ID: 1167556500

View in Genome Browser
Species Human (GRCh38)
Location 19:50199450-50199472
Sequence GGGTATCAGCTGCAGCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 229}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167556500_1167556503 -6 Left 1167556500 19:50199450-50199472 CCTCTCTGCTGCAGCTGATACCC 0: 1
1: 0
2: 1
3: 32
4: 229
Right 1167556503 19:50199467-50199489 ATACCCACAGGACCCACAGAGGG 0: 1
1: 0
2: 2
3: 16
4: 177
1167556500_1167556504 -5 Left 1167556500 19:50199450-50199472 CCTCTCTGCTGCAGCTGATACCC 0: 1
1: 0
2: 1
3: 32
4: 229
Right 1167556504 19:50199468-50199490 TACCCACAGGACCCACAGAGGGG 0: 1
1: 1
2: 3
3: 13
4: 232
1167556500_1167556502 -7 Left 1167556500 19:50199450-50199472 CCTCTCTGCTGCAGCTGATACCC 0: 1
1: 0
2: 1
3: 32
4: 229
Right 1167556502 19:50199466-50199488 GATACCCACAGGACCCACAGAGG 0: 1
1: 0
2: 2
3: 15
4: 166
1167556500_1167556507 5 Left 1167556500 19:50199450-50199472 CCTCTCTGCTGCAGCTGATACCC 0: 1
1: 0
2: 1
3: 32
4: 229
Right 1167556507 19:50199478-50199500 ACCCACAGAGGGGTCAGCCCTGG 0: 1
1: 0
2: 1
3: 19
4: 206
1167556500_1167556510 15 Left 1167556500 19:50199450-50199472 CCTCTCTGCTGCAGCTGATACCC 0: 1
1: 0
2: 1
3: 32
4: 229
Right 1167556510 19:50199488-50199510 GGGTCAGCCCTGGACAGCCAAGG 0: 1
1: 0
2: 5
3: 36
4: 335

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167556500 Original CRISPR GGGTATCAGCTGCAGCAGAG AGG (reversed) Intronic
900314878 1:2051519-2051541 GGGTGGCTGCTGCTGCAGAGAGG + Intronic
900417808 1:2543101-2543123 GGGGACCTGCTGCAGCACAGTGG + Intergenic
900506316 1:3031397-3031419 GGGTGTCAGCAGCAGCGGAAGGG + Intergenic
900701092 1:4049096-4049118 GGGTATCAGCTGAAGCAGCTCGG + Intergenic
901401039 1:9015187-9015209 GGTCAGCAGCTGCAGCAGGGCGG + Exonic
902236886 1:15063406-15063428 GGGTATCTGCTTCAGGAGATGGG + Intronic
902274132 1:15327045-15327067 GTGCTCCAGCTGCAGCAGAGAGG - Exonic
904157447 1:28496386-28496408 GAGTATCAGATGCAACAGAAAGG + Intronic
904266036 1:29319041-29319063 GGGTGTCAGCTGAAGGGGAGGGG + Intronic
904404162 1:30275242-30275264 AGGTATCAGCTGCAGTGGGGAGG - Intergenic
905035058 1:34912815-34912837 GGGTATGAGCTGCAGGTCAGAGG - Intronic
906533695 1:46539420-46539442 GGAAATCAGCTGCTGCACAGGGG + Intergenic
906656219 1:47550089-47550111 TGGTATCAGTTGCAGCAGCTTGG - Intergenic
907126641 1:52056366-52056388 GGGTCTCACCTGAAGCAGGGAGG - Exonic
911876574 1:103171294-103171316 TGTAATGAGCTGCAGCAGAGGGG + Intergenic
913119861 1:115729973-115729995 GGCTGTGAGGTGCAGCAGAGTGG + Intronic
914705996 1:150170357-150170379 TGGTGTCATCTGTAGCAGAGAGG + Intergenic
915362539 1:155294795-155294817 GGGGCACAGTTGCAGCAGAGAGG + Intronic
915500715 1:156315071-156315093 GGGTGTCAGAGGCAGAAGAGTGG - Intronic
915531530 1:156505037-156505059 TGGTGGCAGCTGCAGGAGAGTGG + Intergenic
915999895 1:160605828-160605850 GAGCATCAGCTGCAGCAGTACGG + Intergenic
