ID: 1167563950

View in Genome Browser
Species Human (GRCh38)
Location 19:50244413-50244435
Sequence GAAGGGGGATGCTCTCTACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 67}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167563950_1167563956 2 Left 1167563950 19:50244413-50244435 CCACGTAGAGAGCATCCCCCTTC 0: 1
1: 0
2: 1
3: 4
4: 67
Right 1167563956 19:50244438-50244460 GCCACACCTGTCTCCAACCCAGG 0: 1
1: 0
2: 4
3: 25
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167563950 Original CRISPR GAAGGGGGATGCTCTCTACG TGG (reversed) Intronic
906311837 1:44759921-44759943 GGAGGGGGCTGCCCTCTACAGGG + Intronic
910755171 1:90682066-90682088 GAAGGGAGATGATCTCTAAAAGG + Intergenic
923412426 1:233723646-233723668 TAAGGGGCATGCTCTTCACGGGG - Intergenic
924537378 1:244947874-244947896 GAAGGTGAAAGCTCTCTACAGGG + Intergenic
1070408758 10:76120054-76120076 AAAGGGGGCTGCTCTATATGAGG - Intronic
1074080303 10:110163163-110163185 GAAGAGGGATGCTCTGTGGGAGG - Intergenic
1074215174 10:111377126-111377148 GAAGGGGGATTCTCTATAGAAGG + Intergenic
1077263390 11:1635644-1635666 AAATGTGCATGCTCTCTACGGGG + Intergenic
1089585193 11:119506134-119506156 GATGGGGGCTGCTCTCTGCTTGG + Intergenic
1090552199 11:127833527-127833549 AGAGGGGCATGCTCTCTACTTGG + Intergenic
1092261569 12:6955866-6955888 GAAGGGGGAGGCTCTGTGGGGGG - Intronic
1106855534 13:33847408-33847430 GGAGGGGGATAATCTCTAGGAGG + Intronic
1106945997 13:34828317-34828339 GAAGGGGAAAGCTCTCGAGGAGG + Intergenic
1111242264 13:85490588-85490610 GAAGGGGAATCTTCTCTACCAGG + Intergenic
1124899882 15:33812197-33812219 GAAGGTGGAGGCTCTCCAAGTGG - Intronic
1130734776 15:86536742-86536764 GAAGAGGAATGCTTTCTAAGCGG - Intronic
1131018348 15:89076253-89076275 GAAGGTGGATGATATCTACCTGG - Intergenic
1131626926 15:94130385-94130407 GAAGGTGGAAGATCTCTACCAGG - Intergenic
1139264088 16:65623190-65623212 GAAGGGGGATTCTCCCCATGAGG + Intergenic
1142511227 17:394745-394767 GAGGGGGGATAGGCTCTACGTGG + Intergenic
1146720161 17:35118544-35118566 GAATGGCGCTGATCTCTACGAGG - Intronic
1155555623 18:27015989-27016011 AAAGGGGGATGCTCACCAAGTGG - Intronic
1155984829 18:32218780-32218802 GAAGGGGGCTGCCCTCAAAGAGG + Intronic
1161216130 19:3095797-3095819 GTGGGGGGCTGCTCTCAACGAGG - Intronic
1161700880 19:5794442-5794464 GAAGGGGTCTCCTCTCTAAGTGG - Intergenic
1165105072 19:33464407-33464429 GAAGGGGGATGAAATCTACATGG + Intronic
1167563950 19:50244413-50244435 GAAGGGGGATGCTCTCTACGTGG - Intronic
925270015 2:2598780-2598802 GAAGGGGCATTCCCTCTACATGG - Intergenic
929117387 2:38455990-38456012 GAAAGGGGATGTTCTCTCCCAGG - Intergenic
929490277 2:42390049-42390071 CAAGGGGAAGGCTCTCTATGTGG + Intronic
929810900 2:45188587-45188609 GAAGGGAAGTGCTCTCTTCGGGG - Intergenic
932094363 2:68834217-68834239 GAGGAGAGATGCTCTATACGTGG + Intergenic
