ID: 1167565086

View in Genome Browser
Species Human (GRCh38)
Location 19:50250978-50251000
Sequence CCCCGAGCTGGGCACACAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 164}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167565086_1167565092 10 Left 1167565086 19:50250978-50251000 CCATTTGTGTGCCCAGCTCGGGG 0: 1
1: 0
2: 0
3: 15
4: 164
Right 1167565092 19:50251011-50251033 CTGGATACACAGATCAAACATGG 0: 1
1: 0
2: 1
3: 13
4: 156
1167565086_1167565090 -9 Left 1167565086 19:50250978-50251000 CCATTTGTGTGCCCAGCTCGGGG 0: 1
1: 0
2: 0
3: 15
4: 164
Right 1167565090 19:50250992-50251014 AGCTCGGGGCCGAGCAAAGCTGG 0: 1
1: 0
2: 0
3: 13
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167565086 Original CRISPR CCCCGAGCTGGGCACACAAA TGG (reversed) Intronic
902770953 1:18645371-18645393 CCCCGAGCGGGACAGAAAAAGGG + Intronic
903848858 1:26294437-26294459 CCCAGAGCTGACCAGACAAAGGG + Intronic
904420293 1:30386735-30386757 CCCAGTGCGGGGCACACACAGGG + Intergenic
905205719 1:36341857-36341879 CCCGGAGCTGGGTACCCAAGCGG - Exonic
906416055 1:45622064-45622086 CCAAGAGTTGGGCCCACAAATGG + Intronic
906728319 1:48060002-48060024 CACAGACCTGGGCATACAAATGG + Intergenic
907726330 1:57024055-57024077 CCCTGAGCTGGGCACACAGTAGG - Intronic
915525300 1:156472365-156472387 CCTGGGGCTGGGCACACACATGG + Intronic
915912420 1:159923239-159923261 CCCAGAGCTGGGGACCCCAAAGG + Intronic
918121761 1:181546631-181546653 CCCCAAGCTTGGCACAGAATGGG - Intronic
922966389 1:229694422-229694444 CCCCTCGCTGGCCACACTAATGG + Intergenic
1063255887 10:4326782-4326804 CCCCTAGCTGGGAAAACAAAGGG + Intergenic
1064104932 10:12492822-12492844 CCCCGAGCTGTACACAAGAACGG + Intronic
1067266626 10:44751302-44751324 GCCAGGGCTGGGCAGACAAAAGG + Intergenic
1068968024 10:62933309-62933331 GCCCAAGCTGGGCTCATAAAAGG - Intergenic
1069831300 10:71283932-71283954 CCCAGGGCTTGGCACAGAAAGGG - Intronic
1069876630 10:71567122-71567144 CACCGTGCTGAGCACTCAAAGGG + Intronic
1070762857 10:79035580-79035602 CCCAGGGCTGGGCACAGAATGGG - Intergenic
1071433874 10:85628610-85628632 CTCCTAGCTGGGCCCACCAATGG - Intronic
1071802460 10:89078868-89078890 CCCTGAGCTGGGCCCAGGAATGG - Intergenic
1072066817 10:91879514-91879536 CTCCCAGCTGGCAACACAAAGGG - Intergenic
1073445883 10:103580057-103580079 CCCAGGGCTGGGCACACAGTAGG + Intronic
1075240708 10:120775879-120775901 CTCCAACCTGGGCACACACATGG + Intergenic
1075587910 10:123670738-123670760 CGTCTAGCTGGGCACACAGATGG + Intronic
1076218359 10:128713438-128713460 CTCCGGGCTGGGCTCAGAAAGGG + Intergenic
1076821842 10:132943400-132943422 CCCCGGGGTGGGCACACTAGGGG + Intergenic
1076896663 10:133316577-133316599 CCCCGACCTGGACACAGAGATGG + Intronic
