ID: 1167556100

View in Genome Browser
Species Human (GRCh38)
Location 19:50196650-50196672
Sequence ATAAACATACAGATGGACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 371
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 340}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167556100 Original CRISPR ATAAACATACAGATGGACAG AGG (reversed) Intronic
902124662 1:14198758-14198780 ATAAATAAACATATGTACAGTGG - Intergenic
902922000 1:19671787-19671809 ATAAATAGACATATGGAGAGGGG - Intronic
906277130 1:44524624-44524646 ATAAAAATAGAGAGAGACAGAGG - Intronic
906329315 1:44871487-44871509 CTATACATGCAGATGGACAAGGG - Intronic
906543891 1:46608152-46608174 ATAGAGATACACATGGAAAGAGG - Exonic
906785369 1:48610940-48610962 ATCAAAATACAGAAGGGCAGGGG + Intronic
907996198 1:59635285-59635307 ATAAACATACAGCTGCAAGGAGG + Intronic
908553913 1:65237855-65237877 ATAAAAATATAGAAGAACAGAGG + Intergenic
910439210 1:87234921-87234943 ATAGAGATAGAGATGGAAAGAGG - Intergenic
910576419 1:88769954-88769976 ATAAACATACACATGAAAAGGGG + Intronic
911036487 1:93555359-93555381 TTAAAGCTTCAGATGGACAGAGG + Intergenic
916364367 1:164007473-164007495 GTATACATATAGATGGAAAGAGG + Intergenic
917469642 1:175315370-175315392 ATAAAAATAAAAATGTACAGAGG - Exonic
918355727 1:183705442-183705464 ATCAACATACTGAAGGAGAGTGG + Intronic
919244349 1:194960196-194960218 ATAAAAATACGGCTGGATAGTGG - Intergenic
919362915 1:196617408-196617430 ACAAAGATACAGATGAACAACGG - Intergenic
920692559 1:208158212-208158234 AAAAACAGACAGAGGGACACAGG - Intronic
922083478 1:222322337-222322359 TTAAAAAGACAGGTGGACAGAGG + Intergenic
922556726 1:226538225-226538247 ATACAAATTCAAATGGACAGTGG - Intergenic
1064291225 10:14035689-14035711 ATAAAAATACAGCTGGATCGAGG - Intronic
1064724772 10:18267653-18267675 ATAAACATTAAGAAGCACAGAGG + Intronic
1065409162 10:25403395-25403417 AAAAACATAAAGAAGGACATTGG - Intronic
1065909820 10:30292811-30292833 ATAAAAACACAACTGGACAGGGG + Intergenic
1066498754 10:35970038-35970060 ATGAACATAAACATGGACACTGG + Intergenic
1067496552 10:46765818-46765840 ACAAACATACATATGGAAAAAGG + Intergenic
1067598103 10:47574584-47574606 ACAAACATACATATGGAAAAAGG - Intergenic
1067910391 10:50340592-50340614 ATATACATACAGATATGCAGGGG + Intronic
1068446138 10:57126103-57126125 ATAAACATATAAATGCACATAGG - Intergenic
1069173408 10:65260915-65260937 TTAAACAGACAGATTGATAGAGG - Intergenic
1069640593 10:69952956-69952978 AAAAACATACCAATGGGCAGGGG - Exonic
1069780624 10:70953172-70953194 ATAAGCAGACAGATGGATGGGGG - Intergenic
1069861307 10:71473364-71473386 ATGAACACACAGGTGCACAGAGG - Intronic
1070764879 10:79050651-79050673 ATAAACATCCAGATGAAGAGAGG + Intergenic
1071615187 10:87069054-87069076 ATGAACATACATATGGAAAAAGG + Intronic
1071996685 10:91156154-91156176 ATAAACAGCCAGATGCTCAGGGG + Intergenic
1075000379 10:118792565-118792587 CTGAATATACAAATGGACAGTGG + Intergenic
1075962860 10:126584441-126584463 ATAGACAGACAGGTAGACAGAGG - Intronic
1077321959 11:1946741-1946763 AAAAACAGCCAGATGGAGAGAGG + Intergenic
1077959178 11:7055107-7055129 ATAAACCTACACATCTACAGTGG - Intronic
1077986232 11:7354100-7354122 GTGAACATAAAGATGGACACAGG - Intronic
1079549637 11:21678258-21678280 AAAAACATACAAATGGCCAAAGG - Intergenic
1080255021 11:30281061-30281083 ATAAACATAGAGAAGAAAAGAGG + Intergenic
