ID: 1167550327

View in Genome Browser
Species Human (GRCh38)
Location 19:50155834-50155856
Sequence CGTGGGAACCAGATGGTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 172}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167550327_1167550339 27 Left 1167550327 19:50155834-50155856 CCCTGCACCATCTGGTTCCCACG 0: 1
1: 0
2: 0
3: 9
4: 172
Right 1167550339 19:50155884-50155906 ACTATTCTCTTTCATTCACTCGG 0: 1
1: 0
2: 1
3: 35
4: 518

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167550327 Original CRISPR CGTGGGAACCAGATGGTGCA GGG (reversed) Intronic
900672823 1:3866329-3866351 CCTGGGAGGCAGAGGGTGCAGGG - Intronic
901222541 1:7591693-7591715 GGTGGGAACCAAACAGTGCAGGG - Intronic
903327365 1:22577078-22577100 CGTGGGAGCAAGATGGGGGAGGG + Intronic
904240872 1:29144297-29144319 CCTGTGAACCAGATAGTGCTTGG - Intergenic
904407871 1:30305265-30305287 TGTGGTCACCAGATGATGCAGGG - Intergenic
908513776 1:64871850-64871872 CGTGGAAAGCAGATTGTGCTGGG - Intronic
912846066 1:113075769-113075791 CCTGGGAAGCAGAGGTTGCAGGG - Intronic
913659649 1:120994858-120994880 TGTGGTCACCAGATGATGCAAGG + Intergenic
914011010 1:143777982-143778004 TGTGGTCACCAGATGATGCAAGG + Intergenic
914166820 1:145183125-145183147 TGTGGTCACCAGATGATGCAAGG - Intergenic
914649630 1:149686637-149686659 TGTGGTCACCAGATGATGCAAGG + Intergenic
919909119 1:202099581-202099603 CCTGGGAAGCAGAGGTTGCAGGG - Intergenic
921597286 1:217068294-217068316 CATGGCTACCAGATGGTGCAAGG - Intronic
923716855 1:236432311-236432333 CCTGGGAAGCAGAGGTTGCAGGG + Intronic
1063634394 10:7767781-7767803 CCTGGGAGGTAGATGGTGCAGGG + Intronic
1065899513 10:30192602-30192624 CCTGGGAAGCAGAGGTTGCAGGG - Intergenic
1066296538 10:34058865-34058887 CCTGGGAACCAGCTGGTGGTGGG - Intergenic
1067525831 10:47038073-47038095 TGTGGGAAGCAGATGCTGTAAGG - Intergenic
1072132539 10:92509515-92509537 CCTGGGAAGCAGAGGTTGCAGGG + Intronic
1074790395 10:116880870-116880892 CGAGGGAAACAGCTGCTGCAGGG + Intronic
1076171277 10:128322243-128322265 CGTGGGAACAGGAAGGTGGAAGG + Intergenic
1079082024 11:17420388-17420410 CATGGGAACCAGATGGCCCCTGG - Intronic
1079347450 11:19665364-19665386 GCTGAGAAGCAGATGGTGCATGG + Intronic
1079394701 11:20051479-20051501 AGTGAGAACGAGAGGGTGCAAGG - Intronic
1079709669 11:23666053-23666075 CTTGGGAAGTAGATGGGGCAGGG + Intergenic
1080480844 11:32648255-32648277 AGTGGGAACCAGATGGACAATGG - Intronic
1080735299 11:35008317-35008339 TGAGGGATCCAGATGGTACAGGG - Intronic
1084972609 11:72780173-72780195 CCAGGGGACCAGATGGGGCAGGG - Intronic
1088692867 11:112342767-112342789 CCTGGGAAGCAGAGGTTGCAGGG - Intergenic
1088932872 11:114369783-114369805 CTTGGGAGCCAGAAGTTGCAGGG - Intergenic
