ID: 1167561341

View in Genome Browser
Species Human (GRCh38)
Location 19:50227644-50227666
Sequence CCTGAGATGCTCCCCTGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 184}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167561341_1167561345 0 Left 1167561341 19:50227644-50227666 CCTTTCCAGGGGAGCATCTCAGG 0: 1
1: 0
2: 0
3: 10
4: 184
Right 1167561345 19:50227667-50227689 ACGGCTGTTTTCTGCTCAGATGG 0: 1
1: 0
2: 1
3: 10
4: 106
1167561341_1167561347 8 Left 1167561341 19:50227644-50227666 CCTTTCCAGGGGAGCATCTCAGG 0: 1
1: 0
2: 0
3: 10
4: 184
Right 1167561347 19:50227675-50227697 TTTCTGCTCAGATGGCATATGGG 0: 1
1: 0
2: 0
3: 21
4: 154
1167561341_1167561348 18 Left 1167561341 19:50227644-50227666 CCTTTCCAGGGGAGCATCTCAGG 0: 1
1: 0
2: 0
3: 10
4: 184
Right 1167561348 19:50227685-50227707 GATGGCATATGGGCGTTTAAAGG 0: 1
1: 0
2: 0
3: 14
4: 208
1167561341_1167561346 7 Left 1167561341 19:50227644-50227666 CCTTTCCAGGGGAGCATCTCAGG 0: 1
1: 0
2: 0
3: 10
4: 184
Right 1167561346 19:50227674-50227696 TTTTCTGCTCAGATGGCATATGG 0: 1
1: 0
2: 1
3: 13
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167561341 Original CRISPR CCTGAGATGCTCCCCTGGAA AGG (reversed) Intronic
900656853 1:3762833-3762855 CCTCACCTGCTCCCCTGGAGTGG - Intronic
901823764 1:11847309-11847331 CCTGAGGTGCCTCCCTGGACCGG - Exonic
903047512 1:20575637-20575659 GATGAGACTCTCCCCTGGAATGG - Intergenic
903477193 1:23627710-23627732 ACTGAGATGTTTTCCTGGAAGGG - Intronic
903649468 1:24914057-24914079 CCTGAGATTCAAACCTGGAAAGG + Intronic
903656821 1:24954627-24954649 CCTGGGATTCTCCCCAGGACAGG + Intronic
904409079 1:30314101-30314123 CCTCAGGTGATCCCCAGGAAGGG - Intergenic
907386151 1:54126657-54126679 CCTGACATGCTCTACTGTAATGG + Intergenic
918605501 1:186420286-186420308 TCTGAGATGCTGCCCTAGAGAGG + Exonic
918741388 1:188135333-188135355 CCTGAGGTGCTCACCTCTAAAGG - Intergenic
922161342 1:223080985-223081007 CCTGGGACTCTCCCCGGGAAGGG + Intergenic
922571706 1:226638250-226638272 GCTGAGATCCTCCCCTGCAAGGG + Intronic
922672227 1:227519264-227519286 CCTGAGAGTCTCCCCTGGCCTGG + Intergenic
922962675 1:229662088-229662110 GGTGAGAGGCGCCCCTGGAAGGG + Intergenic
1062817014 10:508273-508295 CCGGAGATGCTGCTCTGGAGTGG - Intronic
1063113340 10:3055044-3055066 GCTGTGATGCTCCCAGGGAATGG + Intergenic
1063161283 10:3420738-3420760 CCTGAGTTTCTCTCCTAGAATGG - Intergenic
1063268083 10:4476020-4476042 CCTGTGAGGCTCCCTGGGAAGGG - Intergenic
1063667109 10:8069265-8069287 CCTGACATGCTCCAGTGGAGTGG + Intronic
1065868420 10:29934353-29934375 CCTGAGTTGTTCCCCAGGACTGG + Intergenic
1066491812 10:35901460-35901482 CCTGTGCTGCTGCCCCGGAAGGG + Intergenic
1068520136 10:58068668-58068690 CCTGAGAAGATCACCTGGAGGGG + Intergenic
1069357046 10:67598362-67598384 CCTGAGAGGCTCCCAGGGAAGGG - Intronic
1070147502 10:73785725-73785747 CCTGAGATTCTCGCCCGGCACGG + Exonic
1070770367 10:79078982-79079004 TGTGAAAGGCTCCCCTGGAAAGG - Intronic
1070789429 10:79180618-79180640 CCTGAGCTGCCCCTCTGGAGTGG + Intronic
