ID: 1167534474

View in Genome Browser
Species Human (GRCh38)
Location 19:50041027-50041049
Sequence GTAACATAATAAAAGTGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 166}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167534474_1167534484 20 Left 1167534474 19:50041027-50041049 CCAGCACACTTTTATTATGTTAC 0: 1
1: 0
2: 0
3: 14
4: 166
Right 1167534484 19:50041070-50041092 CCAAATGCATGTGGCTGGGCTGG 0: 1
1: 0
2: 2
3: 22
4: 233
1167534474_1167534480 11 Left 1167534474 19:50041027-50041049 CCAGCACACTTTTATTATGTTAC 0: 1
1: 0
2: 0
3: 14
4: 166
Right 1167534480 19:50041061-50041083 CCAGGAGTTCCAAATGCATGTGG 0: 1
1: 0
2: 1
3: 10
4: 194
1167534474_1167534482 16 Left 1167534474 19:50041027-50041049 CCAGCACACTTTTATTATGTTAC 0: 1
1: 0
2: 0
3: 14
4: 166
Right 1167534482 19:50041066-50041088 AGTTCCAAATGCATGTGGCTGGG 0: 1
1: 0
2: 1
3: 14
4: 202
1167534474_1167534477 -7 Left 1167534474 19:50041027-50041049 CCAGCACACTTTTATTATGTTAC 0: 1
1: 0
2: 0
3: 14
4: 166
Right 1167534477 19:50041043-50041065 ATGTTACAGTCCTGGAGGCCAGG 0: 1
1: 0
2: 2
3: 61
4: 775
1167534474_1167534486 28 Left 1167534474 19:50041027-50041049 CCAGCACACTTTTATTATGTTAC 0: 1
1: 0
2: 0
3: 14
4: 166
Right 1167534486 19:50041078-50041100 ATGTGGCTGGGCTGGAGGCGAGG 0: 1
1: 0
2: 0
3: 49
4: 482
1167534474_1167534481 15 Left 1167534474 19:50041027-50041049 CCAGCACACTTTTATTATGTTAC 0: 1
1: 0
2: 0
3: 14
4: 166
Right 1167534481 19:50041065-50041087 GAGTTCCAAATGCATGTGGCTGG 0: 1
1: 0
2: 3
3: 7
4: 168
1167534474_1167534485 23 Left 1167534474 19:50041027-50041049 CCAGCACACTTTTATTATGTTAC 0: 1
1: 0
2: 0
3: 14
4: 166
Right 1167534485 19:50041073-50041095 AATGCATGTGGCTGGGCTGGAGG 0: 1
1: 0
2: 2
3: 34
4: 368

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167534474 Original CRISPR GTAACATAATAAAAGTGTGC TGG (reversed) Intronic
904353772 1:29925387-29925409 GAGACATAATAAACGTTTGCTGG + Intergenic
906456028 1:45997768-45997790 GGAACAAAAGAAAAGTGAGCAGG - Exonic
907190912 1:52647921-52647943 GTATCATATTAAAAGTGAGAAGG + Intronic
911056658 1:93714281-93714303 GTTCCATAATAAAAGTATGATGG - Intronic
915609554 1:156980339-156980361 GTATCAAGATGAAAGTGTGCAGG + Intronic
915639947 1:157216999-157217021 GTTACATAATAAAAGTAAGATGG + Intergenic
916747635 1:167696877-167696899 TTCACAAAATAAAAGTCTGCAGG + Intronic
917249311 1:173040223-173040245 GAAAAAAAAAAAAAGTGTGCTGG + Exonic
921442504 1:215204231-215204253 TTAAAAAAATAAAAATGTGCAGG + Intronic
1065984911 10:30940158-30940180 GTAATAAATTAAGAGTGTGCTGG - Intronic
1066403621 10:35098628-35098650 GTAACTTAATAAAAATAAGCAGG + Intergenic
1066545949 10:36500970-36500992 GCAACATAAGAAAAGTGTTCAGG + Intergenic
1070038651 10:72752955-72752977 ATAACATCATAACAGTCTGCTGG + Intronic
1070938155 10:80317626-80317648 GTAACATAATAAAAGTCATCAGG - Intergenic
1073773909 10:106765297-106765319 GTAGCATAATGACAGTGTGGAGG - Intronic
