393 13:56016975-56016997 CAGGGTGAGGCTGAGAGAGGAGG - Intergenic
1109133035 13:58612043-58612065 TTGGCTGAGCATAAGAAAGGTGG + Intergenic
1110686974 13:78386886-78386908 CAAGCTGAGCTTTCAAGAGGAGG - Intergenic
1113281332 13:108791630-108791652 CTGGATGAGCAATAGAGAAGAGG - Intronic
1113645689 13:111993766-111993788 CCAGCTGATCATTAGAAAGGTGG - Intergenic
1115728483 14:36242653-36242675 CAGCCAGTGCATGAGAGAGGTGG + Intergenic
1117402796 14:55372728-55372750 CAGGCTGAGCCTTGGAGGGAGGG - Intronic
1117488887 14:56226308-56226330 GAGGCTGATCATCAGTGAGGTGG - Intronic
1119264476 14:73255893-73255915 CAAACTGAGAATCAGAGAGGTGG - Intronic
1119435038 14:74592972-74592994 TTCACTGAGCATTAGAGAGGTGG + Intronic
1120606411 14:86583882-86583904 CAGGCTGACCTTTAGGGTGGAGG + Intergenic
1120853090 14:89188253-89188275 CAGTCTGAGTATTACAGAGTTGG + Intronic
1122188224 14:100018534-100018556 CTGGCTGAGTTTTAGAGAAGGGG - Intronic
1122762171 14:104037310-104037332 GCGGGTGCGCATTAGAGAGGTGG - Intronic
1124097611 15:26663208-26663230 CAGGGTTGGGATTAGAGAGGAGG - Intronic
1126465865 15:48961445-48961467 CAGGCTGGGCCTTATGGAGGAGG - Intronic
1127396152 15:58545520-58545542 CAGGCTGGGCATTAGCTAGCGGG - Intronic
1127975050 15:63990934-63990956 CAGGCAGAGGAGTAGGGAGGGGG - Intronic
1128962794 15:72025575-72025597 CAGGCAGATCATTTGAGATGAGG - Intronic
1129083959 15:73068522-73068544 CATGTTGAGGATTAGAGATGAGG - Intronic
1129540599 15:76344221-76344243 CTGGCTGGCCATTAGATAGGGGG + Intergenic
1129888233 15:79053498-79053520 CAAACTGAGCATTCTAGAGGAGG + Intronic
1132835172 16:1949606-1949628 CAGGCTGTGCAATGTAGAGGTGG + Intronic
1133361943 16:5181008-5181030 GAGGATGAGTAGTAGAGAGGAGG + Intergenic
1136173800 16:28504040-28504062 CAGGCTGAGCCCTGGAGAGATGG + Exonic
1136401526 16:30021776-30021798 CCGGCTGAGCACTAAGGAGGGGG + Intronic
1139208020 16:65047877-65047899 CAGGCGGAGCTTCAGTGAGGAGG - Intronic
1141382070 16:83585672-83585694 AAGGCTGACCATTAGAGACTCGG + Intronic
1141496500 16:84414098-84414120 CAGGCTGACATTTAGAGAGGAGG + Intronic
1141611523 16:85183762-85183784 CAGGCTGAGGCTCAGAGAGGTGG + Intronic
1142079458 16:88141394-88141416 CAGGCTGAGCATTTCATAGCAGG - Intergenic
1142359733 16:89620365-89620387 CAGGTTGAGAAATGGAGAGGAGG - Intronic
1146924773 17:36736555-36736577 CAGGGTGAGAATGAGAAAGGAGG + Intergenic
1146961619 17:36985295-36985317 CAGCCTGAGCAATAGAGTGAAGG - Intronic
1146990531 17:37266983-37267005 TAGGCTGAACATTGGTGAGGAGG - Intronic
1147441729 17:40451673-40451695 AAGCCTGAGCATTTCAGAGGTGG + Intronic
1147464172 17:40597943-40597965 CAGGCTGGGGAGTAGAGAAGGGG + Intergenic
1148022071 17:44559863-44559885 CAGGCCCAGCGTCAGAGAGGAGG - Intergenic
1149333517 17:55610232-55610254 CAGGCTGAGCATTAATCAGCAGG + Intergenic
1149992652 17:61391502-61391524 CAGGCAGGGCAGGAGAGAGGTGG + Intronic
1151331422 17:73411488-73411510 GAGGCAGAGCATTTGAGGGGAGG - Intronic
1151517208 17:74604324-74604346 CAGGCTGAGCTCCAGAGAGCAGG + Intergenic
1152077371 17:78168138-78168160 CAGGCTTAGCCCCAGAGAGGAGG + Intergenic