1081006570 11:37751612-37751634 ATAAACAGACAAATGGATAAAGG + Intergenic
1081078180 11:38702516-38702538 TTAAATATACAAATGGACAATGG + Intergenic
1081557100 11:44174849-44174871 TCAAAGATACAGAGGGACAGGGG + Intronic
1082756926 11:57086064-57086086 AAAAACACACAGAATGACAGTGG + Intergenic
1085669346 11:78447883-78447905 ACAAAGTTTCAGATGGACAGAGG + Intronic
1086952284 11:92903576-92903598 ATAAACACACAGATGGAGATGGG + Intergenic
1087435729 11:98114732-98114754 ATACACATACACATACACAGAGG - Intergenic
1087788249 11:102379802-102379824 ATTAGGATACAGATGCACAGAGG + Intergenic
1088389163 11:109294732-109294754 ATAAGCATACAGTTAGATAGGGG + Intergenic
1090824963 11:130378661-130378683 ATAAATACACAGATTAACAGAGG - Intergenic
1090966422 11:131601209-131601231 GGGAGCATACAGATGGACAGTGG + Intronic
1202804975 11_KI270721v1_random:2054-2076 AAAAACAGCCAGATGGAGAGAGG + Intergenic
1091679668 12:2517994-2518016 GTAAACAGACAGACAGACAGTGG + Intronic
1092044283 12:5417911-5417933 ATTAATTGACAGATGGACAGAGG - Intergenic
1092512159 12:9168513-9168535 AAAAACATAAAGAAGGACAAAGG - Intronic
1093520791 12:20047658-20047680 AGAAACAGACAAATGGAGAGAGG + Intergenic
1094049839 12:26206907-26206929 ATGAAAATACAGAGGGAGAGTGG - Intronic
1094776700 12:33737856-33737878 ACAAACATACAAATGTACAATGG + Intergenic
1095482682 12:42652073-42652095 ATAAACAGCCAGATGAAGAGAGG - Intergenic
1097212330 12:57381776-57381798 ATATACATACATATAGAGAGAGG + Intronic
1097322189 12:58238201-58238223 ATATATATACATATGGAAAGAGG - Intergenic
1097422639 12:59399279-59399301 AGAAAAATACAGATGAACATAGG - Intergenic
1098973827 12:76881251-76881273 ATAAAGAAACAGATGCATAGAGG - Intergenic
1100670397 12:96806004-96806026 ATAAACATGGACATGCACAGTGG + Intronic
1101803278 12:108041468-108041490 CTGAACATACAAATGGACAGTGG + Intergenic
1101938124 12:109075762-109075784 AAAGACATACAAATGGCCAGTGG - Intronic
1102684239 12:114711987-114712009 ACAAAGACACAGAAGGACAGAGG - Intergenic
1103801431 12:123540373-123540395 ATAAAGATTAAGAAGGACAGTGG + Intergenic
1104427648 12:128691418-128691440 ATGCACAGACAGATGGACAGAGG - Intronic
1106764558 13:32900990-32901012 ATAAAAATTCAAATGGTCAGGGG + Intergenic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107915461 13:45145537-45145559 ATAGAAATACAGATGTAAAGAGG - Intronic
1108050287 13:46428434-46428456 TTAAGTATACAGGTGGACAGTGG + Intronic
1108690567 13:52855891-52855913 AGAAGAATGCAGATGGACAGTGG + Intergenic
1108912186 13:55568762-55568784 TTAAACAGACAGATGGTAAGTGG + Intergenic
1109338656 13:61026089-61026111 AAAAAGATACAGAAGAACAGAGG + Intergenic
1109542810 13:63801750-63801772 TTAAGTATACAGGTGGACAGTGG + Intergenic
1110394741 13:75016203-75016225 ATACACAGACAGACAGACAGAGG + Intergenic
1110564160 13:76941118-76941140 ATAAAAATACAAATGGAGAAGGG + Intergenic
1110717183 13:78719511-78719533 ATACACATATATATGGAGAGAGG + Intergenic
1111326978 13:86711127-86711149 ATAAAGAAACAGAGGCACAGGGG - Intergenic
1112205454 13:97319494-97319516 TTTGACATACAGAGGGACAGTGG - Intronic
1112967568 13:105216447-105216469 ACAAACATACAGATAGATAAAGG - Intergenic
1113019947 13:105873742-105873764 ATAAACATACAGATAAACAAAGG + Intergenic
1114275262 14:21137380-21137402 ATATATATACAGAGAGACAGCGG - Intergenic
1114325116 14:21581241-21581263 ATACACATACAAATGGGCATGGG + Intergenic