917461611 1:175235051-175235073 GGGCATCAGCTGTAGTAGTGTGG - Intergenic
918219130 1:182419639-182419661 GACTATCATCTGCAGCTGAGTGG - Intergenic
921291822 1:213664490-213664512 CAGTAGCAGCTGCAGCAGAAGGG - Intergenic
923091231 1:230742883-230742905 GGGAAACAGCTGGATCAGAGTGG + Intergenic
923837372 1:237627807-237627829 AGAAATCAGCTGCTGCAGAGTGG - Exonic
924886938 1:248229066-248229088 GGATATCAGCAGAAGCAGGGTGG + Intergenic
1064284380 10:13979881-13979903 GAGTTTCAGCTGCACCAGGGTGG - Intronic
1066950734 10:42113143-42113165 GGGAAAAAGCTGCAGCAGCGGGG + Intergenic
1066950744 10:42113184-42113206 GGGAATAAGCTGCAGCGGCGGGG + Intergenic
1067658980 10:48219437-48219459 GTGTATCAGTAGGAGCAGAGAGG - Intronic
1070290453 10:75110430-75110452 GGGTATGAGCTGCAGTGGGGAGG + Intronic
1070793296 10:79202601-79202623 TGGTATGAGCTTCAGCAGGGTGG - Intronic
1072258146 10:93640675-93640697 GGGACTCATCTGCAGCGGAGAGG - Intronic
1072340172 10:94439618-94439640 GGTTTCCAGCTGCTGCAGAGTGG - Intronic
1073031396 10:100529199-100529221 GGTGAGCAGCTGCAGCTGAGAGG - Intronic
1073432807 10:103497636-103497658 GGGAATCACCAGCAGCAGAGTGG - Intronic
1073516536 10:104080746-104080768 GGTTATCAGCTTCAACAGTGGGG - Intronic
1074880348 10:117652317-117652339 GGACATCAGCTCCATCAGAGAGG + Intergenic
1075475065 10:122727433-122727455 GGCTCACAGCTGCAGCAGAGGGG - Intergenic
1075638032 10:124043667-124043689 GGGGTTAAGCTGGAGCAGAGAGG + Intronic
1076372957 10:129966865-129966887 GGGCAGGAGCAGCAGCAGAGGGG + Intergenic
1076593395 10:131607784-131607806 GGAGATCAGCAGCAGCACAGCGG + Intergenic
1076837105 10:133026689-133026711 GGCTCTCAGCTGCAGCTGAGTGG + Intergenic
1078667731 11:13340293-13340315 GGGTGACAGCTGCTGCTGAGGGG - Intronic
1079121448 11:17688149-17688171 GGGCACCAGCGTCAGCAGAGCGG + Intergenic
1083258773 11:61511894-61511916 GGGTAGGAGCTGCAGCTGACTGG + Intergenic
1083858242 11:65404538-65404560 GGGAGCCAGCTGCTGCAGAGAGG - Intronic
1083970751 11:66072855-66072877 GGCAAGGAGCTGCAGCAGAGGGG + Intronic
1084326979 11:68406173-68406195 GGGTATCAGTAACAGCAGTGCGG - Intronic
1084706812 11:70820495-70820517 GGGCATCTGCTGCAGCAGCTGGG + Intronic
1084925795 11:72510462-72510484 GGGCATTAGCTGGAGCAGGGTGG + Intergenic
1085666312 11:78417940-78417962 GGGGAGCAGCTGCAGCAGGAAGG + Intronic
1085869272 11:80330195-80330217 GGGTTTATGCTGCAGCAGAGAGG + Intergenic
1086728894 11:90223325-90223347 GGGTATCTCCTGCAGCAAAGTGG + Exonic
1089489540 11:118873383-118873405 GGGTATAAGCTACCGCAGAGTGG + Intergenic
1089796173 11:120983100-120983122 GGGTATCTGCTGCAGCTGCAGGG - Intronic
1090710761 11:129382838-129382860 GGGTGCCACCTGCAGCACAGTGG - Intronic
1092832814 12:12461688-12461710 GCATTTCAGCAGCAGCAGAGTGG + Intronic
1093406754 12:18813727-18813749 GGCTAGCAGCAGCAGCAGTGGGG + Intergenic