1075184859 10:120246605-120246627 GTAATATATTAATAATGTGCTGG - Intergenic
1075801488 10:125157341-125157363 GTACCTTAATAAGAGTCTGCAGG - Intronic
1076083231 10:127602532-127602554 ATAAGATTAGAAAAGTGTGCTGG + Intergenic
1080654013 11:34244400-34244422 GTCACATGCTAAAAATGTGCAGG - Intronic
1081183974 11:40019801-40019823 CTTACATAATAAAAGAGTGTAGG + Intergenic
1081327100 11:41758297-41758319 CTAACACAATAAAAATATGCAGG - Intergenic
1083191312 11:61054337-61054359 GAAACATTATAAAATTGGGCAGG + Intergenic
1087217273 11:95507529-95507551 GTGAGATACTAAATGTGTGCTGG - Intergenic
1088868330 11:113870222-113870244 ATAAAATAATAAAAGTATGAGGG + Intronic
1090101529 11:123802431-123802453 CTAAAGTTATAAAAGTGTGCAGG + Intergenic
1090312219 11:125751209-125751231 GTAAAATAATAAAAGGGTAGAGG + Intergenic
1090686326 11:129125753-129125775 GTTACATCATCACAGTGTGCTGG + Intronic
1091849298 12:3682333-3682355 CTAACATGAGAAAAGTGTGTGGG - Intronic
1091889544 12:4042409-4042431 ATAACATAACATGAGTGTGCTGG - Intergenic
1100904464 12:99281595-99281617 AAAAAATAATAAAAGTATGCTGG - Intronic
1103159761 12:118719327-118719349 GTAAAATAATAAAAGTGGTAGGG + Intergenic
1106154203 13:27137267-27137289 TAAACATAATTAAAGTGTTCAGG - Intronic
1106551157 13:30772268-30772290 GTGACATATTAAAAGAATGCTGG + Intergenic
1108241099 13:48465497-48465519 GTAACATAATAAGAATATGGGGG + Intronic
1109888227 13:68571572-68571594 GTAAAGTGATAAAAGTGTACAGG + Intergenic
1113726614 13:112607898-112607920 GCATAATATTAAAAGTGTGCAGG + Intergenic
1114714724 14:24813222-24813244 GTAACACAATTAAATTGTGAAGG - Intronic
1116315271 14:43380189-43380211 TTAATATAATAAATGTGTGATGG - Intergenic
1116621922 14:47215946-47215968 GTAACAAAATAAATGTCTTCAGG + Intronic
1120094705 14:80375523-80375545 ATAAAATACTAAAAGTGTGGGGG + Intronic
1120462156 14:84811534-84811556 TTAACAAATTAAAAGTGTGCAGG + Intergenic
1128889143 15:71315342-71315364 GTGTCATAATAAAAGTGTGAAGG - Intronic
1137334860 16:47538284-47538306 CTAACATCATGAAAGTGAGCAGG + Intronic
1138629052 16:58279081-58279103 GTACCATATTCAAAGTCTGCGGG - Intronic
1139086010 16:63586738-63586760 ATAATATAAAAACAGTGTGCTGG - Intergenic
1140863322 16:79038167-79038189 CTGACAAAAAAAAAGTGTGCAGG - Intronic
1146052282 17:29563564-29563586 ATAAAATAATAAAAGTGGCCAGG + Intronic
1148218536 17:45847111-45847133 ACCACATAATAAGAGTGTGCAGG + Intergenic
1149318513 17:55461010-55461032 GAAACATAATAAAATTAAGCAGG + Intergenic
1157363695 18:47043787-47043809 GTAACCTAATAAAAATGGGGTGG + Intronic
1158512028 18:58098961-58098983 GTAACATAATAATAGTGACCTGG - Intronic
1160762575 19:792867-792889 TTAAGATAATAAACCTGTGCTGG + Intergenic
1167534474 19:50041027-50041049 GTAACATAATAAAAGTGTGCTGG - Intronic
925798528 2:7572960-7572982 GTAACACGATAAACTTGTGCTGG + Intergenic
929179602 2:39022170-39022192 TTAATATAACAAAATTGTGCTGG - Intronic
929363339 2:41121692-41121714 GTAAGATAATAAGAGTGGGGGGG + Intergenic