1114358466 14:21941802-21941824 GTAATCATACACATGGCCAGAGG + Intergenic
1114826569 14:26087787-26087809 ATAAAAATAGAGATAGACAATGG - Intergenic
1115155191 14:30331079-30331101 CTGAATATACAAATGGACAGTGG + Intergenic
1116837911 14:49789239-49789261 AGAAACCTAGAGGTGGACAGAGG - Exonic
1117192676 14:53308488-53308510 ATAGACATATAGATGAATAGGGG - Intergenic
1117286307 14:54288861-54288883 ATACATATACATATGCACAGTGG + Intergenic
1118235718 14:64003619-64003641 GTAAACACACAGAAGGACAAGGG - Intronic
1118756087 14:68844671-68844693 ACAAACATACAGCTAGACAGAGG - Intergenic
1120895777 14:89530579-89530601 ATATATATACATATGGAGAGAGG - Intronic
1121169265 14:91839410-91839432 ATAGAGATACAGATGGATTGTGG - Intronic
1121820997 14:96966006-96966028 TTAAAGATACGTATGGACAGCGG + Intergenic
1122796745 14:104209949-104209971 CCAAACAGACAGATGAACAGAGG - Intergenic
1123167130 14:106336109-106336131 AAAAACATACACATGAACCGTGG - Intergenic
1123169266 14:106355936-106355958 ATAAATATACAGAGGTTCAGAGG + Intergenic
1124099081 15:26676502-26676524 ATACACACACAGGTGCACAGGGG + Intronic
1124793930 15:32757427-32757449 ATAAACAGACACATGAACAGTGG - Intergenic
1125985706 15:44049367-44049389 ATAAACCTTAAGCTGGACAGTGG + Intronic
1127667151 15:61159042-61159064 ATAAATATACAGCTAGACATAGG + Intronic
1128608706 15:69057226-69057248 ATAAATTGACAGATGGAAAGAGG - Intronic
1128751984 15:70156375-70156397 ACAGACAGACAGAGGGACAGAGG - Intergenic
1131363811 15:91820053-91820075 ACAAAAATGCAGATGGAGAGAGG + Intergenic
1131962110 15:97800756-97800778 GTAGACATACAGGTGGACATGGG - Intergenic
1133431010 16:5736727-5736749 AGACACACACAGATGGAGAGAGG - Intergenic
1133510653 16:6454173-6454195 ATACACATTCTGATGTACAGGGG + Intronic
1133814792 16:9188449-9188471 AAAAAAATGGAGATGGACAGGGG - Intergenic
1134880835 16:17744309-17744331 ATAGAGATACAGAGAGACAGAGG + Intergenic
1135876893 16:26210253-26210275 ATAAACATAAATATAGACATAGG - Intergenic
1138328951 16:56197313-56197335 ATAAACATAGAGAGGGACGAAGG - Intronic
1138442072 16:57041119-57041141 AGAAACAGGCAGAGGGACAGAGG - Intronic
1141397102 16:83714941-83714963 GTAAAGAAACAGATGGGCAGAGG - Intronic
1141832781 16:86519008-86519030 ATGAAATGACAGATGGACAGAGG + Intergenic
1141886579 16:86896365-86896387 GTAAACACACACCTGGACAGTGG + Intergenic
1143188522 17:5024530-5024552 ACAGACAGACAGACGGACAGGGG - Exonic
1143786277 17:9258083-9258105 CTAAACTTAAAGATGAACAGAGG + Intronic
1144497163 17:15755675-15755697 ATAAAGATATAGATAGATAGGGG + Intergenic
1144904466 17:18629230-18629252 ATAAAGATATAGATAGATAGGGG - Intergenic
1147698845 17:42378595-42378617 CTAAACATACTGATGAAAAGAGG + Intronic
1147817716 17:43222171-43222193 ATAGACAGACAGACAGACAGAGG - Intergenic
1148045891 17:44744092-44744114 ATAAAAATAGAGATGGGCGGGGG - Intronic
1148883765 17:50756140-50756162 ATAAACATACAGATTAAAAAAGG - Exonic
1148889401 17:50797054-50797076 ATAAAAATATATATGTACAGAGG + Intergenic
1149117893 17:53120455-53120477 ATAATCATAAAGATGGCCTGAGG + Intergenic
1149768836 17:59303833-59303855 ATAAACATACATATGCAGATCGG - Intergenic
1149941475 17:60872645-60872667 ATATACATACAGATAGATATCGG - Intronic
1150952008 17:69813566-69813588 AAAAAGAAACAGATAGACAGAGG + Intergenic
1151140444 17:71986405-71986427 ATCAAAGTACAGATGGAGAGTGG - Intergenic
1153543735 18:6185206-6185228 ATAAACAAACAGAGGGAAGGCGG + Intronic