1071259453 10:83906901-83906923 CCTGAGATGCCACACTGGATGGG + Intergenic
1071600059 10:86954647-86954669 TGTGAGTTTCTCCCCTGGAATGG - Intronic
1074564264 10:114562757-114562779 CCTCAGAGGCTCTCCTGGGATGG + Intronic
1075658171 10:124175372-124175394 GCTGAGATGCTACCCGGGAAGGG + Intergenic
1077090373 11:775670-775692 TCTGAGCGGCTTCCCTGGAAGGG - Intronic
1077107131 11:847122-847144 CCAGAGATGCTCCCAGAGAAGGG - Intronic
1077150522 11:1071106-1071128 CCTCAGATGCTCACCTGCCAGGG + Intergenic
1077351912 11:2096994-2097016 CCTGGGGTTCTCCCCTGGAGAGG + Intergenic
1082101511 11:48176793-48176815 CCTGAGCTGCTCCCATGAGAGGG - Intergenic
1083212179 11:61194973-61194995 AATGAGATGCTCCCCTAGGAAGG + Intergenic
1083595118 11:63915455-63915477 CTTGATTGGCTCCCCTGGAAGGG - Intronic
1083656856 11:64234180-64234202 CCTGAGGGGCTCACCTGGATGGG + Exonic
1088593182 11:111420602-111420624 CCTGTGGTTCTCCCCTGTAATGG + Intronic
1088811461 11:113395451-113395473 CCTGGGATGGGCTCCTGGAAGGG + Intronic
1089344394 11:117781504-117781526 GCTGGGATGCTCGCCTGGAATGG + Intronic
1090352627 11:126116782-126116804 CCTGGGAAGCTCCCAGGGAAGGG - Intergenic
1090832074 11:130427121-130427143 TCTGAGAGGCTCCCAGGGAAAGG - Intronic
1091453322 12:587124-587146 GCAGAGATGCTCCACAGGAAGGG - Intronic
1092231340 12:6777368-6777390 CCTGAGAAACTCCTCTGGGATGG - Exonic
1093011447 12:14111547-14111569 CCTGAGAGGACCACCTGGAAGGG - Intergenic
1094266906 12:28569773-28569795 CAGGAAATGCTCCCTTGGAATGG - Intronic
1096771264 12:53937474-53937496 ACGGAGATGCTCCCTTAGAAAGG + Intergenic
1098657128 12:73046233-73046255 CTTGAGATTCTCTCCTGGAGAGG - Intergenic
1102778934 12:115546736-115546758 CCTGAGAGACTCTCCAGGAAGGG + Intergenic
1106451817 13:29889013-29889035 CCTGAGCTGCTCCACGGGGATGG - Intergenic
1106669786 13:31892282-31892304 CGTGAGATGCACACATGGAAAGG + Intergenic
1106783049 13:33079040-33079062 CCTCAGATGATGCCATGGAATGG - Intergenic
1107994018 13:45842984-45843006 TCTGAGATGCTCCCCTGTGTGGG - Intronic
1108164622 13:47679112-47679134 CCTGAGATGCTCCAGTTGGAGGG - Intergenic
1108320471 13:49284850-49284872 CCTGAGATGGTGCCCTAGCAGGG + Intronic
1108693906 13:52885930-52885952 GCTGAGATGATACCATGGAAAGG - Intergenic
1111522342 13:89422770-89422792 CCTGTGATGCTCATCTGCAAAGG - Intergenic
1114411558 14:22505429-22505451 CCTGAGATGGTTCTTTGGAAAGG - Intergenic
1114577159 14:23725715-23725737 CCTGACGTGCTCCCCTGCGAGGG + Intergenic
1115795515 14:36930996-36931018 TCTGAGATGCTTCCCTGAACTGG + Intronic
1117072680 14:52069954-52069976 CCTGAGCTGCTCCGCAGGACTGG + Intergenic
1117546263 14:56797025-56797047 CCTGGGACTTTCCCCTGGAATGG - Intergenic
1118463226 14:66006050-66006072 CCTGAGATGCTGCCTTGGCAGGG - Intergenic
1120954439 14:90068959-90068981 CCTGAGATGCTCAGATGGAGAGG + Intronic
1121238311 14:92409628-92409650 CCTAACATGCTCCCCAGGATAGG + Intronic
1122421193 14:101578661-101578683 CCTGAGATCTTCCCACGGAAGGG - Intergenic
1126735267 15:51726478-51726500 CCTGTGATGCTCCCCAGGGCAGG - Intronic