1090375416 11:126284776-126284798 CGTGGGAGGCAGAGGTTGCAGGG + Intronic
1091360046 11:134972020-134972042 CGTGCCAACCACATGGAGCACGG + Intergenic
1091898744 12:4125205-4125227 CGTGGGAGGCAGAGGCTGCAGGG + Intergenic
1094810451 12:34132464-34132486 CGTGGCAACCAGATTGTCCTTGG + Intergenic
1095815431 12:46417052-46417074 CCTGGGAAGCAGAAGTTGCAAGG - Intergenic
1102034281 12:109761954-109761976 CTGGGGAAGCAGTTGGTGCAGGG - Intronic
1102281631 12:111623196-111623218 CCTGGGAAACAGAGGCTGCAGGG - Intergenic
1102380852 12:112465546-112465568 CGTGGGACCCAGGTTGTGGATGG + Intronic
1103087332 12:118071642-118071664 TGTGGGGATCAGATGGAGCAGGG + Intronic
1103720386 12:122971527-122971549 CCTGGGAAGCAGAGGTTGCATGG - Intronic
1105020921 12:132816407-132816429 CGTGGGACTCAGATGGCACACGG + Intronic
1105801785 13:23911131-23911153 GGTGGCAACCAGATGTTTCATGG - Intergenic
1107452277 13:40520615-40520637 CGAGGGAAACAGAATGTGCATGG + Intergenic
1109783905 13:67150107-67150129 CCTGGGAGGCAGATGTTGCACGG - Intronic
1114278300 14:21168136-21168158 CCTGGGAACAACATGGAGCAAGG + Intergenic
1115002941 14:28443246-28443268 CATGGTAGCCAAATGGTGCAAGG + Intergenic
1118709477 14:68507972-68507994 CGTCGGAAGCAGAGGGTGCCAGG + Intronic
1118754260 14:68827225-68827247 CCTGGGAAGCAGAAGTTGCAGGG + Intergenic
1124057979 15:26260326-26260348 AGTGGGTCCCAGATGTTGCATGG - Intergenic
1124159390 15:27254982-27255004 CGTGGGAGGCATCTGGTGCAGGG - Intronic
1124448842 15:29765814-29765836 CCTGGGAAGCAGAGGTTGCAGGG + Intronic
1127095893 15:55512072-55512094 CTTGGGGACGAGATGGTTCATGG - Intergenic
1131341923 15:91610631-91610653 CTTGGAAATCAGATGGTGCTAGG - Intergenic
1131698016 15:94901353-94901375 CTTGGGGACCAGATAGGGCAGGG - Intergenic
1133234646 16:4382198-4382220 TGTGAGAGCCAGATGGGGCAGGG + Exonic
1134109680 16:11507256-11507278 CGTGGCAACCAGATGGCCCTGGG - Intronic
1135555712 16:23434887-23434909 CGTGAAAACCAGATACTGCAAGG + Intronic
1145242932 17:21250179-21250201 CATGGGGAGCAGGTGGTGCAGGG - Intronic
1145831654 17:27921228-27921250 CATGGGAGGCAGGTGGTGCATGG - Intergenic
1146677153 17:34781492-34781514 GGTGGGAACCAGCTGCTGCAGGG - Intergenic
1147203842 17:38822736-38822758 TGTGGCAAGCTGATGGTGCAGGG + Intronic
1147658601 17:42105105-42105127 CGTGGCCACCAGAAGGTTCAGGG + Exonic
1147789403 17:43004046-43004068 CTTGGGAACCAGAGGGGGCGGGG + Intergenic
1148846927 17:50534858-50534880 CCTGGGGACCAGTTGGGGCACGG + Intronic
1151199235 17:72455646-72455668 CTTGGGAGGCAGATGCTGCAAGG - Intergenic
1151769170 17:76148644-76148666 CCTGGGAACCGGAGGTTGCAGGG - Intronic
1152175407 17:78783543-78783565 CCTGGGAAGCAGAGGTTGCAGGG - Intergenic