1154276993 18:12970398-12970420 AAGAAAAAACAGATGGACAGGGG - Intronic
1155721131 18:29013064-29013086 ATTACCACACAGATGGTCAGGGG - Intergenic
1156632158 18:38983225-38983247 ATAAACTTATTGATGGACAAAGG - Intergenic
1156946517 18:42839749-42839771 ATGAACATACGAATGGACAGTGG + Intronic
1157525794 18:48380510-48380532 ACAGACATACATATGTACAGTGG + Intronic
1157897835 18:51485396-51485418 ATGAACATAAAGATGAACGGGGG - Intergenic
1158001377 18:52623055-52623077 ATAAACAAACAGCTGGCCTGTGG - Intronic
1158161408 18:54488648-54488670 TTGAATATACAGATGGACAATGG - Intergenic
1158435326 18:57431245-57431267 TTACACGTGCAGATGGACAGTGG - Intergenic
1158501057 18:58002288-58002310 AAAAACAAATAGATGGAAAGAGG - Intergenic
1159315520 18:66768455-66768477 AAAGACATACAGAAGGTCAGAGG + Intergenic
1159499027 18:69244952-69244974 ATACAGATGCAGATGGACACAGG + Intergenic
1159775763 18:72601625-72601647 AGAAACATCCTGTTGGACAGGGG + Intronic
1163364143 19:16866749-16866771 ACAAACAAACAGATAGACAATGG - Intronic
1163952796 19:20606224-20606246 ATAAACATATACATGGAAAATGG - Intronic
1164080500 19:21858112-21858134 ATATACATCCAGATGGCCTGAGG + Intergenic
1164445353 19:28312870-28312892 ATAAACACACCCAGGGACAGAGG - Intergenic
1166206429 19:41272666-41272688 AGCAACATACAGATGGACAGTGG + Intronic
1167224330 19:48227260-48227282 ATAAACACTCATATGGAGAGGGG + Intronic
1167556100 19:50196650-50196672 ATAAACATACAGATGGACAGAGG - Intronic
925039666 2:721804-721826 ATTAAGATACATATGTACAGAGG - Intergenic
925373535 2:3364870-3364892 ACAAATATACAGTTGGATAGAGG + Intronic
926646044 2:15290754-15290776 ATGAACCTCCAGAAGGACAGAGG + Intronic
927126253 2:20014288-20014310 ATACACATACATATAGAGAGAGG + Intergenic
928038592 2:27850852-27850874 AAAAACAGACAGATGTCCAGGGG + Intronic
928210090 2:29317458-29317480 ATCAACATTCAGAAGGACACTGG - Intronic
928593335 2:32838821-32838843 AGAAACATACATATACACAGTGG - Intergenic
928755277 2:34517081-34517103 ACATACATACATATGGAGAGGGG + Intergenic
929018173 2:37522917-37522939 AAAAACACACAGATGGCCAGAGG + Intergenic
929383198 2:41377861-41377883 ATATACATCCAGATGGCCAGAGG + Intergenic
929384272 2:41385316-41385338 ATATACATCCAGATGGTCTGAGG + Intergenic
930347147 2:50198061-50198083 ATAAAGATGCAGATGGATAATGG - Intronic
933334191 2:80935796-80935818 AAAAATATACAAATGGCCAGTGG + Intergenic
933982276 2:87560954-87560976 AGAAACAGACAGCTGGGCAGTGG + Intergenic
934233158 2:90205305-90205327 ATACAGAGACAGAGGGACAGGGG + Intergenic
936311562 2:111389856-111389878 AGAAACAGACAGCTGGGCAGTGG - Intergenic
936495984 2:113021419-113021441 ACATACATACAGATGCACAGGGG + Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938977843 2:136496166-136496188 CTGAATATACAAATGGACAGTGG - Intergenic
939314251 2:140526870-140526892 AGAAACAAAGAGATGGGCAGGGG + Intronic
939326521 2:140697024-140697046 ATAAACACATAGAAGTACAGAGG + Intronic
939971544 2:148667590-148667612 ATAAACATCCAGACTGAGAGAGG - Intronic
941451162 2:165661959-165661981 GGAAAGATACAGAGGGACAGTGG - Intronic
941686901 2:168456575-168456597 ATGAAGATACAGAAGGCCAGGGG - Exonic
942588859 2:177518684-177518706 ATATACAGACAGATAGATAGTGG - Intronic
942993220 2:182228269-182228291 ATTAACAAACAGAAGGACAATGG + Intronic
943189629 2:184659306-184659328 TTAAACATACAAATGAATAGTGG - Intronic
943734238 2:191336466-191336488 TTAAACACACGGATGGAGAGGGG - Intronic