930799852 2:55432311-55432333 GTAACATAAAAAACATATGCTGG + Intergenic
930896623 2:56453566-56453588 CTAAAAAAATAAAAGTGGGCTGG + Intergenic
931002816 2:57807905-57807927 GTAAAATAATAAAGGTATGAAGG + Intergenic
932334393 2:70921671-70921693 GAAACATTATAAAATTGGGCTGG + Intronic
932858570 2:75265054-75265076 GTAACCAAATAACAGGGTGCTGG - Intergenic
934886000 2:98025480-98025502 GTAATAAAATCAAAGTGTTCTGG - Intergenic
935599806 2:104911526-104911548 GGAACATAAGAGAAGTGTGGTGG + Intergenic
937098602 2:119251518-119251540 GTAACAGGAGAACAGTGTGCAGG - Intronic
937153956 2:119705229-119705251 GTGAGATAATAAATGTGTGCTGG - Intergenic
939452223 2:142388770-142388792 GCAACATAAGAAAACTGTGAAGG - Intergenic
940224316 2:151385598-151385620 GTAAGATAATAAATGTGGCCGGG + Intergenic
940431525 2:153596255-153596277 GTAACAAAATGAAACTGTGTTGG - Intergenic
941822551 2:169857046-169857068 AAAACATAATAAAATTATGCTGG - Intronic
942158005 2:173151606-173151628 GTAACATTATCGAAATGTGCAGG + Intronic
943403022 2:187440036-187440058 GTAATATAATAATAGTATGAGGG - Intronic
1169412379 20:5382666-5382688 GTAAAATAACAAAAGTGGTCAGG + Intergenic
1171199928 20:23232569-23232591 GCAACACAAGAAATGTGTGCTGG + Intergenic
1172075779 20:32296157-32296179 ATAAGATAATAAAAATGGGCCGG - Intronic
1173020030 20:39259478-39259500 ATAATGTAATAAAAGTATGCAGG + Intergenic
1173942511 20:46923671-46923693 GAAAAATAATACACGTGTGCTGG + Intronic
1175753405 20:61514500-61514522 GTAACATGATAAAAGCGAGAAGG - Intronic
1176275503 20:64264619-64264641 GAAACATAATTAAACTGTGGTGG + Intronic
1182522085 22:30890484-30890506 TGAACATGATAAAAGTGTGTAGG + Intronic
1185375435 22:50480996-50481018 GTAACAGATTTAAAGTGTCCGGG - Intergenic
949185317 3:1184259-1184281 GTAAAACAAAAAAAGTGTGCTGG - Intronic
950239071 3:11351609-11351631 GTAACACAATGTAAGTGTGAAGG - Intronic
950507609 3:13405034-13405056 TTATTAAAATAAAAGTGTGCTGG + Intronic
953852275 3:46473496-46473518 GTAAGATAATACATTTGTGCTGG - Intronic
954777311 3:53031595-53031617 GTAAAAAAAAAAAAGTGTCCAGG + Intronic
955554423 3:60120419-60120441 GAAACCTAATAAAAATATGCAGG - Intronic
957401404 3:79720069-79720091 TTAAGATAATAAAAGTGTTAAGG + Intronic
958497948 3:94868944-94868966 TTAAAATAATCAAAATGTGCTGG + Intergenic
959785324 3:110290813-110290835 GTAAAATAGTGAAAGTGTTCTGG + Intergenic
962440783 3:135414114-135414136 GTAACATGAGAAAAATGTCCAGG + Intergenic
964592938 3:158386561-158386583 GTTTCATAATAATAGTGTGTTGG - Intronic
965012925 3:163119601-163119623 AAAACATTATAAAAGAGTGCCGG - Intergenic
966005156 3:175001865-175001887 GTAACATAATACATGAGGGCAGG - Intronic
967355218 3:188561817-188561839 GAAACATAATTAAAGTGTAATGG + Intronic
968202673 3:196768961-196768983 GTAAAAAAATAAAAGTAGGCCGG - Intronic
970990805 4:22210708-22210730 TTAAGATAATTAAATTGTGCAGG - Intergenic
971739894 4:30506113-30506135 ATTATACAATAAAAGTGTGCAGG + Intergenic
972245980 4:37245408-37245430 GTGTCCTAATAGAAGTGTGCAGG - Intronic
