ID: 1167546828

View in Genome Browser
Species Human (GRCh38)
Location 19:50131948-50131970
Sequence AAGAAGCAAAGTGGACGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167546828_1167546833 -9 Left 1167546828 19:50131948-50131970 CCCGGCCGTCCACTTTGCTTCTT No data
Right 1167546833 19:50131962-50131984 TTGCTTCTTGCAGAGGCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167546828 Original CRISPR AAGAAGCAAAGTGGACGGCC GGG (reversed) Intergenic
No off target data available for this crispr