943935651 2:193912327-193912349 AAAAATATACATATGGACATAGG + Intergenic
944324546 2:198388682-198388704 ATAAACAAGCAGAAGGCCAGTGG + Intronic
944401931 2:199337541-199337563 AGAAACATACAGATAGGGAGAGG + Intronic
945477435 2:210301593-210301615 ATAAACCTATAGATGGAAGGAGG - Intronic
945858657 2:215095695-215095717 ATATACATCCAGATGGCCTGAGG + Intronic
946650153 2:221884595-221884617 ATAGACAGACAGATAGATAGCGG + Intergenic
947766884 2:232643644-232643666 AAAAAAACACAGATGGACATTGG - Intronic
949075673 2:242055876-242055898 ATAAACAGACATGGGGACAGAGG - Intergenic
1169412943 20:5389195-5389217 ACAAACATACAGTTAGATAGAGG + Intergenic
1169875398 20:10291786-10291808 ATGAAAATACAGATGAAAAGAGG + Intronic
1169921611 20:10740363-10740385 ATATACACACACAGGGACAGAGG - Intergenic
1170442891 20:16396574-16396596 AGAGACAGAGAGATGGACAGTGG + Intronic
1170951153 20:20937690-20937712 ATAAAAATGAAGATGGAGAGTGG + Intergenic
1171144688 20:22771360-22771382 CTAAACACACTGATGAACAGTGG + Intergenic
1171472160 20:25380840-25380862 TTAAACATCCAGGTGGATAGGGG - Intronic
1171780574 20:29413599-29413621 AGAAAAGGACAGATGGACAGAGG - Intergenic
1172974761 20:38897877-38897899 GAAGACATACAGATGGACAACGG - Intronic
1173050197 20:39551952-39551974 ATAAATATACTGATGAAAAGGGG - Intergenic
1173171052 20:40724193-40724215 TTGAACAAACAGATGGACATGGG - Intergenic
1173312814 20:41915896-41915918 ATAAACATAGAGCAGGAAAGGGG + Intergenic
1173444429 20:43105079-43105101 AAACACATCCAGATGGACAGGGG + Intronic
1176117797 20:63440580-63440602 ATAAACAGACAGAGGGATCGAGG + Intronic
1176524285 21:7853688-7853710 CTAAATATACAAATGGACAATGG - Intergenic
1177571103 21:22888288-22888310 ATTAACATGCATATGGACAAGGG + Intergenic
1177944154 21:27446324-27446346 ATAGACAGACAGATAGATAGAGG + Intergenic
1178193423 21:30314267-30314289 ATATAAAGACAGATGGACAATGG - Intergenic
1178658305 21:34483701-34483723 CTAAATATACAAATGGACAATGG - Intergenic
1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG + Intergenic
1181126482 22:20704915-20704937 ATAATCAAACAGAAGGAAAGGGG - Intergenic
1181341777 22:22186687-22186709 AAAAACATACAGAAGCACAGTGG + Intergenic
1181428589 22:22861603-22861625 AGAAACATACAAATGGCCAAAGG + Intronic
1183700959 22:39450701-39450723 ATACACACACAGATGGGCAGGGG + Intergenic
949588931 3:5473106-5473128 ATAAAAATACAGATTGAGATTGG + Intergenic
949865069 3:8540746-8540768 ATACACATACAAATGCTCAGTGG - Intronic
954082396 3:48220251-48220273 ATAGAGAGACAGAGGGACAGGGG + Intergenic
955078131 3:55632988-55633010 ATAAATAGACAGGTGGACAATGG - Intronic
956008636 3:64806920-64806942 TTAAACCTACAGCTGGACATTGG - Intergenic
956265500 3:67392030-67392052 TCAAACATACAGAAGGACAGGGG - Intronic
956934428 3:74083903-74083925 TTTAACATACATATGGACACAGG + Intergenic
957084442 3:75667669-75667691 AGAAAAGGACAGATGGACAGAGG + Intergenic
957465700 3:80588002-80588024 ATAAACATATATATACACAGAGG - Intergenic
958772819 3:98446403-98446425 ATAAACATAGAGATGGGAAGAGG + Intergenic
959243267 3:103828548-103828570 ATAAACATCCACCTGGAGAGTGG - Intergenic
960827408 3:121804730-121804752 ATAAACATGCAGATGCAAAAAGG - Intronic
962649778 3:137476931-137476953 ATAAACAAATAAATGGACACAGG + Intergenic
963116760 3:141736916-141736938 AGAAACATAAATATGGACACAGG - Intergenic
964128661 3:153263737-153263759 AAAAAAAAAAAGATGGACAGTGG + Intergenic
