ID: 1167544124

View in Genome Browser
Species Human (GRCh38)
Location 19:50110553-50110575
Sequence AAGAAGCAAAGTGGACGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167544124_1167544129 -9 Left 1167544124 19:50110553-50110575 CCCGGCCGTCCACTTTGCTTCTT No data
Right 1167544129 19:50110567-50110589 TTGCTTCTTGCAGAGGCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167544124 Original CRISPR AAGAAGCAAAGTGGACGGCC GGG (reversed) Intergenic
No off target data available for this crispr