ID: 1167554043

View in Genome Browser
Species Human (GRCh38)
Location 19:50181819-50181841
Sequence CAACAGAGAAAGACCCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167554043_1167554046 -3 Left 1167554043 19:50181819-50181841 CCCTCCAGGGTCTTTCTCTGTTG No data
Right 1167554046 19:50181839-50181861 TTGCCCACGCTGCAGTGCAGTGG 0: 15
1: 1891
2: 77060
3: 188930
4: 234058

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167554043 Original CRISPR CAACAGAGAAAGACCCTGGA GGG (reversed) Intergenic
No off target data available for this crispr