1153046606 18:860995-861017 CAGGGTGAGCATTACAGAGGAGG - Intergenic
1157190915 18:45580945-45580967 CAGGCTGAGCAGGAGGCAGGAGG + Intronic
1157491469 18:48126781-48126803 AAGGCTGAGCATTTGTGTGGAGG + Intronic
1158568626 18:58577199-58577221 CAAGCTGAGGATGACAGAGGGGG + Intronic
1158867191 18:61649183-61649205 CAGGCAGAGCATGACAGAGGAGG - Intergenic
1159992740 18:74929095-74929117 CAGGATGAGCATGAGTGAGCCGG - Intronic
1160247836 18:77173856-77173878 TTGGCTCAGCATTACAGAGGAGG + Intergenic
1160839653 19:1140458-1140480 AAGGCTGAGCAGAAGTGAGGGGG + Intronic
1161994493 19:7703933-7703955 GCCGCTGAGCATTGGAGAGGTGG - Intergenic
1162569226 19:11461350-11461372 CCCACTGAGCATTTGAGAGGTGG - Intronic
1163983322 19:20922226-20922248 CAGCCTGAACATTAGAGTCGAGG + Intergenic
1165892244 19:39120344-39120366 CAGGCAGATCATTTGAGATGAGG - Intergenic
1167533746 19:50035764-50035786 CAGGCTGAGCATTAGAGAGGTGG + Intronic
1167765850 19:51481740-51481762 CAGGCTGAGCTGGAGAGAGGGGG + Intronic
1168681931 19:58322314-58322336 CAGTCTGACCACTAGAGGGGTGG - Intergenic
926372973 2:12198987-12199009 CAGGCTGTGCTTTAGAGGGAAGG - Intergenic
927703833 2:25285183-25285205 CAGGCTGTGCACTTGAGTGGTGG - Intronic
927944655 2:27128336-27128358 CAGGCTGGGCTCTGGAGAGGGGG + Intronic
928986583 2:37188317-37188339 CTGTCTGAGCATCAGTGAGGAGG - Intronic
929451723 2:42042487-42042509 GGGGCTGAGGACTAGAGAGGGGG - Intergenic
929954441 2:46444590-46444612 CAAGCTGAGCTGCAGAGAGGAGG - Intronic
929954872 2:46449374-46449396 CAGGCTGTGGATTAGGAAGGGGG - Intronic
929983045 2:46699077-46699099 CAGGCAGGGCTTTAGAGGGGCGG - Exonic
931749229 2:65316426-65316448 GAAGCTGAGGCTTAGAGAGGTGG - Intronic
932086977 2:68771298-68771320 CAGGCGGAGGGTTGGAGAGGGGG - Intronic
937473148 2:122190689-122190711 CATGCTTAGCATAAGACAGGTGG + Intergenic
937980615 2:127612484-127612506 CCAGCTGAACATTGGAGAGGAGG + Exonic
938315720 2:130326551-130326573 CAGGCAGAGCATTAGAATAGAGG - Intergenic
938377621 2:130819171-130819193 CAGGCTTAGAACTAGAGTGGGGG - Intergenic
938775373 2:134537106-134537128 CAGTCTGGGTATTAGAGATGTGG - Intronic
940290541 2:152074145-152074167 CAGGCTGAGCAACAGAGGTGAGG + Intronic
940856169 2:158730292-158730314 CAGGCAGAGAAGTAGAGAGAGGG + Intergenic
941333273 2:164207419-164207441 CAGCCAGTGCATTAGTGAGGAGG + Intergenic
942219880 2:173758565-173758587 CAGCCCCAGCATTTGAGAGGAGG + Intergenic
945884015 2:215355520-215355542 TAGGCTGGGCTTTAGAAAGGTGG - Intergenic
946412438 2:219522090-219522112 CATGGTGAGCATTTGAGGGGTGG - Intronic
1168796250 20:611803-611825 CAGGCTGGGCTTTGGGGAGGAGG + Intergenic
1168986478 20:2053282-2053304 AAGGCTGAGTATCAGAGAGGTGG - Intergenic
1169286630 20:4313630-4313652 CAAGCTGAGGATGAGATAGGAGG - Intergenic
1169468163 20:5859644-5859666 CAGCCTTATGATTAGAGAGGAGG + Intronic
1169675818 20:8153439-8153461 CAGCCTGAGTACTTGAGAGGTGG + Intronic
1172355404 20:34276456-34276478 CAGGGAGAGAAATAGAGAGGTGG - Intergenic
1172420314 20:34811001-34811023 TAGGCTGAGCATTGCAGAGTGGG + Intronic