1093652067 12:21657515-21657537 GGGTAGCAGCTGCGGCTCAGCGG - Exonic
1093948413 12:25136032-25136054 GGGCATCAGCTGCGGTAGTGTGG - Intronic
1096121690 12:49092816-49092838 GGTTGCCACCTGCAGCAGAGTGG - Intronic
1097982704 12:65750858-65750880 TGGTATCAGCTGAAGCAAAGTGG + Intergenic
1100416664 12:94385112-94385134 GGGTATCAACAGAAGTAGAGTGG - Intronic
1102848609 12:116216135-116216157 GGGTTTCAGGGGCAGAAGAGAGG - Intronic
1103512361 12:121484129-121484151 GGGAAGCACCTGCAGGAGAGGGG - Intronic
1103861236 12:124015976-124015998 TGCTGTCAGCTGAAGCAGAGGGG + Intronic
1103973636 12:124688030-124688052 GGGGAGCAGCTGCAGAGGAGGGG - Intergenic
1105472773 13:20706896-20706918 GAGTGGCAGCTGCAGCAGGGTGG + Intronic
1107542400 13:41403336-41403358 GTGTGCCAGCTGCAGCAGGGTGG + Intergenic
1107702004 13:43058240-43058262 GAGCATCAGCTGCAGCAGTATGG + Intronic
1108844356 13:54659968-54659990 GGGGATCACCTGAAGCACAGGGG - Intergenic
1110624494 13:77637632-77637654 GGGGATCACCAGCAGCAGAGGGG - Intronic
1111158294 13:84357811-84357833 GAGTATAAGCTGCATCAGAATGG - Intergenic
1119647938 14:76361911-76361933 GGGGATGAGATGGAGCAGAGAGG + Intronic
1120970953 14:90206585-90206607 GGGCATTAGAAGCAGCAGAGTGG - Intergenic
1121262631 14:92577515-92577537 CGGCAGCAGCAGCAGCAGAGAGG + Intronic
1122711418 14:103661197-103661219 GAGTATGAGCTGCAGAGGAGAGG - Intronic
1122871326 14:104640409-104640431 CGGGGGCAGCTGCAGCAGAGGGG - Intergenic
1123756310 15:23400096-23400118 GGGTACCATGTGCAGCAGAAGGG + Intergenic
1123782949 15:23645303-23645325 GGGTCTCTGAGGCAGCAGAGGGG + Exonic
1123837837 15:24214005-24214027 GTGTATCAGCTCCAGGAGAGAGG + Intergenic
1123847368 15:24316304-24316326 GTGTACCAGCTCCAGGAGAGAGG + Intergenic
1123866362 15:24523373-24523395 GTGTACCAGCTCCAGGAGAGAGG + Intergenic
1125709889 15:41776022-41776044 GAGGATCATCTGCAGCTGAGTGG - Intronic
1128249422 15:66153978-66154000 GGGTATCAACAGCTGCAGGGGGG + Intronic
1129071103 15:72952314-72952336 GGGATTCATCTGCAGAAGAGAGG + Intergenic
1132061559 15:98696707-98696729 GGCTGTCATCTGGAGCAGAGTGG + Intronic
1132383863 15:101386216-101386238 GGGGAGCTGCTGCAGCTGAGGGG + Intronic
1132882100 16:2167045-2167067 GGGGATCACCAGCAGCAAAGAGG - Intronic
1136567597 16:31079568-31079590 GGGTAGCAGCGGGAGCAGACAGG - Exonic
1141138284 16:81480875-81480897 GGACCTCAGCTGAAGCAGAGTGG + Intronic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1142373003 16:89693384-89693406 CGAAATCCGCTGCAGCAGAGAGG - Exonic
1142698925 17:1648156-1648178 GGGTTGCAGCTGCAGCAGCCAGG - Intronic
1143081657 17:4386012-4386034 GGATATCAGCTGCATCTGATTGG - Intergenic
1144546161 17:16197892-16197914 GGGTAGCAGCTGGAGAAGAAGGG - Intronic
1145300230 17:21629377-21629399 GGGTAACAGCTGGAGGAGAAGGG + Intergenic
1145350051 17:22073875-22073897 GGGTAGCAGCTGGAGGAGAAGGG - Intergenic
1146358922 17:32158902-32158924 GGCCATCAGCTGCAGCAGGGAGG + Intronic