964314054 3:155424635-155424657 CTAAATATACAGATGGACAATGG + Intronic
965041333 3:163510928-163510950 ATAAACACACTGATGTATAGTGG - Intergenic
965069066 3:163893712-163893734 ATAAACCAACAAATGCACAGTGG - Intergenic
967234548 3:187371305-187371327 ATAAAGACACAGATGTTCAGTGG - Exonic
967358394 3:188600119-188600141 ATGTACATACACATGGACATTGG + Intronic
968179305 3:196579905-196579927 ATACAAAGACAGATTGACAGAGG - Intronic
969036752 4:4260259-4260281 ATAAACACAGAGATGGAAATGGG + Intergenic
969120458 4:4905220-4905242 ACAAATATACAGTTTGACAGAGG - Intergenic
969648796 4:8450659-8450681 ATAAACACACAGATGTATTGGGG - Intronic
969694916 4:8729108-8729130 CTAGACAGACAGATGGACACTGG + Intergenic
971991937 4:33909624-33909646 AAAAACATAGAAATGGACAAAGG + Intergenic
974590302 4:63940007-63940029 ATAAACAGAGAGATGAACAAAGG - Intergenic
976805355 4:89040238-89040260 ACAAACATACAAAGAGACAGAGG + Intronic
979009471 4:115349235-115349257 ATAAACATGCAGATGAAAAAGGG + Intergenic
979089742 4:116467225-116467247 AAAAAAATACAGAGGAACAGAGG - Intergenic
979563388 4:122125614-122125636 ACAAATATACAAATGGACATAGG - Intergenic
980005606 4:127538796-127538818 CAAAACACACAGATGGCCAGTGG + Intergenic
981798353 4:148625965-148625987 AAAAACAAACATATTGACAGTGG + Intergenic
981947744 4:150368646-150368668 ATAAACATCCACATGAAAAGTGG - Intronic
982173171 4:152681002-152681024 AGAGACAGACAGATGGAGAGAGG + Intergenic
982490289 4:156021449-156021471 ATATACATCCAGATGGCCTGAGG + Intergenic
982683604 4:158461419-158461441 ATAAAGAAACAGAGGCACAGAGG + Intronic
983198830 4:164838465-164838487 AGAAACATACAGAGAGAAAGAGG - Intergenic
983304593 4:165970327-165970349 ATAAACATAAACATTCACAGTGG + Intronic
983984388 4:174040678-174040700 AGAAACATAAAGAAGGCCAGTGG + Intergenic
984920478 4:184760087-184760109 ATAAACATACTGGGGGACAGGGG - Intronic
986646397 5:9920751-9920773 ATAAACATACAAACGGGCAATGG - Intergenic
987201437 5:15581727-15581749 ATAAACAAGCAGAGGGAAAGAGG - Intronic
988715116 5:33818463-33818485 ATAAACAGACAAATGGATAAAGG - Intronic
989455194 5:41635880-41635902 ACAAAGATACAGAAAGACAGAGG + Intergenic
989584102 5:43061180-43061202 AAACACATACAGGTGGGCAGGGG + Intergenic
989773752 5:45177158-45177180 ATAAAAATAAAAATGGGCAGAGG - Intergenic
991936582 5:71808002-71808024 ATTAAAATACACATGGACATTGG + Intergenic
993279030 5:85901145-85901167 ATAAACAAATAGTTGGACACTGG - Intergenic
994280189 5:97892771-97892793 AGAGACATACAGATGAGCAGGGG + Intergenic
994495860 5:100512533-100512555 ATAAAAAAACACATGGAGAGAGG + Intergenic
994760731 5:103849662-103849684 ATAACCATATTTATGGACAGAGG - Intergenic
995414113 5:111890056-111890078 ATATACATCCAGATGGCCTGAGG - Intronic
996670892 5:126115572-126115594 CTGAATATACAAATGGACAGTGG - Intergenic
998455374 5:142268716-142268738 ATACAGAGACAGAAGGACAGGGG + Intergenic
999054502 5:148559588-148559610 CTAAACATACAAATGGACAATGG + Intronic
999871493 5:155756214-155756236 ATCAACATGCAGAAGGTCAGTGG + Intergenic
1000081548 5:157853052-157853074 ATAAGCATACAAAAGGCCAGAGG + Intronic
1000459858 5:161501028-161501050 TTAAAAATACACATGGACACAGG - Intronic
1002343155 5:178530102-178530124 TGAAACCTACAGATGCACAGCGG + Intronic
1004157865 6:13186242-13186264 ATAGACAGACAGATGGACAGTGG - Intronic
1005641244 6:27798524-27798546 ATAAAAATACAGCAGGAAAGGGG - Intergenic