1172644084 20:36459087-36459109 CAGGCTGGGGATTAGGGAGGGGG + Intronic
1174114623 20:48218408-48218430 CAGGGTGAGCTTCACAGAGGAGG - Intergenic
1175178281 20:57126947-57126969 CAGGCTGGGCAGGAGAGAGGAGG + Intergenic
1178584138 21:33858798-33858820 CAGGCTGGGGATTAGAGGAGAGG - Intronic
1180110668 21:45647505-45647527 CAGGGAAAGCTTTAGAGAGGAGG + Intronic
1182725804 22:32444420-32444442 CGAGCTGAGCACTAGAGAGATGG + Intronic
1183509652 22:38227364-38227386 GGGGCTGCGCACTAGAGAGGTGG + Intronic
1183659763 22:39212379-39212401 CAGGCTGAACAACAGAGAGTTGG + Intergenic
1183897807 22:40983178-40983200 CAGGCTGAGAAGCAGAGAGATGG + Intergenic
1184296638 22:43529260-43529282 AAGGCTGATGATCAGAGAGGTGG + Intronic
1184651543 22:45921469-45921491 CAGGCTGGGCAGGAGAAAGGTGG + Exonic
951803478 3:26622761-26622783 CAGGCTGGGAATGAGGGAGGAGG - Intergenic
951882573 3:27493530-27493552 CAGGCAGATCACTAGAGATGAGG - Intergenic
953169012 3:40490588-40490610 CAGGCTGAGAAGGGGAGAGGAGG - Intergenic
953371026 3:42388585-42388607 GATGCTCAGCACTAGAGAGGCGG + Intergenic
958877739 3:99635050-99635072 GAGGCTGAGAAATGGAGAGGAGG - Intergenic
960435925 3:117626547-117626569 CACACTTAGGATTAGAGAGGAGG - Intergenic
960485722 3:118250514-118250536 CAGGCAGATCATTTGAGATGAGG - Intergenic
962752748 3:138445842-138445864 AAAGCTGAGGCTTAGAGAGGTGG + Intronic
965743419 3:171900479-171900501 CAGGCTGAGCTTGAGAAAGGCGG + Intronic
968534857 4:1118123-1118145 AAGGATGAGCATTAGAAAAGTGG + Intergenic
968932220 4:3587176-3587198 CAGGCAGAGAATTTGAGACGTGG + Intronic
969053773 4:4389171-4389193 CAGACTGAGGACAAGAGAGGAGG - Intronic
969244147 4:5921650-5921672 CAGGCAGAGCTGGAGAGAGGAGG + Intronic
969517275 4:7654707-7654729 CAGGCTGAGCAGTGGAAGGGGGG - Intronic
970465971 4:16323449-16323471 CAAGCTGAGTGGTAGAGAGGAGG - Intergenic
970465984 4:16323569-16323591 CAAGCTGAGTGGTAGAGAGGAGG - Intergenic
970465997 4:16323689-16323711 CAAGCTGAGTGGTAGAGAGGAGG - Intergenic
971426287 4:26519141-26519163 CATGCTGAGCATTTGATAGACGG + Intergenic
974631627 4:64497723-64497745 CAAGCTGTGCATTGGAAAGGAGG + Intergenic
975281659 4:72569034-72569056 CAGGCTAAGCCTGGGAGAGGGGG + Intergenic
976593952 4:86876440-86876462 CAGGCTGCGCAAAGGAGAGGGGG + Intronic
976830368 4:89307977-89307999 CAGCCTGAGCATCCGAGAGAGGG + Exonic
977123186 4:93130101-93130123 CAGGTTGAGAATTAGACAGGCGG + Intronic
981020454 4:140022122-140022144 GAGTGTGAGCATGAGAGAGGAGG + Intronic
982573869 4:157083512-157083534 AAGGTTGAGCATTACACAGGCGG + Intronic
984175021 4:176406832-176406854 CTGGGAGAGCATTATAGAGGTGG - Intergenic
984252446 4:177350344-177350366 CTAGCTGTGCATTAGAGAGTAGG + Intronic
984374622 4:178911834-178911856 CAGGCAGAACATCAGACAGGGGG + Intergenic
986350075 5:6868985-6869007 CAGGCTCAGCATCACAGGGGAGG + Intergenic
987302003 5:16605588-16605610 AAGGCCAAGCATTAGAGAGAGGG + Intronic
994042695 5:95276113-95276135 TAAGCTCAGCATTAGACAGGAGG + Intronic
995931844 5:117455563-117455585 CAGGCACAGTAGTAGAGAGGAGG - Intergenic