1153457155 18:5295027-5295049 CCTGGGAGCCAGGTGGTGAAAGG + Intronic
1158392417 18:57054133-57054155 TGGGGGAACAAGATGGTGCCTGG - Intergenic
1158790748 18:60777590-60777612 CCTGGGAAGCAGAGGTTGCAGGG + Intergenic
1161420776 19:4174972-4174994 CGTGGGGGACAGAGGGTGCATGG + Intronic
1161440771 19:4290487-4290509 CGTGAGAACCAGGTGGTGCTGGG + Exonic
1161621746 19:5301389-5301411 CCTGGGAGGCAGAGGGTGCAGGG - Intronic
1162119422 19:8453680-8453702 CTGGGGAAGCAGAAGGTGCAAGG + Intronic
1162349133 19:10138246-10138268 CTAGGGAAGCAGATGATGCAGGG + Intronic
1162920550 19:13899631-13899653 GGTGGGCACCTGATGGGGCAGGG - Intronic
1163574581 19:18103114-18103136 GGTGGAAAGCAGATGGTGCGGGG + Intronic
1164707888 19:30333725-30333747 CGTGGGGTCCGGCTGGTGCACGG - Intronic
1165844915 19:38812240-38812262 CGTGGGGGCCAGAAGGTTCAGGG - Intronic
1167256973 19:48436464-48436486 CGGGGGAGCCAGAGGCTGCATGG + Intronic
1167325089 19:48819488-48819510 GGTGGGAACCAGATCAGGCAGGG - Intronic
1167412480 19:49353172-49353194 CCTGGGAAGCAGAGGTTGCAGGG - Intronic
1167550327 19:50155834-50155856 CGTGGGAACCAGATGGTGCAGGG - Intronic
1167556235 19:50197666-50197688 AGAGGGGACCAGATGGAGCAGGG + Intronic
1168562530 19:57396032-57396054 CACGGAAACCAGGTGGTGCACGG - Intronic
927045180 2:19271175-19271197 CCTGGGAAGCAGAGGTTGCAGGG - Intergenic
927075774 2:19575837-19575859 AATGGAAACCAGATGTTGCATGG - Intergenic
927186250 2:20484654-20484676 TGCGGGAATCAGATGGGGCAAGG - Intergenic
929171731 2:38939046-38939068 CCTGGGAGGCAGATGTTGCAGGG - Intronic
929423215 2:41816237-41816259 GGTGAGAACCAGATGGGGAAGGG + Intergenic
931318964 2:61157920-61157942 CTTGGGCTCCAGATGGTCCAGGG - Intronic
934622970 2:95826783-95826805 CCTGGGAGCCACATGGGGCAAGG - Intergenic
934810796 2:97275305-97275327 CCTGGGAGCCACATGGGGCAAGG + Intergenic
934826896 2:97432634-97432656 CCTGGGAGCCACATGGGGCAAGG - Intergenic
935208269 2:100915379-100915401 CCTGGGAACCAGAAGGTACTGGG + Intronic
936849173 2:116874453-116874475 CCTGAGAACCACATGGGGCAAGG - Intergenic
937499519 2:122462809-122462831 CATGGGAACCAGATTCTGGAGGG + Intergenic
940227420 2:151414208-151414230 CCTGGGAAGCAGAGGTTGCAGGG + Intronic
940713238 2:157187538-157187560 CCTGGGAAGCAGAGGTTGCAGGG + Intergenic
941442914 2:165560534-165560556 AGTGGGAACCAGATGGCTTAAGG - Intronic
944657437 2:201890205-201890227 AGTTGGAACCAGATGGTGAAGGG - Intronic
945024405 2:205606363-205606385 CCTGGGAGCCACATGGGGCAAGG - Intronic
947784559 2:232804565-232804587 CCTGGGAAGCAGAGGTTGCAGGG - Intronic
948318921 2:237053500-237053522 CCTGGGATCCAGAGGGTGGATGG - Intergenic
1171395282 20:24829176-24829198 CGTGGGGCCCAGGTGATGCAGGG + Intergenic
1173010341 20:39176355-39176377 AGGGGGAACCAGCAGGTGCAAGG - Intergenic