1006359755 6:33580590-33580612 ATACCCATTCAGATGAACAGAGG + Intergenic
1007323966 6:41046377-41046399 CTATAAATACTGATGGACAGAGG + Intronic
1008876481 6:56335238-56335260 CTAAATATACAAATGGACAATGG + Intronic
1010950245 6:82028076-82028098 ATCAGCACTCAGATGGACAGTGG - Intergenic
1011157911 6:84354336-84354358 ATAAAAATATAGATGCACATTGG + Intergenic
1011864115 6:91800380-91800402 ATATATATATATATGGACAGAGG - Intergenic
1012259853 6:97075358-97075380 ATAAACATACAGAGAGATATAGG - Intronic
1012862254 6:104573901-104573923 ATAATGAAACATATGGACAGTGG - Intergenic
1013790793 6:113834395-113834417 ATAAAAACACAGATATACAGTGG + Intergenic
1013841632 6:114402849-114402871 AGAAAGATACAGATAGACAGTGG - Intergenic
1014961930 6:127696802-127696824 TTAGACATACACATGCACAGAGG - Intergenic
1015716039 6:136192877-136192899 GAAAACATACAGATGAACATGGG - Exonic
1016224469 6:141718413-141718435 ATAGATATACATATGGATAGGGG - Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017080485 6:150663908-150663930 ATAAACCTGGAGATGGAGAGTGG - Intronic
1018352026 6:162969892-162969914 ACAAACATGCAGATAAACAGTGG - Intronic
1019104319 6:169656411-169656433 ATAAACCTCCAGGTGGACACAGG - Intronic
1020739744 7:11999509-11999531 ATAGAGAGACAGAAGGACAGAGG + Intergenic
1023448847 7:40260209-40260231 AAAAACATACAGAAGCACAGAGG - Intronic
1025618396 7:63144447-63144469 AAAAAAATACTGGTGGACAGTGG + Intergenic
1025873635 7:65459283-65459305 ATAGAAACACAGATGGTCAGAGG + Intergenic
1026310539 7:69180071-69180093 AGAGACATACAGATGGAAAGAGG + Intergenic
1026398901 7:69988944-69988966 AGAAAAGTACAGATGGAAAGGGG + Intronic
1027141466 7:75660849-75660871 ATAAACAAAGAGATGGAGAGAGG - Intronic
1028010372 7:85635395-85635417 ATAAACAATCAGATGGTCTGTGG - Intergenic
1030550893 7:110958346-110958368 ATAAACACACAGGTGTACAAAGG + Intronic
1030565927 7:111155577-111155599 ATACACAGACAGAGAGACAGAGG - Intronic
1032891819 7:136204331-136204353 ATAAACATACATATGTATATAGG + Intergenic
1033006622 7:137571817-137571839 AGAAGAATACAGATGGAAAGAGG + Intronic
1034516782 7:151587314-151587336 ATAAACAAACAGATGGAGAAGGG + Intronic
1035421219 7:158730205-158730227 ATGGACAGACAGATGGACAAAGG + Intergenic
1035690893 8:1558647-1558669 ATAAACACACATATGCACATAGG + Intronic
1037273225 8:17152913-17152935 ATAAACATGCACATTGACACTGG + Intergenic
1037762023 8:21747814-21747836 ATAAACATGCACATGCACACAGG + Intronic
1038273907 8:26103235-26103257 ATAGATATACAGATAGATAGAGG + Intergenic
1038427768 8:27475602-27475624 AAAAATCTACAGATGGACAGTGG + Intronic
1038604660 8:28987890-28987912 ATAAACTTGGAGATGTACAGGGG + Intronic
1039266443 8:35829346-35829368 ATATACATCCAGATGGCCTGAGG - Intergenic
1040906988 8:52479439-52479461 ATAAACATACCGATGGGCCAAGG - Intergenic
1041092912 8:54319290-54319312 ATACAAGAACAGATGGACAGTGG + Intergenic
1041556296 8:59160055-59160077 ATTCACATACAGAGAGACAGAGG + Intergenic
1041824032 8:62071659-62071681 AAAGACATACAAATGGACACAGG + Intergenic
1042233712 8:66586396-66586418 GAAAACATACAAATGGACAATGG + Intronic
1043573978 8:81635854-81635876 ATGTGCATACATATGGACAGAGG + Intergenic
1044341079 8:91046975-91046997 AAAAACATAGAGAATGACAGAGG + Intergenic
1044472721 8:92589047-92589069 ATAAACATGCAGACGGACTCAGG + Intergenic
1044554844 8:93551972-93551994 ATAAACATTCATGTGAACAGAGG - Intergenic
