ID: 1167561282

View in Genome Browser
Species Human (GRCh38)
Location 19:50227406-50227428
Sequence CTCACTACCAGGGTTTTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167561279_1167561282 -4 Left 1167561279 19:50227387-50227409 CCGGGGAAGCACAGAGAGACTCA No data
Right 1167561282 19:50227406-50227428 CTCACTACCAGGGTTTTCACTGG No data
1167561278_1167561282 -3 Left 1167561278 19:50227386-50227408 CCCGGGGAAGCACAGAGAGACTC No data
Right 1167561282 19:50227406-50227428 CTCACTACCAGGGTTTTCACTGG No data
1167561274_1167561282 27 Left 1167561274 19:50227356-50227378 CCAGGTGCGACAACACTTATGAA No data
Right 1167561282 19:50227406-50227428 CTCACTACCAGGGTTTTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167561282 Original CRISPR CTCACTACCAGGGTTTTCAC TGG Intronic