1076978822 11:194597-194619 CCCACAGAGGGGCACACAAATGG + Intronic
1077117812 11:893248-893270 CCCTGTGCTGGGCACAGAGAAGG - Intronic
1077353690 11:2104942-2104964 CCCAGAGCTGGGCCCAGGAAAGG + Intergenic
1078048901 11:7945062-7945084 ACCCAAGCTGGTCACACAATAGG - Intergenic
1081647705 11:44801451-44801473 CACAGAGCTGGGCATACAGAAGG + Intronic
1083058079 11:59842402-59842424 CCCCGAGCTGGGAACATCAGAGG - Intronic
1083198465 11:61104981-61105003 ACCAGAGCTGGGGACACCAAGGG + Intronic
1084174635 11:67416862-67416884 CCCAGGGCTGGGCACACAGTAGG + Intronic
1084655168 11:70510765-70510787 CCCTAGGCTGGGCACACAAAGGG + Intronic
1088388088 11:109281852-109281874 CTCCAAGCTGGGAACAAAAAGGG + Intergenic
1088799189 11:113289812-113289834 CCCCAACCTGGCCACCCAAATGG + Intergenic
1089767342 11:120777490-120777512 CCCCGTGCCGGGCACACAGTGGG - Intronic
1099178877 12:79455054-79455076 CCCCTACCAGGGCACACACAAGG + Intergenic
1102207483 12:111100259-111100281 CATCGAGCTGGACACACAAAGGG - Intronic
1102515260 12:113441931-113441953 CCCAGAGCTGGGCCCACACAGGG + Intergenic
1104377685 12:128279226-128279248 CCCAGAACTGGCCACATAAAAGG + Intronic
1104448915 12:128853764-128853786 TCCCGAGCCGCGCGCACAAACGG + Intronic
1104866639 12:131959885-131959907 CCCCGGGCCTGACACACAAATGG + Intronic
1113781240 13:112978885-112978907 CACCGTGCTGGGCACACACAGGG - Intronic
1119879588 14:78089991-78090013 CCCCGAGCCTGGTACAGAAAAGG - Intergenic
1121258556 14:92549603-92549625 CCAGGAGCTGGGCACACTCAAGG + Intronic
1121444283 14:93968821-93968843 CCCAAGGCTGGGTACACAAAAGG + Intronic
1121661834 14:95640816-95640838 CCCCAAGGTGGCCACACTAAAGG + Intergenic
1122261172 14:100523904-100523926 CCACCAGCTAGACACACAAATGG + Intronic
1122264341 14:100539670-100539692 CCCCTCGCTGGGCACAAAATGGG - Intronic
1122628897 14:103098510-103098532 CATCGAGCTGGGCACACAGTAGG + Intergenic
1122721993 14:103727427-103727449 CCATGAGCTGGGCACACATTAGG - Intronic
1123132293 14:105998591-105998613 CCCTGGGCTGAGCACACAGAGGG + Intergenic
1123142374 14:106093953-106093975 CCCAGGGCTGAGCACACAGAGGG + Intergenic
1123149695 14:106169156-106169178 CCCAGGGCTGAGCACACAGAGGG + Intergenic
1123196020 14:106617453-106617475 CCCAGGGCTGAGCACACACAGGG + Intergenic
1123223449 14:106878025-106878047 CCCAGGGCTGAGCACACAGAAGG + Intergenic
1123582511 15:21729703-21729725 CCCTGGGCTGAGCACACAGAGGG + Intergenic
1123619161 15:22172299-22172321 CCCTGGGCTGAGCACACAGAGGG + Intergenic
1126861702 15:52890636-52890658 CCCCGTGCTGGAAACACAATTGG - Intergenic
1127264737 15:57352360-57352382 AACCGAGCTGTGGACACAAAGGG + Intergenic
1127888144 15:63222258-63222280 CCCTTAGCTGGACAGACAAAAGG - Intronic
1128511970 15:68318936-68318958 TCCAGAGCTGGGCACATAGAAGG - Intronic