1044606740 8:94054371-94054393 ATAAAAACACAAATGGACTGGGG - Intergenic
1045213354 8:100122031-100122053 CTGAATATACAAATGGACAGTGG + Intronic
1045507007 8:102785841-102785863 ATAATCCTAGAGATGGGCAGAGG - Intergenic
1045994703 8:108349472-108349494 ATAGATATATAGATGGATAGAGG + Intronic
1047176528 8:122546230-122546252 ATAAAAATACAACTGGAAAGAGG + Intergenic
1047443241 8:124897745-124897767 ATATACATCCAGATGGCCTGAGG - Intergenic
1052520481 9:29541759-29541781 ACAAACATACATAAGAACAGAGG + Intergenic
1053343726 9:37362358-37362380 ATAAACATACAGTTGGTCTATGG - Intergenic
1055778161 9:79789003-79789025 ATAAATATACAAATGAACAATGG - Intergenic
1057828967 9:98392806-98392828 ATGAGTAGACAGATGGACAGTGG - Intronic
1058274223 9:103020256-103020278 AAAGACATACAGATGGTCAATGG - Intergenic
1058937432 9:109781824-109781846 ATCAAAATACACATGCACAGGGG - Intronic
1060857016 9:126922576-126922598 AAAAATAAACAGATGCACAGAGG - Intronic
1061729096 9:132599719-132599741 ATAGACAGACAGACAGACAGGGG + Intronic
1062251300 9:135596516-135596538 AGAAACATACACATGGGCAATGG - Intergenic
1185538495 X:883151-883173 AGAAACAGACAGAGAGACAGAGG + Intergenic
1185538500 X:883225-883247 AGAAACAGACAGAGAGACAGAGG + Intergenic
1186326935 X:8488481-8488503 ATAGACAGATAGATGGACGGAGG - Intergenic
1186607428 X:11106706-11106728 ATAAAATTAGAGATGGCCAGAGG - Intergenic
1187037162 X:15552662-15552684 ATAAAAATTCAGATGCACACAGG + Intronic
1187101747 X:16199904-16199926 ATTAACATACACATGGAAACAGG + Intergenic
1187671984 X:21676861-21676883 ATAAACATACAGATACAGATAGG + Intergenic
1188114795 X:26229800-26229822 ATAAACATATAGATCAACAAAGG - Intergenic
1188222699 X:27559914-27559936 ATATACACACTCATGGACAGTGG - Intergenic
1188252556 X:27915567-27915589 AGAAACATACACATGGATAAAGG - Intergenic
1188477994 X:30607310-30607332 AAAAACACACAGATAGACACGGG + Intergenic
1188487009 X:30692943-30692965 ATAAGAATACAGATGGGGAGGGG + Intronic
1188592388 X:31853597-31853619 ATTCTCATACAGATGGACAAAGG - Intronic
1189136364 X:38554800-38554822 ATATAGAAACAGATGAACAGGGG + Intronic
1190732064 X:53233030-53233052 ATAGACAGACAGATGGACCCTGG - Exonic
1191007227 X:55722515-55722537 ATAAACAAAAAGTTGGACAAGGG - Intronic
1193531565 X:82660667-82660689 AGAAACATAAAGTTGGACAAGGG - Intergenic
1194234375 X:91364130-91364152 ACAAACATACAGTTAGATAGGGG - Intergenic
1194444761 X:93974259-93974281 AAAAACATACTGATGTACACAGG - Intergenic
1194521572 X:94925074-94925096 ATAAACGTATAGATCTACAGTGG + Intergenic
1194831658 X:98631062-98631084 ATAAAGAAAAAGATGGACACAGG + Intergenic
1195566181 X:106341570-106341592 ATAAACATATAGACAGACAAAGG + Intergenic
1195660538 X:107373653-107373675 ATAGATATAGATATGGACAGAGG + Intergenic
1195760542 X:108241359-108241381 ACAATCATACAGTTGGAAAGTGG + Intronic
1196118740 X:112025587-112025609 ACAAACAAACACATGGAGAGTGG - Intronic
1196598421 X:117571764-117571786 ATAAAGATACACATGGACTCTGG - Intergenic
1197308048 X:124868272-124868294 AAAAACAGACAGATAGACAGTGG + Intronic
1197841593 X:130753535-130753557 ATAAAGATAGGAATGGACAGAGG - Intronic
1198244328 X:134814945-134814967 ATTAAAACACAGATGGCCAGCGG + Intronic
1198471416 X:136950433-136950455 AAAAACATGCAGAAGCACAGAGG - Intergenic
1200021200 X:153211211-153211233 ACAAACATACAGTTAGACAGAGG - Intergenic
1200949511 Y:8880765-8880787 ACAAGCATACAGATAGATAGAGG + Intergenic