1146972323 17:37083111-37083133 GGCTACCAGCTGCGGCAGGGTGG - Intergenic
1147236124 17:39058874-39058896 GGGTGTCAGCAGCTGTAGAGAGG + Intergenic
1148209781 17:45801127-45801149 GGGTAGCAGCTGCTGCAGGCTGG + Intronic
1149978173 17:61287309-61287331 TGGTAGATGCTGCAGCAGAGAGG + Intronic
1150982425 17:70157386-70157408 GGGCATCTGCTGCCACAGAGAGG - Intergenic
1151039247 17:70839647-70839669 GGGTTATAGCTTCAGCAGAGAGG + Intergenic
1151309518 17:73284953-73284975 GGGAAGCAGCTGCAGCAGGAGGG - Exonic
1151576131 17:74953435-74953457 TGGGGTCACCTGCAGCAGAGGGG - Intronic
1152332198 17:79679759-79679781 GGAACGCAGCTGCAGCAGAGTGG - Intergenic
1155064545 18:22257169-22257191 GAGTAACAGCAGCAGAAGAGTGG - Intergenic
1157026235 18:43847320-43847342 GGCAATCAGCTACATCAGAGAGG - Intergenic
1157102648 18:44744330-44744352 GGTTATCAGCTGCAGAACAACGG - Intronic
1157780109 18:50430806-50430828 GGGTTCCAGCAGCAGCTGAGAGG + Intergenic
1158456610 18:57613804-57613826 GGTTCTGAGCTGCAGTAGAGGGG - Intronic
1160190203 18:76709001-76709023 GGGTCACAGCTGCAGAGGAGGGG + Intergenic
1160981931 19:1820166-1820188 GGGTCACAGCTGCGGCTGAGAGG + Intronic
1161125850 19:2556702-2556724 GGGTCTCAGCTGCAGGAAGGCGG + Intronic
1163527938 19:17832617-17832639 GTGAAACAGCTGCAGCACAGCGG - Exonic
1167414855 19:49364649-49364671 GGATAGGAGCTGCAGCGGAGGGG - Exonic
1167556500 19:50199450-50199472 GGGTATCAGCTGCAGCAGAGAGG - Intronic
925193085 2:1901028-1901050 GGGTTTCTTCTGGAGCAGAGAGG - Intronic
925772201 2:7293729-7293751 GGGTGTGTACTGCAGCAGAGTGG + Intergenic
925818123 2:7773351-7773373 GGGTATCAGCAGCATCGGAAGGG + Intergenic
928537077 2:32251315-32251337 GGCAATTCGCTGCAGCAGAGTGG + Exonic
928759363 2:34563667-34563689 GGGTATCAGCTGAATAAGTGAGG - Intergenic
930233880 2:48870626-48870648 AGGTGCTAGCTGCAGCAGAGAGG + Intergenic
931171025 2:59803959-59803981 GGGTCTCCGCTGGAGCAGAGGGG - Intergenic
932774898 2:74522471-74522493 GGGTGGCAACTGGAGCAGAGAGG + Intronic
934780720 2:96968222-96968244 GGGAATGAGCAGGAGCAGAGGGG - Intronic
936809205 2:116375836-116375858 GGGTATAAGCTCCATGAGAGTGG + Intergenic
937233692 2:120417843-120417865 TGGGATCAGCTTCATCAGAGGGG - Intergenic
937680533 2:124639937-124639959 GAGTATCTGCAGCAGCAAAGGGG - Intronic
937919181 2:127118282-127118304 GGGTCTCAGCACCAGCAGGGTGG + Intergenic
939637472 2:144599997-144600019 GGATATCAGTTCCAGGAGAGTGG + Intergenic
939701891 2:145402202-145402224 AGGTATAAGATGCAGCAAAGAGG - Intergenic
940703764 2:157078256-157078278 GCCTACCAGCTGCAGCAGACAGG - Intergenic
942067941 2:172289355-172289377 GGGTATCAGATGCATCAAAGGGG + Intergenic
942445618 2:176075638-176075660 GGGTGACAGCTGCTGCAGGGAGG - Intergenic
946577289 2:221089474-221089496 GGGGATCAGCTGAAGCCGAGAGG - Intergenic
947118379 2:226795330-226795352 CGGTAGCAGCAGCAGCAGCGAGG - Exonic