1173019489 20:39255258-39255280 CCTGGGAGCCAGAGGTTGCAGGG - Intergenic
1174445898 20:50590888-50590910 CATGGGAAGCAGAGGCTGCAGGG - Intronic
1175024662 20:55889147-55889169 AGTGTGAGCCAGATTGTGCAGGG + Intergenic
1175260756 20:57672732-57672754 CCTGGGAGCCCGATGGTGCAAGG - Intronic
1175296493 20:57912412-57912434 CCTTGGAAGCAGATGGTGCCAGG - Intergenic
1175886152 20:62292006-62292028 AGTGGGAACCACATGGGTCAGGG - Intronic
1179286917 21:39985362-39985384 TGTGGGCCCCAGATGATGCAGGG - Intergenic
1179625461 21:42646563-42646585 TGTGGGAAGCAGATGGGTCAGGG - Intergenic
1180831244 22:18907305-18907327 GGTGGAAATCTGATGGTGCAGGG - Intronic
1181506373 22:23360991-23361013 AGTGGGAAGTAGATTGTGCAAGG - Intergenic
1184059996 22:42075575-42075597 CCTGGGAACCAGGTGGTCGAAGG + Exonic
1184411699 22:44329905-44329927 GCTGGGAATCAGATGGTCCAGGG - Intergenic
1184536497 22:45091290-45091312 TGAGGGAACCAGGTGGTTCAGGG - Intergenic
1203281330 22_KI270734v1_random:132576-132598 GGTGGAAATCTGATGGTGCAGGG - Intergenic
950053166 3:10007378-10007400 CCTGGGAACCAGACTGTGCTGGG + Intronic
952572211 3:34731472-34731494 CCTGGGAGCCACATGGGGCAAGG + Intergenic
954310801 3:49765572-49765594 CATGGGAATCAGAGGTTGCAGGG + Intronic
955690005 3:61581683-61581705 CCTGGGAAGCAGAGGTTGCAGGG - Intronic
959299051 3:104576065-104576087 CCTGGGAGCCACATGGGGCAAGG - Intergenic
961457021 3:127029375-127029397 AGTGGGAGCCTGGTGGTGCAGGG + Intronic
961861347 3:129918970-129918992 CCTGGGAACCAGACTGTGCTGGG + Intergenic
962991569 3:140582187-140582209 TCTGGGAGACAGATGGTGCAGGG + Intergenic
974913392 4:68149593-68149615 CCTGGGAGCCACATGGGGCAAGG - Intergenic
985837047 5:2279166-2279188 CTTGGGATCTAGATGCTGCAAGG + Intergenic
987188617 5:15450781-15450803 CGGGGGCACCAGATGATGGAGGG - Intergenic
988610577 5:32720529-32720551 TGTGGGAACCAGATGATGGAGGG + Intronic
992546871 5:77821860-77821882 CTTGGGTACCAGGTGGTACATGG + Intronic
998295752 5:140967428-140967450 TGTGAGAACCAGGTGGTGCAAGG - Exonic
999582734 5:153057723-153057745 CGTGTGATCCAGAAGGTGGAAGG + Intergenic
1001943288 5:175755881-175755903 CCTGGGAAGCAGAGGCTGCAGGG + Intergenic
1002442298 5:179270767-179270789 CGTGGGAACGATTAGGTGCATGG + Intronic
1002519830 5:179786162-179786184 CCTGGGAAGCAGAGGTTGCAGGG + Intronic
1002599445 5:180345990-180346012 CCTGGGATCCTCATGGTGCATGG - Intronic
1006463413 6:34177150-34177172 AGTTGGCACCAGATGGGGCAGGG - Intergenic
1007070577 6:39035115-39035137 CATGGTAACCAGAAGGAGCATGG + Intergenic
1010734715 6:79431110-79431132 CGTGGGAACCAGGTGGCTCCCGG - Intergenic
1017097869 6:150820787-150820809 CCTGGGAAGCAGAGGTTGCAAGG + Intronic
1018475449 6:164135668-164135690 CGTGGGAGACAGAGGGTGAAAGG - Intergenic
