ID: 1167565013

View in Genome Browser
Species Human (GRCh38)
Location 19:50250635-50250657
Sequence GCCTGATCCCGCAGGTGCCT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 116}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167565013_1167565024 20 Left 1167565013 19:50250635-50250657 CCGAGGCACCTGCGGGATCAGGC 0: 1
1: 0
2: 0
3: 13
4: 116
Right 1167565024 19:50250678-50250700 ACGCGGGCAAGGTAGGGGCTGGG 0: 1
1: 0
2: 1
3: 3
4: 110
1167565013_1167565019 13 Left 1167565013 19:50250635-50250657 CCGAGGCACCTGCGGGATCAGGC 0: 1
1: 0
2: 0
3: 13
4: 116
Right 1167565019 19:50250671-50250693 CTCCACTACGCGGGCAAGGTAGG 0: 1
1: 0
2: 0
3: 3
4: 29
1167565013_1167565018 9 Left 1167565013 19:50250635-50250657 CCGAGGCACCTGCGGGATCAGGC 0: 1
1: 0
2: 0
3: 13
4: 116
Right 1167565018 19:50250667-50250689 TGTTCTCCACTACGCGGGCAAGG 0: 1
1: 0
2: 0
3: 3
4: 38
1167565013_1167565026 25 Left 1167565013 19:50250635-50250657 CCGAGGCACCTGCGGGATCAGGC 0: 1
1: 0
2: 0
3: 13
4: 116
Right 1167565026 19:50250683-50250705 GGCAAGGTAGGGGCTGGGGCCGG 0: 1
1: 0
2: 12
3: 185
4: 1261
1167565013_1167565022 15 Left 1167565013 19:50250635-50250657 CCGAGGCACCTGCGGGATCAGGC 0: 1
1: 0
2: 0
3: 13
4: 116
Right 1167565022 19:50250673-50250695 CCACTACGCGGGCAAGGTAGGGG 0: 1
1: 0
2: 0
3: 1
4: 24
1167565013_1167565020 14 Left 1167565013 19:50250635-50250657 CCGAGGCACCTGCGGGATCAGGC 0: 1
1: 0
2: 0
3: 13
4: 116
Right 1167565020 19:50250672-50250694 TCCACTACGCGGGCAAGGTAGGG 0: 1
1: 0
2: 0
3: 3
4: 23
1167565013_1167565023 19 Left 1167565013 19:50250635-50250657 CCGAGGCACCTGCGGGATCAGGC 0: 1
1: 0
2: 0
3: 13
4: 116
Right 1167565023 19:50250677-50250699 TACGCGGGCAAGGTAGGGGCTGG 0: 1
1: 0
2: 0
3: 4
4: 100
1167565013_1167565017 4 Left 1167565013 19:50250635-50250657 CCGAGGCACCTGCGGGATCAGGC 0: 1
1: 0
2: 0
3: 13
4: 116
Right 1167565017 19:50250662-50250684 TTCAGTGTTCTCCACTACGCGGG 0: 1
1: 0
2: 0
3: 2
4: 72
1167565013_1167565025 21 Left 1167565013 19:50250635-50250657 CCGAGGCACCTGCGGGATCAGGC 0: 1
1: 0
2: 0
3: 13
4: 116
Right 1167565025 19:50250679-50250701 CGCGGGCAAGGTAGGGGCTGGGG 0: 1
1: 0
2: 3
3: 14
4: 227
1167565013_1167565016 3 Left 1167565013 19:50250635-50250657 CCGAGGCACCTGCGGGATCAGGC 0: 1
1: 0
2: 0
3: 13
4: 116
Right 1167565016 19:50250661-50250683 CTTCAGTGTTCTCCACTACGCGG 0: 1
1: 0
2: 0
3: 3
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167565013 Original CRISPR GCCTGATCCCGCAGGTGCCT CGG (reversed) Exonic