948365486 2:237451992-237452014 GGGTCTCAGCTGCAGCAGGAAGG - Intergenic
948920234 2:241062929-241062951 GGGTGACAGCTGCAGCACACTGG + Intronic
1169810552 20:9605121-9605143 GGGCATCTGCTGCAGCACAGAGG - Intronic
1170652938 20:18259423-18259445 GGCTTTCAGCTGCAACAGAAGGG - Intergenic
1170882651 20:20310797-20310819 TGGTGTCAGCTGTAGCAGAAGGG - Intronic
1170928308 20:20745549-20745571 GGGTCTCAGCTGCATCACTGTGG - Intergenic
1171447305 20:25214020-25214042 GGGCTTCAGCTGCAGCACCGGGG - Intronic
1171560326 20:26118885-26118907 GGGTAGCAGCTGGAGGAGAAGGG - Intergenic
1172048503 20:32098740-32098762 GGGTATCAGCTGAATCAACGAGG + Intronic
1172095386 20:32457680-32457702 GGGGACCTGCTGCAGCCGAGGGG - Intronic
1172328639 20:34057976-34057998 GTGTCTCAGCTGCAGGAGAAAGG - Intronic
1172443266 20:34980026-34980048 GGGGAGCAGCTGTAGCAGTGCGG + Intronic
1173179746 20:40796825-40796847 GGGCAGGAGCAGCAGCAGAGTGG - Intergenic
1174371303 20:50089994-50090016 AGGTGCCAGCAGCAGCAGAGGGG + Intronic
1175314516 20:58038250-58038272 GGGTGTGAGCTGCTGCACAGGGG + Intergenic
1175745141 20:61451308-61451330 GCGTCTCAGCTGCGTCAGAGTGG + Intronic
1176411357 21:6451078-6451100 GGGTCTCTGCTGCACCAGTGAGG - Intergenic
1176650843 21:9545525-9545547 GGGTAGCAGCTGGAGGAGAAGGG + Intergenic
1179686850 21:43059400-43059422 GGGTCTCTGCTGCACCAGTGAGG - Intronic
1180215055 21:46318434-46318456 GGGCAGCAGCTGAGGCAGAGGGG + Intronic
1180718456 22:17888627-17888649 GGGGAACAGCTGCAGTAGCGCGG + Intronic
1180904669 22:19401017-19401039 GGCTCTCAGCTGGAGGAGAGAGG - Intronic
1180961622 22:19764920-19764942 GGGAATCAGCTCCAGCGGTGGGG - Intronic
1180966226 22:19789236-19789258 AGGTCCCAGCTGCAGGAGAGGGG + Intronic
1181498257 22:23300580-23300602 GGGGAACAGCTGCTGCAGAGTGG + Intronic
1181747060 22:24962823-24962845 CCGTATCAGCTACAGCAGAAGGG - Intronic
1183574860 22:38681779-38681801 GGGCATTAGCAGCAGCTGAGAGG - Intergenic
1184288714 22:43486773-43486795 GGGGTCCAGATGCAGCAGAGGGG + Intronic
1184322844 22:43756306-43756328 GTGCTGCAGCTGCAGCAGAGAGG - Intronic
949739283 3:7211828-7211850 TACTGTCAGCTGCAGCAGAGGGG - Intronic
950168062 3:10816337-10816359 GGGTGGCGGCTGCAGCAGCGGGG + Exonic
950674469 3:14546232-14546254 GGGTACCAGGAGCAGCTGAGGGG + Intergenic
950953287 3:17023989-17024011 GAGGATGAACTGCAGCAGAGAGG - Intronic
952354437 3:32571009-32571031 GGGCTTCAGTTGCAGCATAGCGG - Intergenic
953346205 3:42178057-42178079 GGGAAACAGATGCAGCAGAAAGG - Intronic
953866175 3:46585194-46585216 TGAGATCAGCTGCAGGAGAGGGG - Intronic
954775837 3:53017703-53017725 AGGTATAAGCTGCAGGAGAAGGG - Intronic
958161109 3:89817978-89818000 GTGTGCCAGCTGCAGCAGGGTGG + Intergenic
961456766 3:127028368-127028390 GGGTGTGTGCTGGAGCAGAGGGG + Intronic
965205105 3:165712516-165712538 GAGTGCCAGCTGCAGCAGGGTGG + Intergenic
965637102 3:170793683-170793705 GGACAGGAGCTGCAGCAGAGTGG - Intronic