1019291108 7:250733-250755 CGTGGGCACCAGGGTGTGCATGG - Intronic
1020166445 7:5811309-5811331 CCTGGGAGCCAGAGGCTGCAGGG - Intergenic
1021577731 7:22119677-22119699 CTTCGGCACCAGGTGGTGCAGGG - Exonic
1022616319 7:31934142-31934164 CGTGGCCACCAGAAGGTACAAGG - Intronic
1024276382 7:47680281-47680303 CGTGGGAGGCAGATGTTGCAGGG + Intergenic
1025041613 7:55650959-55650981 CCTGGGAGCCACATGGGGCAAGG + Intergenic
1026487000 7:70830247-70830269 CTTGTGAAGCAGATGGTGAAGGG - Intergenic
1030077721 7:105750888-105750910 CATTGGAACCAGATCGTGGAAGG - Intronic
1030564601 7:111137898-111137920 CCTGGGAAGCAGAGGTTGCAGGG - Intronic
1031160898 7:118166756-118166778 GGTGGGAGCCAGATGGTGGGGGG + Intergenic
1034106370 7:148494260-148494282 CGTGGGAACCAGATCATTCCTGG + Intergenic
1035601306 8:898482-898504 AGAGGGAACCAGACGCTGCATGG - Intergenic
1037762497 8:21751160-21751182 CTTAGGAAGCAGCTGGTGCAGGG + Intronic
1041209754 8:55537159-55537181 TGTGGTAACCAGTTGGTGCTTGG - Exonic
1042506169 8:69563169-69563191 TGTGGGGAGCAGATGGCGCAAGG - Intronic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1044621111 8:94191525-94191547 CCTGGGAGGCAGATGTTGCAGGG - Intronic
1045505016 8:102772140-102772162 CCTGGGAAGCAGAGGTTGCAGGG + Intergenic
1050660650 9:7879774-7879796 CCTGAGAACCACATGGGGCAGGG + Intronic
1051278378 9:15418215-15418237 CTTGGGAAACAGCAGGTGCAAGG + Intergenic
1052784058 9:32812339-32812361 CCTGGGAAGCAGAGGTTGCAGGG + Intergenic
1056741100 9:89256037-89256059 CCTGGGAGGCAGATGTTGCAGGG - Intergenic
1057073212 9:92118377-92118399 GGTGGTAACCAGATGGTGGCTGG - Intergenic
1057392709 9:94652901-94652923 CTGGGGGGCCAGATGGTGCAGGG - Intergenic
1058876154 9:109246630-109246652 AGTTGGAACCAGGTGGTACAAGG + Intronic
1061342075 9:129990563-129990585 TGTGGGAACCAGATTATACAAGG + Intronic
1061364294 9:130163388-130163410 CCTGGGAAGCAGAGGCTGCAGGG - Intergenic
1061403959 9:130383490-130383512 CGTGGAAACCTGTGGGTGCAGGG - Intronic
1062112483 9:134789772-134789794 CGGGGGCTCCAGAAGGTGCAGGG - Intronic
1185579255 X:1197924-1197946 CGTGGGAGACAGATGTTGCAGGG + Intronic
1189302872 X:39965379-39965401 CGTGGGCACCACAAGCTGCAAGG + Intergenic
1189940222 X:46113272-46113294 CCTGGGAGCCACATGGGGCAAGG - Intergenic
1192224957 X:69221711-69221733 CGTGGGAGCCAGGTGGGGGAGGG - Intergenic
1194177152 X:90665025-90665047 CCTGGGAGCCACATGGAGCAAGG + Intergenic
1194786235 X:98087343-98087365 GGTGGGGACCAGATGGTTCCGGG + Intergenic
1196599830 X:117589461-117589483 CCTGGGAGCCACATGGGGCAAGG + Intergenic
1196922641 X:120600427-120600449 CCCGGGAAGCAGAGGGTGCAGGG + Intronic
1197302875 X:124802549-124802571 TGTGGGAGCCATATGGGGCAAGG - Intronic