1128875813 15:71200314-71200336 CCTGAGCTGCTGTCCTGGATTGG + Intronic
1129272586 15:74427276-74427298 TCTGAGCTGCTCCCTGGGAATGG - Intronic
1129336458 15:74854763-74854785 CCTGAGAAGCCTCTCTGGAAGGG + Intronic
1133187869 16:4113615-4113637 CCTGAGATCCCCCCATGGTAAGG + Intronic
1136631291 16:31490592-31490614 CCTGCGGTGCTCCCCAGAAAAGG + Exonic
1137625102 16:49902724-49902746 CCTGAGATGCTGACGTGGGAGGG + Intergenic
1137686812 16:50392083-50392105 CCTGAGTAGCACCCCTGGGAAGG + Intergenic
1141256133 16:82404103-82404125 CCCGCGATGCTGCTCTGGAAGGG - Intergenic
1141864034 16:86737521-86737543 CCTGAGAGGCTCCCATTGTATGG - Intergenic
1142510528 17:389834-389856 GCTGAGATGCGCCTCTGGAGAGG + Intergenic
1145213226 17:21031797-21031819 CCTAGGATGCTCCCCTGCACGGG + Intronic
1145787722 17:27604852-27604874 CCTGACATGCACCTCTGCAATGG - Intronic
1146227118 17:31076835-31076857 CCAGAGATGCTCCTCAGGAAGGG - Intergenic
1148837254 17:50471877-50471899 ACTAAGATGCCCACCTGGAAGGG + Intronic
1149078240 17:52622842-52622864 CCTGGGATGTTCCCCAGTAAAGG + Intergenic
1150834181 17:68549925-68549947 CCTGAAATTGTCCCTTGGAAAGG + Intronic
1150876549 17:68977137-68977159 CTTGAGAAGATCACCTGGAAAGG + Intronic
1152210149 17:78998833-78998855 CCTGAGAAGCTTCCCTGGCTGGG + Intronic
1153378043 18:4403711-4403733 GCTGAGATTGTCCCTTGGAATGG + Intronic
1154501829 18:15001198-15001220 CCTGAGGTTCTGCCCTGCAAGGG - Intergenic
1158128686 18:54129030-54129052 CCAGAGATGCTGTCTTGGAAGGG - Intergenic
1159274206 18:66194164-66194186 CCTGAGTGGCTCCCGGGGAAGGG - Intergenic
1160090578 18:75823118-75823140 CCAGAGAGGCTCCTCAGGAAAGG - Intergenic
1160362673 18:78297146-78297168 CCTGAGGAGCTCTCCTGGAGAGG - Intergenic
1160869410 19:1270190-1270212 CCTGAGGTGCCCCCCAGGACGGG + Intronic
1161170639 19:2810808-2810830 CCTCAGCTGCTTCCCTGGGAAGG + Intronic
1163615979 19:18328629-18328651 AATGAGATTCTCCCCTGGGAAGG + Intergenic
1164616009 19:29667116-29667138 CTTGAGCTGCTCCCCAGGACCGG + Intronic
1165099777 19:33432136-33432158 CCTGAGCTGCTCCACTGCACCGG + Intronic
1166500849 19:43340103-43340125 CCTGAGCTGCTCCACAGGGAGGG - Intergenic
1166509250 19:43393314-43393336 CCTGAGCTGCTCCACGGGGAGGG + Intergenic
1167561341 19:50227644-50227666 CCTGAGATGCTCCCCTGGAAAGG - Intronic
1168561069 19:57383735-57383757 GCTGAGTTGCTGCCATGGAATGG - Intronic
925944772 2:8850706-8850728 TCTGAGAAGCTCCGTTGGAAAGG + Intergenic
926853745 2:17229366-17229388 CCACACATGCTCTCCTGGAAAGG + Intergenic
927495812 2:23550894-23550916 CCTGAGAGGCGGCCCTGGGAGGG + Intronic
929426457 2:41849452-41849474 CCTGAGATGCTACACTCCAAGGG + Intergenic
930550580 2:52829945-52829967 CCTGGAACGCTCCCCTGGACAGG - Intergenic
931689516 2:64823324-64823346 CCTGAGTTGATGCCCTGGACTGG - Intergenic
932491643 2:72126707-72126729 CGTGAGTGGCTCCCCTGGAGTGG - Intergenic
936428343 2:112437305-112437327 CCTCCCATGCACCCCTGGAAAGG + Intergenic
937910974 2:127075574-127075596 CCTGACAGGCTTCCCTGGACAGG - Intronic
