ID: 1167561282

View in Genome Browser
Species Human (GRCh38)
Location 19:50227406-50227428
Sequence CTCACTACCAGGGTTTTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 106}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167561279_1167561282 -4 Left 1167561279 19:50227387-50227409 CCGGGGAAGCACAGAGAGACTCA 0: 1
1: 1
2: 22
3: 547
4: 8896
Right 1167561282 19:50227406-50227428 CTCACTACCAGGGTTTTCACTGG 0: 1
1: 0
2: 0
3: 11
4: 106
1167561278_1167561282 -3 Left 1167561278 19:50227386-50227408 CCCGGGGAAGCACAGAGAGACTC 0: 1
1: 0
2: 2
3: 49
4: 824
Right 1167561282 19:50227406-50227428 CTCACTACCAGGGTTTTCACTGG 0: 1
1: 0
2: 0
3: 11
4: 106
1167561274_1167561282 27 Left 1167561274 19:50227356-50227378 CCAGGTGCGACAACACTTATGAA 0: 1
1: 0
2: 0
3: 0
4: 37
Right 1167561282 19:50227406-50227428 CTCACTACCAGGGTTTTCACTGG 0: 1
1: 0
2: 0
3: 11
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167561282 Original CRISPR CTCACTACCAGGGTTTTCAC TGG Intronic
901259504 1:7861294-7861316 CTCTCTCCCAGGGGTTTAACAGG - Intergenic
905603257 1:39272300-39272322 CTCCCTAACAGGCTGTTCACAGG + Intronic
905630234 1:39514473-39514495 CTCACTCTCCGGGTTGTCACAGG + Intronic
905667526 1:39771717-39771739 CTCACTCTCCGGGTTGTCACAGG - Intronic
907882731 1:58566063-58566085 CACCCTAGCAGGGTTTTCAAAGG + Intergenic
911174544 1:94806040-94806062 CTCAATGCCAGGGTTTTACCAGG + Intergenic
923795790 1:237154114-237154136 CTTCCCACCAGGGATTTCACTGG - Intronic
1067938686 10:50634049-50634071 CTAGCAACCAGTGTTTTCACAGG + Intergenic
1068364834 10:56034204-56034226 CTTAGTACCAGAGTTGTCACGGG + Intergenic
1068785390 10:60967150-60967172 CTCTTTACCTGGATTTTCACAGG - Intronic
1071037567 10:81265476-81265498 CTCACTAACAGTCTTTTCCCGGG + Intergenic
1072748086 10:97955967-97955989 CTCACTACAAGGTTATTCAGAGG - Intronic
1075558836 10:123453438-123453460 CTCATTCCCTGGGTGTTCACTGG + Intergenic
1079576577 11:22010971-22010993 TTCACTATCATGGTTTTGACTGG + Intergenic
1082969934 11:59009573-59009595 CTCATTCCAAGGGTTTTCAGGGG + Intronic
1085126491 11:74005903-74005925 CTCACTACCCGGATTTTGGCCGG - Exonic
1087603329 11:100343520-100343542 CTCAGAACGCGGGTTTTCACAGG + Intronic
1096783979 12:54006743-54006765 CTCTCTGGCAGGGTTTTCGCTGG + Intronic
1105951542 13:25233547-25233569 GTGACTTCCAGGTTTTTCACAGG - Intergenic
1110914272 13:81001943-81001965 CTTACTACTAGGGTTTACCCCGG + Intergenic
1112858608 13:103802451-103802473 ATCACTTCCAGTGTTTACACAGG + Intergenic
1113649666 13:112026732-112026754 CTCCCTCCCAGGGTCTCCACGGG + Intergenic
1121517872 14:94565366-94565388 CTGACTACCAGGGCCTTCAGAGG + Intronic
1127957588 15:63866278-63866300 ATAACAACCATGGTTTTCACTGG + Intergenic
1130350683 15:83089050-83089072 TTCACTACCAGGATTTTGGCTGG - Intergenic
1131685696 15:94765368-94765390 CTTCCTACCACGGTGTTCACTGG + Intergenic
1133530305 16:6649098-6649120 CTCACTACCAGGGGGTTTGCTGG - Intronic
1138944023 16:61825500-61825522 TTCACTCCCAGGGTTTTCTGGGG - Intronic
1139204745 16:65016621-65016643 ATCATTACCAGAATTTTCACAGG + Intronic
1140338963 16:74138586-74138608 CTCACTCCCAGACTTTTCACAGG - Intergenic