972922584 4:43962242-43962264 GTCAAATAATAAAAATGTTCTGG + Intergenic
974478050 4:62408131-62408153 GTAACATAAGAAAAGGGTTTTGG - Intergenic
974974559 4:68874171-68874193 GGAACAAAATAAGAGTTTGCTGG + Intergenic
976562211 4:86514807-86514829 GTAAAATAATCAATGTGTGTGGG + Intronic
977527694 4:98164705-98164727 GGAAAATAATAAAATTGTCCAGG + Intergenic
977868471 4:102060062-102060084 GAAACTCATTAAAAGTGTGCTGG + Intronic
978513269 4:109544471-109544493 GTAATATAAAACAAGTGGGCAGG + Intergenic
978759857 4:112345063-112345085 GTAGAATAATAGAAGTGTGTTGG + Intronic
979567465 4:122171046-122171068 GTAACAAAACAAAAGTGTTTGGG - Intronic
979840857 4:125437900-125437922 GTAAAATAATTTAAGTGAGCTGG + Intronic
981396005 4:144250149-144250171 GTAACATTATATAATGGTGCTGG - Intergenic
981628930 4:146795223-146795245 GTAAGAAAGTAAATGTGTGCAGG + Intronic
982061565 4:151609279-151609301 GTTACATAATAAAGATGTGATGG + Intronic
983449425 4:167892122-167892144 TTTAAATAATAAAAGTTTGCAGG + Intergenic
983476452 4:168217919-168217941 GTAAAATAATAAATTTGTGTTGG + Intronic
987576596 5:19736110-19736132 GTATCTTAATAAAAATGTTCTGG - Intronic
988018711 5:25596101-25596123 GTACCCTAATAAAATTTTGCAGG + Intergenic
990085708 5:51973633-51973655 GGAACATAACAACAGTGTGGTGG - Intergenic
991141213 5:63245655-63245677 TTAACAAATTGAAAGTGTGCAGG + Intergenic
992278261 5:75144313-75144335 GTAACAGACAAAAAGTTTGCTGG + Intronic
994051462 5:95366636-95366658 TTAACATAATATCAGTTTGCTGG + Intergenic
994693020 5:103041511-103041533 AGAAAATAATTAAAGTGTGCTGG + Intergenic
995383163 5:111558566-111558588 GTAACTTAAAAAAATTGTACTGG + Intergenic
996043178 5:118839703-118839725 TTAAAATATTAAAAGAGTGCTGG - Exonic
996162911 5:120188577-120188599 TCAACATAATAAAATTGTGAGGG - Intergenic
1000365522 5:160487247-160487269 GTAAAATAATAAATGTATGTAGG + Intergenic
1000531788 5:162431119-162431141 GGACCATAATAAAAGTGCACAGG + Intergenic
1003356262 6:5374393-5374415 TTAATATAAAAAAAGAGTGCAGG + Intronic
1005377100 6:25194068-25194090 GAAACATAATAAAATATTGCAGG - Intergenic
1008496516 6:52139456-52139478 GTAACAGAATAAAATGGTGGGGG + Intergenic
1011172441 6:84520928-84520950 GTAACATAATGAAGGTTGGCAGG - Intergenic
1013287384 6:108693030-108693052 GTAAGATTATAAATGTTTGCTGG + Intergenic
1013577990 6:111504302-111504324 GTAGCTTAATAAAAGTCTGCTGG - Intergenic
1014265593 6:119273691-119273713 GTAATATGATAAAAGTGTTCTGG - Intronic
1014910914 6:127091919-127091941 ACAACATAATAAAAGTGTTACGG - Intergenic
1016229618 6:141787387-141787409 GTAACATAATAAAAATAAACAGG + Intergenic
1016657506 6:146538914-146538936 GAAACATAATAAATGTGTAGGGG + Intergenic
1018247686 6:161838537-161838559 ATAACACATTAAAAGTGTTCAGG + Intronic
1021263967 7:18496028-18496050 GTAACATGGGAAAAGTGTCCAGG + Intronic
1021572143 7:22076744-22076766 TTATCATATAAAAAGTGTGCGGG - Intergenic
1025021634 7:55485025-55485047 GAAACATTTTAAAACTGTGCAGG + Intronic
1027971054 7:85082544-85082566 GAAACATAATAAAAGTCTATCGG - Intronic