938501010 2:131831367-131831389 CCTGAGGTTCTGCCCTGCAAGGG - Intergenic
942253777 2:174071226-174071248 ACAGAAATGTTCCCCTGGAATGG + Intergenic
944141837 2:196465077-196465099 CCTAATATGCTCTCCTGGAGAGG + Intronic
944293918 2:198040558-198040580 CCTCAGATCCTCCTCTAGAACGG - Intronic
945688910 2:213008071-213008093 CATGAGCTTTTCCCCTGGAAGGG + Exonic
946234896 2:218318106-218318128 CCTGAGAGGTTCCCTTAGAATGG - Intronic
947375110 2:229488049-229488071 CCTTAAGTGCTCCCCTGAAATGG - Intronic
948788247 2:240364257-240364279 GCTGAGATTCTGCCATGGAACGG + Intergenic
1172599846 20:36176125-36176147 CTTGAGATGGTGCCCTGGACAGG - Intronic
1172667119 20:36607979-36608001 CCTGAGATGCTCCTGAGGAGTGG - Intronic
1173435761 20:43030948-43030970 CCTGAGACCATCACCTGGAAAGG + Intronic
1175984700 20:62758872-62758894 CCTGTGAGGCTCCTCTGGGAGGG - Intronic
1176041345 20:63067493-63067515 CCACAGATGCTCCCGTGGGAAGG - Intergenic
1176373906 21:6077906-6077928 CCTCCCATGCACCCCTGGAAAGG - Intergenic
1176901794 21:14451178-14451200 CCTGAGAAGGTCTGCTGGAAAGG - Intergenic
1179315420 21:40239911-40239933 ACTGAGATGCTCGCCTGGAGAGG - Intronic
1179749571 21:43460337-43460359 CCTCCCATGCACCCCTGGAAAGG + Intergenic
1179824673 21:43957411-43957433 CCTGACTTGGTCCTCTGGAAGGG - Intronic
1180852550 22:19028968-19028990 CCTGAAGAGCTCCCATGGAAGGG + Intergenic
1181419106 22:22785647-22785669 CCTGAGGTGCTGCCCAGGACAGG - Intronic
1182105066 22:27683217-27683239 CCTGAGATGGGGCCCAGGAAGGG + Intergenic
1182347054 22:29673692-29673714 CCAGAGAGGCCCCCCTGGAGGGG - Intronic
1183378934 22:37481004-37481026 CCTGTGGTGCTGCTCTGGAAAGG - Intronic
1183708996 22:39491508-39491530 CCTGAGCTGGTGCCCTGGAGGGG - Exonic
1184692279 22:46122800-46122822 CCGGAGATGCCCCCCTGCGATGG - Intergenic
1185102808 22:48850589-48850611 CCTGAGAGGCCCACCTGGGAGGG + Intronic
950240912 3:11369268-11369290 CCTGAGATGCAGCCCAGGAAAGG + Intronic
962979136 3:140472094-140472116 CCTGAGAAGCTCCCCTCATACGG - Intronic
967995787 3:195165344-195165366 CCTGAGATCCTCTCCCAGAAAGG + Intronic
969398470 4:6938335-6938357 CCTCACATGCTCCTCTGGAGAGG + Intronic
970703455 4:18770957-18770979 CCTGAGAGGGTCCTATGGAAGGG + Intergenic
971258898 4:25038600-25038622 CCTGAGCAGCTCCCATGGACAGG + Intergenic
990622563 5:57576495-57576517 CATGGGCTGCTCCCCTGGAGGGG + Intergenic
991632597 5:68671391-68671413 CCTAAGATGCTACCCAGGCAGGG - Intergenic
992486226 5:77199055-77199077 ACTTAGAAACTCCCCTGGAAAGG - Intergenic
1002197708 5:177510159-177510181 CCTGGGCTGCACCCCAGGAAGGG - Intronic
1002764597 6:228116-228138 CCTGGCATTCTCCCCTGGCAAGG + Intergenic
1004829391 6:19461223-19461245 CCTCGGATGCTCCCCTGAATGGG + Intergenic
1005780624 6:29187890-29187912 CCTGAGATGCTCCCCTTGTCAGG + Intergenic
1005909236 6:30293770-30293792 CCTGAGATGCTCCCCGACTAGGG - Intergenic
1006145279 6:31955238-31955260 GCAGATATGCTCCTCTGGAACGG + Exonic
1006525179 6:34598259-34598281 GCTGGGATGTTCCCCTGCAAAGG - Intronic
1009044433 6:58221012-58221034 CCTGAGATCTTCCTCAGGAAAGG + Intergenic