996005877 5:118420126-118420148 GAGACTGAGCAGTACAGAGGAGG + Intergenic
996102965 5:119463896-119463918 CAGGCGGATCATTTGAGATGAGG - Intronic
998549445 5:143063320-143063342 CAGCCAGAGCAATAGGGAGGAGG - Intronic
999267610 5:150277055-150277077 CATGCTCAGCAGTAGAGATGGGG - Intronic
999270931 5:150296034-150296056 CAGGCTGAGTGGTAGCGAGGAGG - Intergenic
1000621465 5:163491346-163491368 AAAGGTGAGCATTAGGGAGGAGG - Exonic
1001017672 5:168156128-168156150 CAGGCTGAGGCTCAGAGAGGTGG + Intronic
1006375602 6:33670113-33670135 CTGGCTGAGCCTTAGCCAGGAGG + Intronic
1006928792 6:37674826-37674848 CAGGCGGATCATTAGAGATCAGG + Intronic
1011570373 6:88728338-88728360 CAGACTGGGCATTAGAGAATTGG + Intronic
1012929458 6:105301827-105301849 ATGGCTGAGCCTTAGAGAGCTGG - Intronic
1013183195 6:107735259-107735281 CAAGCTGAGCATTGGAAAGGAGG - Intronic
1018615599 6:165683706-165683728 CAGGCTGAGCCTCACACAGGAGG + Intronic
1019056196 6:169225246-169225268 CAGGCTGACCATGACAGAGACGG - Exonic
1020544376 7:9505402-9505424 CAATCTAAGCATTAGAAAGGAGG - Intergenic
1022522609 7:31017724-31017746 CAGGCTGGGCATGTGAGACGTGG - Intergenic
1024012746 7:45283950-45283972 CAGGCGGATCATTTGAGATGGGG + Intergenic
1025947973 7:66119304-66119326 CAGGGTGAGGGATAGAGAGGGGG - Intronic
1026091734 7:67306098-67306120 AAGGCTGGGAATTAGAAAGGGGG - Intergenic
1026465612 7:70651296-70651318 GAGGCTGAGCACCAGAGAGGGGG - Intronic
1027219993 7:76207846-76207868 CAGCCTGAGCAACAGAGCGGGGG + Intronic
1029377206 7:100186311-100186333 AAGGCTGGGAATTAGAAAGGGGG - Intronic
1031921085 7:127601021-127601043 GAGCCTGAGCATTTGGGAGGAGG - Intronic
1032417358 7:131746592-131746614 TATGTTGAGCATTATAGAGGAGG + Intergenic
1035864402 8:3067037-3067059 CAGGCTGAGCGAAAGAGATGAGG - Intronic
1036761841 8:11514762-11514784 CTGGCTGAGCATCAGAATGGGGG + Intronic
1038227548 8:25670780-25670802 CTGGCTGGGAATTAGAGAGGAGG + Intergenic
1038307082 8:26414565-26414587 GAGGGTGAGCCTTAGAAAGGTGG + Intronic
1049475981 8:142797196-142797218 TAGGCTGGGCATGGGAGAGGGGG + Intergenic
1053011890 9:34638174-34638196 CAGGGTGGGCATTCCAGAGGCGG + Intronic
1053421937 9:37985199-37985221 CAGGCTGAGCATAAAAGATCAGG - Intronic
1055397228 9:75888907-75888929 CAGGCAGAGCATTTGAGATCAGG + Intergenic
1057449084 9:95140577-95140599 CTGTCTGAGCAGTAGAGGGGAGG + Intronic
1059618532 9:115977464-115977486 CAGGTTGAGCCACAGAGAGGGGG + Intergenic
1059667594 9:116463426-116463448 AAGGCTGAGAAGTTGAGAGGAGG - Intronic
1059959394 9:119550459-119550481 GAGGCTTAGAATTTGAGAGGTGG + Intergenic
1061305972 9:129733635-129733657 CAGGCTGATCATTTGAGACCAGG - Intergenic
1061817972 9:133207636-133207658 GAAGCTGAGGATTAGAGATGGGG - Intronic
1185569832 X:1126504-1126526 CAGGCTGAGATCTAGAGTGGTGG + Intergenic
1189914290 X:45841614-45841636 GGGGCTGAGGATTTGAGAGGAGG + Intergenic
1191131036 X:57011146-57011168 CAGGCAGAGCACTTGAGATGAGG - Intergenic
1192024044 X:67429207-67429229 CAGCATGAGCAAGAGAGAGGTGG + Intergenic
1198632954 X:138662428-138662450 CATGCTGAGCATTAAAGTGATGG - Intronic