968510456 4:993258-993280 AGATCTCAGCTGCAGCAGAGGGG - Intronic
972714643 4:41633361-41633383 GAGTATCAGCTGCATGACAGAGG + Intronic
974483954 4:62482496-62482518 GGCTTTCAGCTGTAGCAGAAAGG + Intergenic
976522630 4:86047137-86047159 GGGTTTCATATGTAGCAGAGGGG - Intronic
978318959 4:107472161-107472183 TGGGACCAGCTGCAGCAGTGGGG + Intergenic
978964703 4:114726104-114726126 TGGTACCAGCTGCAGCAGGGAGG - Intergenic
980745109 4:137002067-137002089 GCATGTCAGCTGCAGCAGGGTGG - Intergenic
981205149 4:142032266-142032288 GGCTACCAGGGGCAGCAGAGAGG + Intronic
981645238 4:146991489-146991511 GACTATCAGCTACAGCAGAGTGG - Intergenic
981650015 4:147046737-147046759 GGTTCTCAGCTGCAGAAGATGGG - Intergenic
984843621 4:184091491-184091513 GGGAATCAGCTCCATCAGTGGGG + Intronic
987572905 5:19687878-19687900 GGGTATCAGCTGTGGCAGGTAGG - Intronic
988753321 5:34215499-34215521 GGGGTTCAGCAGCAGCAGTGTGG - Intergenic
990284935 5:54291926-54291948 GGGTATCAGATGCTGAAGAGTGG - Intronic
990747493 5:58974927-58974949 GGTCATCAGGTGCAGGAGAGGGG + Exonic
991741101 5:69676346-69676368 GGGATTCAGCAGCAGCAGTGTGG - Intergenic
991756517 5:69878096-69878118 GGGATTCAGCAGCAGCAGTGTGG + Intergenic
991792675 5:70256083-70256105 GGGATTCAGCAGCAGCAGTGTGG - Intergenic
991820561 5:70552419-70552441 GGGATTCAGCAGCAGCAGTGTGG - Intergenic
991835919 5:70754009-70754031 GGGATTCAGCAGCAGCAGTGTGG + Intergenic
991885125 5:71256391-71256413 GGGATTCAGCAGCAGCAGTGTGG - Intergenic
997490041 5:134267465-134267487 AGGTATCAACTTCAGCTGAGTGG - Intergenic
997601574 5:135142104-135142126 AGGTATCAGCTGCAGGAGGCAGG + Intronic
999244168 5:150144575-150144597 GGGTGTTTGCTGCAGGAGAGCGG - Intronic
1000457801 5:161473654-161473676 GGGTAAGAGCAGCAGGAGAGAGG - Intronic
1001064921 5:168529120-168529142 GCGTCTCTGCTGCAGGAGAGGGG - Exonic
1004170393 6:13291428-13291450 GGCTTTCAGCGGAAGCAGAGGGG + Intronic
1004386658 6:15178887-15178909 GGGAATCACCTGAACCAGAGAGG + Intergenic
1005551489 6:26922322-26922344 GGGATTCAGCAGCAGCAGTGTGG - Intergenic
1007534729 6:42576424-42576446 GGGCAGCAGCAGCAGCAGAATGG - Intronic
1009705170 6:67239815-67239837 TGGCATCAGCACCAGCAGAGTGG - Intergenic
1011295967 6:85826916-85826938 GGATACCAGCTGCAGCAGGCAGG - Intergenic
1011791226 6:90901306-90901328 TAGTGTCAACTGCAGCAGAGCGG - Intergenic
1011792062 6:90909249-90909271 GGGTATCATCTGGAGAAGACAGG - Intergenic
1012260138 6:97079254-97079276 GGGTCTCATCTGCAGCAGAGTGG - Intronic
1013192455 6:107815178-107815200 TGGTAACAGCTTCTGCAGAGGGG + Intronic
1016272266 6:142302250-142302272 GTGGAGCAGCGGCAGCAGAGCGG + Exonic
1016357373 6:143233066-143233088 GGATATCAACTCCACCAGAGAGG - Intronic
1017740447 6:157401771-157401793 AGGTCTCAGCTGCAGTAGTGAGG + Intronic
1019573809 7:1726551-1726573 GTGTGGCAGCTGCTGCAGAGGGG + Intronic
1019876020 7:3811614-3811636 GGCCAACAGCAGCAGCAGAGAGG - Intronic
