ID: 1167540545

View in Genome Browser
Species Human (GRCh38)
Location 19:50084503-50084525
Sequence CCAGCCTCGTGGATCACTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167540545_1167540549 -1 Left 1167540545 19:50084503-50084525 CCTAAAGTGATCCACGAGGCTGG No data
Right 1167540549 19:50084525-50084547 GGTAATTTATAAAGAGAAAAAGG No data
1167540545_1167540551 24 Left 1167540545 19:50084503-50084525 CCTAAAGTGATCCACGAGGCTGG No data
Right 1167540551 19:50084550-50084572 TATTTGGCTTATGATTCTGCTGG 0: 9
1: 144
2: 878
3: 2528
4: 3953
1167540545_1167540552 28 Left 1167540545 19:50084503-50084525 CCTAAAGTGATCCACGAGGCTGG No data
Right 1167540552 19:50084554-50084576 TGGCTTATGATTCTGCTGGCTGG No data
1167540545_1167540550 8 Left 1167540545 19:50084503-50084525 CCTAAAGTGATCCACGAGGCTGG No data
Right 1167540550 19:50084534-50084556 TAAAGAGAAAAAGGTGTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167540545 Original CRISPR CCAGCCTCGTGGATCACTTT AGG (reversed) Intergenic
No off target data available for this crispr