1140525712 16:75621132-75621154 CTCACTACTCCAGTTTTCACTGG + Intronic
1141233808 16:82196938-82196960 CTCACCACCAGAGTTCTCTCTGG - Intergenic
1152377299 17:79925469-79925491 ATCCCTCCCAGGGTTTTCTCAGG + Intergenic
1154066637 18:11112911-11112933 CTGCCTCCCAGGGTTTTCTCAGG + Intronic
1156463696 18:37335691-37335713 CTGAACATCAGGGTTTTCACAGG + Intronic
1158045521 18:53150602-53150624 CCCTCTACCTGGGTGTTCACAGG - Intronic
1158251068 18:55488173-55488195 CTTACTCCCTGGGTTTTCATTGG + Intronic
1159135206 18:64329443-64329465 CAGACTGCCTGGGTTTTCACTGG + Intergenic
1159887167 18:73919798-73919820 CCCTCTACAAGGGTCTTCACAGG + Intergenic
1162108728 19:8388191-8388213 CTCATTCCCAGGGTGTTCATTGG - Intronic
1166764461 19:45244663-45244685 CTCACTGCCAGCCTTTTCCCCGG + Intronic
1167534380 19:50040347-50040369 CTCAGTGCCAGGGTTTTTACTGG + Intronic
1167561282 19:50227406-50227428 CTCACTACCAGGGTTTTCACTGG + Intronic
1168542133 19:57221670-57221692 CTCAGTGCCAGGGTTTTTATTGG + Exonic
925147674 2:1591908-1591930 CCCACTCCTCGGGTTTTCACAGG + Intergenic
929912614 2:46103541-46103563 CTCACTCCCATGTTTTTCAAGGG - Intronic
935531048 2:104233108-104233130 CTCACTACAAGGGAATTCACTGG + Intergenic
941542854 2:166808272-166808294 CTCACTATCAGGGAGTCCACAGG - Intergenic
1169067986 20:2705287-2705309 CTCCCTCCCAGGCTTTTCCCTGG - Intronic
1169906260 20:10607692-10607714 CTCACTACCAGCATTTTCAGAGG - Intronic
1172610341 20:36246363-36246385 CTCATTGCCATGGTTTACACAGG - Intronic
1174344589 20:49920692-49920714 GTCAATACCATGGTTATCACAGG + Intergenic
1174947782 20:55007433-55007455 CTCACTACCAGTTTTTCCAGGGG + Intergenic
1175233882 20:57495236-57495258 CTCACTCCCAGGTTTTGCAAAGG + Intergenic
1178703772 21:34856113-34856135 CCCTCTTCCAGGGTTTTCAGTGG - Intronic
1179425874 21:41277991-41278013 GTCACTAACAGGGTTTTGACTGG - Intronic
1182516253 22:30860735-30860757 CACCCTACCAGGGTTCCCACAGG - Intronic
1183054489 22:35295223-35295245 CTCCCCACCAGTGTTGTCACAGG + Exonic
1183087553 22:35495737-35495759 CACACTCCCAGGTTTTGCACAGG + Intergenic
1183974861 22:41505971-41505993 CTAAATACCAGGGCTTGCACTGG - Intronic
1184251381 22:43262367-43262389 CTCATTACCAGGGGCTTCCCAGG + Intronic
949898051 3:8785002-8785024 CTCCCTGCCAGGGCTTCCACAGG + Intronic
950570147 3:13794776-13794798 TTCACCACCAGGGTTTCCAGTGG + Intergenic
951448499 3:22810222-22810244 CTTACTTCCTAGGTTTTCACTGG - Intergenic
952724839 3:36573101-36573123 CCCACTACCATGGTTTTGCCAGG + Intergenic
957915569 3:86683482-86683504 CTAACTAAAAGCGTTTTCACAGG - Intergenic
963347357 3:144110994-144111016 CTCAAAACCAACGTTTTCACTGG - Intergenic
966321364 3:178704797-178704819 CTCATTCCCAGGCTATTCACAGG + Intronic
967602861 3:191410218-191410240 CCCACTACCTGGGCTTTCTCAGG + Intergenic
968869167 4:3232817-3232839 CTCGGTGCCAGGGTTTTTACTGG + Intronic
968883590 4:3315032-3315054 CTCGGTGCCAGGGTTTTTACTGG - Intronic
969209835 4:5678276-5678298 CTCAGTGCCAGAATTTTCACTGG - Intronic
970250282 4:14107769-14107791 CTGTCTTCCAGGATTTTCACTGG - Intergenic
970775891 4:19673716-19673738 CTCACCTCCAGGCTTTTCATAGG - Intergenic