1129162394 15:73753731-73753753 CCCAGAGCTTGGCACACAGTAGG - Intergenic
1132114507 15:99125671-99125693 CTGAGAGCTGGGCACAAAAACGG - Intronic
1133304699 16:4801799-4801821 CCCCGAGGCGGGCACACAGGAGG - Intronic
1134137139 16:11684812-11684834 CACAGAGCTGGGCACACAGCTGG + Intronic
1136283564 16:29228603-29228625 CCCAGGGCTGGGCACACAGCAGG - Intergenic
1137786678 16:51143340-51143362 CCCCATGCTGGGCAAACAATGGG - Intronic
1140970303 16:80006198-80006220 CCCTGAGCTGGACACACAACAGG + Intergenic
1141598944 16:85113801-85113823 CCCACAGCTTGGCACAGAAAGGG - Intergenic
1141662316 16:85448082-85448104 CCCAGAGCTGGGTACACGACTGG - Intergenic
1142088595 16:88198114-88198136 CCCAGGGCTGGGCACACAGCAGG - Intergenic
1142466252 17:139089-139111 CCCACAGAGGGGCACACAAATGG + Intergenic
1142466329 17:139518-139540 CCCACAGAGGGGCACACAAATGG + Intergenic
1142466348 17:139628-139650 CCCACAGAGGGGCACACAAATGG + Intergenic
1142509683 17:385868-385890 CCCCGAGCTGGGGGCACCACAGG + Intronic
1142870130 17:2814620-2814642 GCCCGAGCTGGGCACGCTAGAGG - Intronic
1143273621 17:5693911-5693933 ACCCAGGCTGGGCACACAGAGGG - Intergenic
1143780765 17:9228163-9228185 GCCTGAGGTGGGCACACACACGG + Intronic
1144766517 17:17735909-17735931 CCCTGAACTTGGCCCACAAAAGG + Intronic
1146003355 17:29145201-29145223 CCCAGCACTAGGCACACAAAAGG + Intronic
1147209281 17:38862413-38862435 CCCCGTGCTTTGCACACAAGAGG + Intergenic
1147555609 17:41477068-41477090 CCCTGGGCAGGGCACACAAATGG + Exonic
1148148907 17:45384603-45384625 CCCAGAGCTTGGCACACAGAAGG - Intergenic
1150209945 17:63436392-63436414 CCCCCAGCTGTGCACAAAGAGGG + Intronic
1150227624 17:63532390-63532412 CCAAGAGCTGGGCACACAGCGGG + Intronic
1151322243 17:73359101-73359123 CCCAGAGCTGGGTACACAGTAGG + Intronic
1151999285 17:77635274-77635296 CCAGGAGCTGGGCAGACATAAGG + Intergenic
1152666053 17:81570303-81570325 CCCCGTGCTGGGCACCCAGGAGG - Intronic
1154041267 18:10858720-10858742 CACCCTTCTGGGCACACAAAAGG - Intronic
1156216106 18:34999810-34999832 CACAGAGCTGAGCACACAACAGG - Intronic
1156911587 18:42417243-42417265 CCCCCAGCTGGGCACTAAAATGG - Intergenic
1161744104 19:6044446-6044468 CACCGACCTGGGCAGACACACGG + Intronic
1162523493 19:11194934-11194956 CCCGGAGCTGGCCACACGGAAGG + Intronic
1165359799 19:35329308-35329330 CCCAGAGCTGGGAACACAGTGGG + Intronic
1165942279 19:39420905-39420927 CCGGGAGCTGGGCTCACACAGGG + Intronic
1166093162 19:40523301-40523323 CCCCGAGGTGGGACCACAACTGG + Intronic
1166703706 19:44896697-44896719 CCCAGGGCTGGGCACACATGAGG - Intronic
1167565086 19:50250978-50251000 CCCCGAGCTGGGCACACAAATGG - Intronic
1167633900 19:50642290-50642312 CTCAGAGATGGGCACACAGATGG + Intronic