1013463699 6:110399553-110399575 CCTGAAATGCTCGCCCTGAAAGG + Intronic
1015039490 6:128699569-128699591 ACTGAGATTCCCCCCTAGAAAGG + Intergenic
1018810961 6:167297948-167297970 CGTGAGCTGCTCTTCTGGAAGGG - Exonic
1024062610 7:45710178-45710200 TCTGAGTGGCTCCCCTGGTAGGG + Intronic
1024113652 7:46172400-46172422 CCTGAGCTGCTCCCATGTGAGGG - Intergenic
1029441111 7:100586999-100587021 CCCGAGGAGCTCCCCTGGACAGG + Intronic
1030196688 7:106859682-106859704 CCAGAAATCCTCCCATGGAATGG - Intergenic
1030324435 7:108204527-108204549 ACTGTGAAGCTTCCCTGGAAGGG - Intronic
1034317389 7:150145264-150145286 CCTGAAGGGCTCCCCTGGAGAGG + Intergenic
1034775362 7:153821963-153821985 CCTGAAGGGCTCCCCTGGAGAGG - Intergenic
1034989889 7:155541765-155541787 CCTGAGGTCCTTCCCAGGAAGGG + Intergenic
1035098728 7:156378821-156378843 CCTGAGAGGCTCCCATGTATGGG + Intergenic
1035727477 8:1833810-1833832 CCTGTGCTGCTTCCCTGGGAGGG + Intronic
1037458260 8:19084406-19084428 CTTGGGATGCTCCCCTCCAAGGG - Intronic
1037480250 8:19298502-19298524 CATGAGATGCTGACTTGGAAGGG + Intergenic
1038869136 8:31474812-31474834 CCTGAGATTTCCCTCTGGAATGG - Intergenic
1040429456 8:47324658-47324680 CCTGAGATGCTTCCCTTAAAGGG + Intronic
1042035937 8:64533915-64533937 CCTGAGATCATACCCTGGCATGG + Intergenic
1044338767 8:91022404-91022426 CCTGATATACTACTCTGGAATGG + Intronic
1045584426 8:103516794-103516816 CCTGAGATGATCCAATGGGAAGG + Intronic
1048293889 8:133200317-133200339 CCTGAGCTCCTTCCCTGGAGGGG - Intronic
1048417233 8:134240987-134241009 TCTGAGATGATACCATGGAAGGG + Intergenic
1048888335 8:138926287-138926309 CCAGAGTTGCTCAACTGGAAGGG + Intergenic
1049446796 8:142634976-142634998 GCTGAGAGGCTATCCTGGAAGGG + Intergenic
1051102392 9:13535917-13535939 CCTGAGGAGCTCCCAGGGAAGGG - Intergenic
1052686033 9:31757195-31757217 CCTGAGATGTTAGGCTGGAATGG - Intergenic
1053464883 9:38298683-38298705 CCTGAGTTGCTGCCCTGCCAGGG + Intergenic
1054889100 9:70232647-70232669 AGTGAGACACTCCCCTGGAAAGG + Intergenic
1055350155 9:75378376-75378398 CCTGAGATTCCACTCTGGAAAGG - Intergenic
1055641063 9:78319407-78319429 CCTGAGATGGTGCCTGGGAAAGG - Intronic
1061274553 9:129561990-129562012 CTTGAGAGGCTCCCTTGGCAAGG + Intergenic
1061957568 9:133971535-133971557 CCTGAGCTGCTCCACTGGGGAGG + Intronic
1062498661 9:136843152-136843174 CCTGAGGTTCTGCCCTGCAAGGG + Intronic
1062509127 9:136895180-136895202 CCAGAGCTGCTCACCTGAAAGGG - Intronic
1185566817 X:1101259-1101281 TCTGTGATGCTCCCCTGGTGTGG + Intergenic
1185566824 X:1101299-1101321 TCTGTGATGCTCCCCTGGTGTGG + Intergenic
1185567073 X:1102899-1102921 TCTGTGATGCTCCCCTGGTGTGG + Intergenic
1187011378 X:15283797-15283819 CCTGATTTGCCCCTCTGGAAGGG + Intronic
1188101689 X:26096035-26096057 CATGAAATGCTCCACTGGCAGGG + Intergenic
1195389494 X:104346666-104346688 TGTAAGATGCTCACCTGGAATGG + Intergenic
1199713868 X:150492045-150492067 CCTGATGTTCTGCCCTGGAAGGG + Intronic
1201722291 Y:17112866-17112888 CCTGAGCTGCTTCCATGGATGGG - Intergenic