971086702 4:23285947-23285969 CTCACTGCCATGGTATTCAAGGG - Intergenic
972503541 4:39698734-39698756 CCCACTTCCCGGGTTTTCTCAGG - Intronic
976868807 4:89765106-89765128 GTCATTACCAGTGTTTCCACAGG + Intronic
977740233 4:100471471-100471493 CTCAGCACCAGGGTCTTCCCTGG + Intronic
979194035 4:117898656-117898678 CTCTTTACCAAGGATTTCACTGG - Intergenic
981932141 4:150201555-150201577 CTCACTGCCAGGGATTTAACTGG - Intronic
988990493 5:36665666-36665688 CTCCCTCATAGGGTTTTCACTGG - Intronic
995348487 5:111148270-111148292 CTCACCCCCATGGATTTCACTGG - Intergenic
1000034315 5:157431764-157431786 CTCTCTAGCAGGGTTCTCTCTGG - Intronic
1000877060 5:166653424-166653446 CTCTCCACCAGAGTATTCACAGG + Intergenic
1001105191 5:168847404-168847426 TTCATTACCAGGGTCTTCAAGGG + Intronic
1001528201 5:172444097-172444119 CTCACTACCAGTGATTTCAGTGG + Intronic
1002167642 5:177358265-177358287 CTCACTGCCAGGGTTGTACCAGG - Intronic
1002354339 5:178611967-178611989 CTCACATCAAGGGTTATCACAGG + Intronic
1003829664 6:9993838-9993860 CTGAGAACCAGGGTGTTCACTGG - Intronic
1005122901 6:22410233-22410255 TTCAATAGCAGGCTTTTCACTGG + Intergenic
1005303944 6:24495782-24495804 CTCACTACCAGCCTTCTCAAGGG - Intronic
1012614384 6:101258675-101258697 CTCACTAATAGGGTTTTGATAGG - Intergenic
1016747802 6:147599767-147599789 CTCACTACCAGGCTGGTCATTGG + Intronic
1018344725 6:162888537-162888559 CTCTCTCCCTGGGTTTTCCCAGG + Intronic
1019216678 6:170448351-170448373 CTCACCACCAGGCTTTCCACAGG - Intergenic
1019216687 6:170448381-170448403 CTCACCACCAGGCTTTCCACGGG - Intergenic
1020020667 7:4865774-4865796 TTCACCACAAGGTTTTTCACAGG + Intronic
1021262993 7:18481992-18482014 TTCACTACCAGCATTTTCAAAGG + Intronic
1025031751 7:55562427-55562449 GTCACTACCAGTATTTTCAGTGG - Intronic
1028031973 7:85927313-85927335 CTCAGTGCCAGAGTTTTCACTGG + Intergenic
1037156837 8:15711145-15711167 CTCACTACCAGCATTTTCCTTGG + Intronic
1038415486 8:27391912-27391934 CTCAGAGCCAGGGTTTTCACTGG + Intronic
1043589701 8:81815383-81815405 CTCACTGCAAGGCTTTTCAAAGG + Exonic
1045902604 8:107302164-107302186 CTCACTACCAGAGTTCTAAAAGG - Intronic
1054761622 9:69010099-69010121 CTTACTACATGGGTTTTCATAGG + Intergenic
1056674078 9:88658468-88658490 CTCAAAACCTGGGTTTTCAATGG + Intergenic
1058620874 9:106881330-106881352 CTCACCACCAAGGTCCTCACAGG - Intronic
1060863543 9:126976104-126976126 CTTAATACAAGGGTTTTTACTGG + Intronic
1186421468 X:9430356-9430378 CTCCTAACCAGGTTTTTCACTGG + Intergenic
1189353741 X:40296299-40296321 CTCACTATCAGGGGATTCCCAGG - Intergenic
1190167175 X:48082881-48082903 ATCTATACCTGGGTTTTCACAGG + Intergenic
1190761419 X:53441033-53441055 CACACTGGCAGGGGTTTCACTGG - Intergenic
1193416930 X:81237045-81237067 CTCACTACCATAGCCTTCACTGG - Intronic
1195500723 X:105595456-105595478 CTGACAACCAGGGTTTTCCATGG + Intronic
1201797249 Y:17910753-17910775 GTCACTACCTGTGTTTTCAATGG - Intergenic
1201804304 Y:17995232-17995254 GTCACTACCTGTGTTTTCAATGG + Intergenic
1202358619 Y:24079778-24079800 GTCACTACCTGTGTTTTCAATGG - Intergenic
1202512159 Y:25590335-25590357 GTCACTACCTGTGTTTTCAATGG + Intergenic