1020570846 7:9859158-9859180 GGGGAGCAGCTGCTGCAGAGGGG - Intergenic
1021561361 7:21971859-21971881 GAGCAGCAGCTGCAGCAGAGAGG - Intergenic
1022459864 7:30594962-30594984 CGGCAGCAGCAGCAGCAGAGCGG - Exonic
1023178225 7:37454343-37454365 GTGGAACAGCTGGAGCAGAGGGG - Intergenic
1025277520 7:57596475-57596497 GGGTAGCAGCTGGAGGAGAAGGG + Intergenic
1026234179 7:68511465-68511487 GGCAATCAGCTGCAGCAGACAGG - Intergenic
1028595996 7:92546889-92546911 AGGTGCCAGCTGCAGCAGGGAGG + Intergenic
1029981761 7:104885689-104885711 GGGTAAGAGTTGAAGCAGAGAGG - Intronic
1034452422 7:151144108-151144130 GGATTTGAGCTGCAGCAGAGAGG + Exonic
1037813237 8:22098739-22098761 GGGGATCAGCTGCAGCCTTGGGG - Intronic
1037815623 8:22110173-22110195 GCGCACCATCTGCAGCAGAGAGG - Intergenic
1041096805 8:54358401-54358423 GGTTATCAGGTGCTGCAGGGAGG - Intergenic
1041911508 8:63093813-63093835 GGGTTTCAGCTGCAGAATAGGGG - Intergenic
1042689532 8:71482872-71482894 GGGTATCAGCTGAAAGAGAGGGG + Intronic
1047764248 8:127977381-127977403 AGGTATCTCCTGCAGCAGATGGG - Intergenic
1047860242 8:128958039-128958061 GAGCATCAGCTGCACCAGATTGG + Intergenic
1048260191 8:132938682-132938704 GGGTATGAGCTGCTTCAGGGTGG + Intronic
1048433605 8:134394683-134394705 GGGGATCAGCTGAAGCAGTGAGG - Intergenic
1049381400 8:142318159-142318181 GGGTGGCGGATGCAGCAGAGGGG + Intronic
1049503584 8:142982379-142982401 TGGTACCAGCTGCAGCCGACAGG + Intergenic
1049787386 8:144457505-144457527 GTGTATCAGCATCTGCAGAGGGG - Intronic
1050019708 9:1270109-1270131 GGGAAGCAGATGAAGCAGAGAGG - Intergenic
1052307222 9:27023999-27024021 GGGCATCAGCTGCAGTAGTATGG - Intronic
1053707590 9:40770028-40770050 GGTCCTCAGCTGCAGGAGAGTGG + Intergenic
1054417503 9:64890814-64890836 GGTCCTCAGCTGCAGGAGAGTGG + Intergenic
1056854256 9:90111670-90111692 TGATTTCAGCTTCAGCAGAGAGG - Intergenic
1057119462 9:92558644-92558666 AGGCATCAGCTGTAGTAGAGTGG + Intronic
1058560863 9:106227527-106227549 AGGTAGCAGCTGCAGCATTGTGG + Intergenic
1059041740 9:110822459-110822481 GGGTACCAGCTGGACCACAGTGG + Intergenic
1059125218 9:111678341-111678363 GGGTATGAGGAGCAGCAGAATGG - Intergenic
1059350094 9:113658391-113658413 AGGTATTGGGTGCAGCAGAGTGG - Intergenic
1060970885 9:127737198-127737220 GGGTCACAGCAGCAGCAGAGTGG - Intergenic
1061521489 9:131120838-131120860 GGGGATCAGCTGGGGCAGCGGGG - Exonic
1061593235 9:131612416-131612438 TGGAAACAGCTGCATCAGAGTGG + Intronic
1203628577 Un_KI270750v1:49075-49097 GGGTAGCAGCTGGAGGAGAAGGG + Intergenic
1191914860 X:66190446-66190468 GAGCATCAGATGCATCAGAGGGG + Intronic
1194141682 X:90217256-90217278 GGAGAGCAGCTGCAGCAGAGAGG + Intergenic
1197796158 X:130300139-130300161 TGGTATCGGCTGCAGCAGGGAGG - Intergenic
1200143625 X:153914218-153914240 GGGTGCCAGCTGGAGCAGTGGGG + Intronic
1200487434 Y:3786358-3786380 GGAGAGCAGCTGCAGCAGAGAGG + Intergenic