936942879 2:117903719-117903741 GAAGGGGGATTCTCTGCACAGGG + Intergenic
937172393 2:119888063-119888085 GAAGGTGAATGATCTCTACAAGG - Intronic
937249201 2:120512567-120512589 GAAGGGTGCTGGTCTCTGCGTGG + Intergenic
941127142 2:161597824-161597846 GAAGGTGGAAGATCTCTACAAGG + Intronic
1170363458 20:15573700-15573722 GAAGGGGGAGGCTCACAAGGGGG - Intronic
1171126216 20:22603967-22603989 GAGGGGAGATGCTCTTTACCTGG + Intergenic
1172876886 20:38169848-38169870 GAAGGGGGATGCACTACACCTGG - Intergenic
1181446156 22:22976456-22976478 GAATAGGGATCCTCTCCACGAGG + Intergenic
1182063688 22:27415796-27415818 GGAGGGGGCTGCTTTCCACGTGG + Intergenic
949512532 3:4779367-4779389 GAAGGGGGATGCTCTCTGCCTGG + Intronic
957715819 3:83928589-83928611 GAATGGGAATCCTCTCTACGGGG + Intergenic
959377929 3:105607665-105607687 GAAGGGGGAGGCTGTTTATGGGG + Intergenic
960994204 3:123330402-123330424 GCAGGGTGATTCTCTCTAAGCGG + Intronic
962951158 3:140220242-140220264 GAAGGTGGATGATCTCCACCAGG - Intronic
967752051 3:193126331-193126353 GAAGGGGGAAGCTCTGGAAGGGG - Intergenic
973302089 4:48597465-48597487 GAAGGGGGATGCTGATTACGGGG + Intronic
979408164 4:120340520-120340542 CAAGGGGAAAGCTTTCTACGTGG - Intergenic
979712293 4:123794040-123794062 GAAGGTGAAAGATCTCTACGAGG - Intergenic
985515485 5:342791-342813 GAAGGGTGATGCCCTCTCTGAGG + Intronic
985881081 5:2639854-2639876 CAAGGGGGAGGCTCTCTACAAGG - Intergenic
992166295 5:74055364-74055386 GAAGGGGTTTGTTCTCTACCTGG - Intergenic
999908367 5:156168687-156168709 GGAGAGTGAAGCTCTCTACGAGG - Intronic
1003566638 6:7228231-7228253 GAAGGGGGATGCTGCCTAGGAGG - Intronic
1017966977 6:159275474-159275496 GAAGTGGCATGCTCTTCACGAGG + Intergenic
1028351689 7:89857462-89857484 GAATGGGGATCCTCTCCATGAGG + Intergenic
1028636282 7:92993324-92993346 GAAGGGGTACGCTCTGTAAGGGG - Intergenic
1031079777 7:117247085-117247107 GAAGGGAGCTGTTCTCAACGAGG - Intergenic
1034427331 7:151020995-151021017 TAAGGGCCATGCTCTCTAGGTGG + Intronic
1040513658 8:48117210-48117232 GAAAGGGGATGCTCTGCAGGAGG - Intergenic
1045028549 8:98113716-98113738 GAAGGGGTATGCTCTTTAGCAGG + Intronic
1045612525 8:103862666-103862688 GAAGGTGAAAGATCTCTACGAGG - Intronic
1046852018 8:118985119-118985141 GAAGGGCCATGCTCTCTCTGAGG - Intergenic
1051589064 9:18757628-18757650 GAAGAGGGAGGCTCTCTGCTGGG - Intronic
1052129643 9:24827493-24827515 GGAGGTGGAAGATCTCTACGAGG + Intergenic
1059102451 9:111483701-111483723 GAAGGGCGACGCTCGCGACGCGG - Intronic
1061616765 9:131785398-131785420 GCAGGGAGATGCTCTCCATGAGG - Intergenic
1192098433 X:68238379-68238401 GAAGGGAGATTTTCTCTACCAGG - Intronic
1192659486 X:73027193-73027215 CATGGGGAATCCTCTCTACGTGG + Intergenic
1192989878 X:76439115-76439137 GAAGGGGAAAGATCTCTACAAGG - Intergenic
1194486331 X:94491668-94491690 GAATGTAGATGCTCTCTACTCGG + Intergenic
1199311426 X:146325244-146325266 GAAGAGGGCTGCTCTCTTCCAGG - Intergenic