ID: 1167542578

View in Genome Browser
Species Human (GRCh38)
Location 19:50099081-50099103
Sequence AAGAAGCAAAGTGGACGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167542578_1167542583 -9 Left 1167542578 19:50099081-50099103 CCCGGCCGTCCACTTTGCTTCTT No data
Right 1167542583 19:50099095-50099117 TTGCTTCTTGCAGAGGCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167542578 Original CRISPR AAGAAGCAAAGTGGACGGCC GGG (reversed) Intergenic
No off target data available for this crispr