1028209392 7:88054660-88054682 GCACCATAATAGAAGCGTGCAGG - Intronic
1028710380 7:93900851-93900873 ATCAAATAATTAAAGTGTGCTGG + Intronic
1030272259 7:107683033-107683055 GTAAAATGATAAAAATGTGTTGG - Intronic
1030402563 7:109070404-109070426 ATAACAAAATAAAAATGTACTGG - Intergenic
1031022411 7:116642578-116642600 GTAAGAGAATAAATGTGTGTTGG + Intergenic
1031083030 7:117276752-117276774 TTAACATAAAAAAACGGTGCAGG + Exonic
1031917757 7:127579052-127579074 CTAACACAATAAAAGAGTACTGG - Intergenic
1034118977 7:148610019-148610041 GTAACATCAGCAAACTGTGCAGG + Intronic
1040524136 8:48203838-48203860 GTAACATCATATAAATGTGATGG - Intergenic
1041267778 8:56081847-56081869 GTGAGGTAATAAATGTGTGCTGG + Intergenic
1042461834 8:69078812-69078834 GAAAGATAATAAAAATGTCCTGG + Intergenic
1042517984 8:69679797-69679819 CTAACAGAATCAAAGTCTGCTGG + Intronic
1043375344 8:79642511-79642533 AAAACATCATAAAACTGTGCAGG - Intronic
1043669568 8:82865124-82865146 GCAAGATAATAAATTTGTGCTGG - Intergenic
1047436144 8:124836788-124836810 GTAAAATGATAAATGTGTGTGGG - Intergenic
1050576396 9:7000247-7000269 CTAGCATAATAAAAGTGAGGTGG - Intronic
1051507369 9:17841513-17841535 GTCACATAATAAAATTTTGTTGG + Intergenic
1052376339 9:27722067-27722089 GTAACATAGTTCAAGGGTGCAGG + Intergenic
1052551704 9:29959082-29959104 GAATCATAGTAAAAGTGTCCAGG + Intergenic
1055277576 9:74636498-74636520 GTAACATAAAAGAAATGTGTCGG + Intronic
1055708064 9:79030228-79030250 TTCACATAATAAAAGTCTGGAGG + Intergenic
1058035691 9:100249941-100249963 CTAACATTATAAAAATGAGCTGG + Intronic
1058248911 9:102667692-102667714 ATGACATAATAAAAGTGTGAAGG - Intergenic
1058440952 9:105006529-105006551 TTAACATATTAACATTGTGCTGG + Intergenic
1058840121 9:108898808-108898830 GTATCATAATGAAAATATGCTGG - Intronic
1059375075 9:113875622-113875644 GTAATAAAATAAAAGTTTGAAGG - Intergenic
1059873187 9:118601299-118601321 ATAAATAAATAAAAGTGTGCAGG - Intergenic
1059956446 9:119521085-119521107 GAAACATAATATAGGTGTGCGGG - Intronic
1186037900 X:5444512-5444534 GTAAAATAATAAGTGTGTGATGG + Intergenic
1187284224 X:17887355-17887377 GTATCATAATATAAGTGTCCAGG + Intergenic
1187481980 X:19665469-19665491 TTCACAAAATAAAAGTGTGCTGG - Intronic
1189450774 X:41127638-41127660 GTAACACAGTAAAACTGTGCAGG - Intronic
1190131344 X:47751634-47751656 GTTACAGAATAATAGTGTGATGG + Intergenic
1190807901 X:53856326-53856348 AAAATAAAATAAAAGTGTGCCGG - Intergenic
1192684801 X:73292401-73292423 GTAAAATAATAAATGTTGGCTGG + Intergenic
1193449794 X:81651673-81651695 GTAAAACTTTAAAAGTGTGCAGG + Intergenic
1195051003 X:101096852-101096874 CTAACATCACAAAAGTGTGGGGG - Intergenic
1195565715 X:106336865-106336887 GGGACATAATAAAAGTTTGGTGG - Intergenic
1195611916 X:106877255-106877277 GTGAGATAATAAATGTGTGATGG - Intronic
1199207042 X:145160866-145160888 GTAACATAGTAAATTTGTACCGG - Intergenic
1199675663 X:150187173-150187195 GTAAAATAATAAATTTGTGTTGG - Intergenic