925436776 2:3845226-3845248 AACCGTGCTGGACACACAAAAGG + Intronic
926116942 2:10219388-10219410 CCACCAGCTGAGCACACAAGAGG + Intergenic
926168791 2:10537777-10537799 CCACCATCTGAGCACACAAAGGG + Intergenic
928098991 2:28423799-28423821 CCCAGAGCTGGGCAAAGGAAGGG - Intergenic
932435161 2:71699073-71699095 CCCCAGGCTGGGCACACAGCGGG + Intergenic
932573170 2:72948875-72948897 ACCCAGGCTGGGCACACAGAGGG + Intronic
933975112 2:87503271-87503293 CACCGTGCTAGGTACACAAAGGG + Intergenic
935403798 2:102687172-102687194 CTCCGATCTGTGCACACAGAAGG - Intronic
936318714 2:111447543-111447565 CACCGTGCTAGGTACACAAAGGG - Intergenic
936896066 2:117429027-117429049 CCCAGTGCTGGGCACACAGTGGG - Intergenic
944342080 2:198613350-198613372 CCCAGAGCTTGGTACACAATAGG - Intergenic
945974582 2:216260257-216260279 CCCAGTGCTTGGCACACAATAGG - Intronic
948856160 2:240731674-240731696 GCCTGAGCTGGGGGCACAAAAGG - Intronic
1169347090 20:4837161-4837183 CCCTGACCTGGACACACAAAGGG + Intergenic
1170744800 20:19089947-19089969 CCAGGAGCTGTGCACACACAAGG - Intergenic
1173080556 20:39863075-39863097 CCCCAAGGTGGCCACGCAAAGGG + Intergenic
1173797537 20:45872804-45872826 CCCCGCACTGTGCACACAATAGG + Intronic
1173819187 20:46009805-46009827 GCCCCAGCTGGGCAGAGAAAGGG + Intronic
1173836366 20:46128714-46128736 CCCCCTGCTGGCCACACCAAGGG - Intronic
1174505848 20:51016992-51017014 CCCAGACCTGGGACCACAAAGGG + Intronic
1179593517 21:42427232-42427254 CCCCGAGCTGGCCACCCTCATGG + Intronic
1179944937 21:44666797-44666819 GCAGGAGCTGGGCACACAACAGG + Exonic
1180174053 21:46078958-46078980 CCCCAAGCTGGGCACCCTAAGGG + Intergenic
1180764188 22:18234138-18234160 GCCCAAGCTGTGCACACAATGGG - Intergenic
1180771454 22:18390403-18390425 GCCCAAGCTGTGCACACAATGGG + Intergenic
1180802836 22:18640018-18640040 GCCCAAGCTGTGCACACAATGGG + Intergenic
1181218882 22:21355243-21355265 GCCCAAGCTGTGCACACAATGGG - Intergenic
1184037010 22:41923070-41923092 TTCCAAGCTGGGCACACAACAGG + Intergenic
1185006019 22:48277397-48277419 CTCCGAGCTGAGGACACAGAGGG + Intergenic
1185280456 22:49967614-49967636 CCCCGTGCCGGGCACCCAACTGG - Intergenic
1203233293 22_KI270731v1_random:131394-131416 GCCCAAGCTGTGCACACAATGGG + Intergenic
949775507 3:7628252-7628274 CCCCAGGCTGGGCACACAGTAGG - Intronic
950634166 3:14303411-14303433 CTCTGAGCTGGGGACACACAGGG - Intergenic
952946552 3:38481520-38481542 TCCCCAGCTGAGCACAAAAAGGG - Intronic
954464733 3:50647755-50647777 CCCAGTGCTGGGCACACAGTGGG + Intronic
956055055 3:65289935-65289957 CCCCTTGCTGGGGACACAAGAGG - Intergenic
961345971 3:126263634-126263656 CCCAGTGCTGGGCACAGAAGTGG + Intergenic
961728151 3:128946298-128946320 CCCGAGGCTGGGCACAGAAAAGG + Intronic
968623445 4:1615056-1615078 ACCCCACCTGGGCACACAGAAGG + Intergenic
968623524 4:1615357-1615379 ACCCCACCTGGGCACACACACGG + Intergenic
968844073 4:3030145-3030167 CCCAGAGCCAGGCACACAGAAGG - Intronic
968969098 4:3784217-3784239 GCCGGGGCTGGGCACACAAGGGG + Intergenic
969476459 4:7425013-7425035 CCCTGAGCTCGGCCCACAGATGG - Intronic
969660259 4:8523268-8523290 CCCTGAGCTGGGCACAGAGTTGG - Intergenic
969867174 4:10083610-10083632 ACCAGAGCTGTCCACACAAAAGG + Intronic
977692088 4:99924347-99924369 CACAGTGCTTGGCACACAAAAGG + Intronic
980979901 4:139645699-139645721 CTCCTAGGTGGGTACACAAAGGG - Intergenic
981122912 4:141073268-141073290 CCCAGAGATAGGCACACAAGGGG + Intronic
986413280 5:7503097-7503119 TGCAGAGCTGGGCACACAGAAGG + Intronic
997386705 5:133479257-133479279 CCCAGTGCTGGGCACAAAAAAGG + Intronic
1001328067 5:170744034-170744056 CCCCCTGCTGTTCACACAAAGGG + Intergenic
1004360711 6:14968282-14968304 CCCAGTGCTTGGCACACAACAGG - Intergenic
1004446298 6:15702046-15702068 CCCAGAGCTGGGAATAAAAAAGG - Intergenic
1006146527 6:31962969-31962991 CCCCACGCTGGGCACAGAGAGGG - Exonic
1006844322 6:37051841-37051863 CTCCGTGCTGGGCACACAGATGG - Intergenic
1007809037 6:44473461-44473483 CCCTGGGCTGGGCACAGAAGAGG - Intergenic
1019850046 7:3545694-3545716 GCCAGAGCTGGGCACAGAATTGG + Intronic
1022261234 7:28706976-28706998 CACTGAGCTTGGCACACAATAGG - Intronic
1023915105 7:44582609-44582631 GCCCGAGCTGAGAACCCAAAAGG - Intergenic
1026558793 7:71430896-71430918 CCCAAAGCTGAGCACACAATTGG - Intronic
1027059372 7:75073489-75073511 CCCGGAGCTGGGCACCACAAAGG + Exonic
1029248109 7:99217211-99217233 AGCCGGGCTGGGCACACAGAGGG - Intergenic
1030327800 7:108239697-108239719 TCCCCAGCAGGGCAGACAAAAGG + Intronic
1036753616 8:11457953-11457975 CCCTGTGCTCGGGACACAAAAGG - Intronic
1037912884 8:22754639-22754661 CCCCAAGGAGGCCACACAAATGG - Intronic
1040415647 8:47192348-47192370 CCACGAGCTGGGCTCAGAAAAGG - Intergenic
1041963443 8:63647077-63647099 CACAGAGCTGGGCACAAAGACGG - Intergenic
1052238782 9:26247276-26247298 CCTTGAGCTGGGAAGACAAATGG + Intergenic
1053425774 9:38008979-38009001 CCCTGAGCTGGGAAAGCAAAGGG - Intronic
1054779552 9:69153977-69153999 CCCCTTGCTTGGCACATAAAAGG - Intronic
1060413653 9:123415888-123415910 TCCCCAGCTGGGGACACAGATGG + Intronic
1060922680 9:127433366-127433388 CCCTGAGCTGGGAACAGACAAGG + Intronic
1061864273 9:133484557-133484579 CATAGTGCTGGGCACACAAAGGG + Intergenic
1190362425 X:49661979-49662001 ACCCCAGCTGGGCCCACAGAAGG - Intergenic
1192155762 X:68745444-68745466 CCCTGAGCTGGGCACTAAGAAGG - Intergenic
1193416683 X:81233639-81233661 CTCCAAGCTTGGCACCCAAAAGG - Intronic
1199977374 X:152902273-152902295 GCCCGAGCTGGGCCTACAGATGG - Intergenic