ID: 1167565088

View in Genome Browser
Species Human (GRCh38)
Location 19:50250989-50251011
Sequence GCTTTGCTCGGCCCCGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 84}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167565088_1167565093 28 Left 1167565088 19:50250989-50251011 CCCAGCTCGGGGCCGAGCAAAGC 0: 1
1: 0
2: 0
3: 7
4: 84
Right 1167565093 19:50251040-50251062 TCCTCACAAAGATCCCTATCTGG 0: 1
1: 0
2: 0
3: 8
4: 125
1167565088_1167565095 29 Left 1167565088 19:50250989-50251011 CCCAGCTCGGGGCCGAGCAAAGC 0: 1
1: 0
2: 0
3: 7
4: 84
Right 1167565095 19:50251041-50251063 CCTCACAAAGATCCCTATCTGGG 0: 1
1: 0
2: 0
3: 7
4: 116
1167565088_1167565092 -1 Left 1167565088 19:50250989-50251011 CCCAGCTCGGGGCCGAGCAAAGC 0: 1
1: 0
2: 0
3: 7
4: 84
Right 1167565092 19:50251011-50251033 CTGGATACACAGATCAAACATGG 0: 1
1: 0
2: 1
3: 13
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167565088 Original CRISPR GCTTTGCTCGGCCCCGAGCT GGG (reversed) Intronic
900319954 1:2078133-2078155 GCTTCCCTGTGCCCCGAGCTGGG + Intronic
900514542 1:3074993-3075015 GCTTTGGTGGGCCCAGAGCAGGG + Intronic
900866213 1:5270361-5270383 GCTTTGCTCAGCCCAGGGCATGG + Intergenic
901037866 1:6347131-6347153 GCTTTGCTGGGGCCCTAGGTGGG - Intronic
901439759 1:9270720-9270742 TCTGTGCTCTGCCCCGCGCTAGG + Exonic
902679761 1:18034953-18034975 GCTTTCCTCTACCCAGAGCTGGG - Intergenic
920438191 1:205961663-205961685 GCTGTTCTGGGCCCAGAGCTGGG + Intergenic
922571370 1:226636351-226636373 GCTTTGCTGTGCCCCTAGCAGGG - Intronic
1071429916 10:85599039-85599061 GCTTGGCTGGACCCCCAGCTTGG - Intergenic
1072518933 10:96213279-96213301 GCTTTACCTGGCCCCAAGCTGGG - Intronic
1075074553 10:119342136-119342158 GGCTTGCTCTGCCCCAAGCTGGG - Intronic
1077407360 11:2388638-2388660 GCTTGGCTCTGCCACCAGCTGGG - Intronic
1077530720 11:3093597-3093619 GCTTTTCTGGACCCCGAGCGGGG - Exonic
1078159467 11:8828356-8828378 GCTTTGCTTTGCCCAGGGCTGGG - Intronic
1078358684 11:10651973-10651995 GCTTGGCTTGGCCCCCAGCCAGG + Intronic
1093694422 12:22143971-22143993 GCTGTGCTGGGCTCAGAGCTAGG + Intronic
1098255557 12:68611534-68611556 GCTTCTCCCAGCCCCGAGCTAGG + Intronic
1105302838 13:19151149-19151171 GCTTTCCTGGTCCCCTAGCTGGG - Intergenic
1105541198 13:21319074-21319096 GCTCTGCTCGGCTCCCAGCGCGG - Intergenic
1112434599 13:99382895-99382917 GCTTTTCTCGGCCCCCACCCAGG - Intronic
1115769879 14:36657690-36657712 GGTTGGGTCGGGCCCGAGCTCGG - Intronic
1117500065 14:56342754-56342776 GCTTTGCTCTGCCCCCAGGATGG + Intergenic
1117677714 14:58171311-58171333 GCTTAGCCCTGCCCCAAGCTTGG - Intronic
1122784763 14:104158577-104158599 GCTTTCCCAGGCCCCGAGCTCGG + Intronic
1128647631 15:69388779-69388801 GCCTTGTTCAGCCCTGAGCTAGG + Intronic
1132149326 15:99448166-99448188 GCTTCTCTAGGCCCCAAGCTGGG - Intergenic
1132451294 15:101969934-101969956 GCTGTGCTGGGGCCTGAGCTGGG - Intergenic
1132483526 16:178137-178159 GCTGAGCTGGGCCCTGAGCTGGG - Intergenic
1132578732 16:675669-675691 GCTCCGCTCGGCGCCGCGCTTGG - Exonic
1132901374 16:2256614-2256636 GCTATGCTGGGCCCTGTGCTGGG + Intronic
1132948576 16:2547091-2547113 GCTTTGCTCAGCCCTGTTCTTGG + Intronic
1132966011 16:2655035-2655057 GCTTTGCTCAGCCCTGTTCTTGG - Intergenic
1133453450 16:5922488-5922510 GCTCTCCTCTGCCCTGAGCTGGG - Intergenic
1135552312 16:23408031-23408053 GCTTTCCTGGGCTCTGAGCTAGG - Intronic
1143027245 17:3948090-3948112 TCTGTGCCCGGCCCCGTGCTAGG - Intronic
1144956447 17:19021182-19021204 GCTCTGCTGGGCCCCGGTCTGGG + Exonic
1148445041 17:47732598-47732620 GGTTTGCAGGGCCCTGAGCTGGG - Intergenic
1148853113 17:50564387-50564409 GCTGTGCTGGGCTCTGAGCTTGG - Intronic
1152476752 17:80523347-80523369 GCTGAGCTAGCCCCCGAGCTTGG - Intergenic
1152748607 17:82052312-82052334 GGATAGCTCGGCCCCCAGCTCGG + Exonic
1157680709 18:49603292-49603314 ACTATGCTCTGCCCAGAGCTGGG + Intergenic
1160857434 19:1223826-1223848 GCTGTGTTCGGCCCAGGGCTGGG + Intronic
1160904406 19:1445713-1445735 GGCTTGCTGGGCGCCGAGCTGGG - Intergenic
1160943406 19:1630396-1630418 GCTTTGCCCGGCCTCGAACTTGG - Intronic
1163509011 19:17724438-17724460 GCTGTCCTGGGCCCTGAGCTGGG - Intronic
1166687236 19:44802688-44802710 GCATTGCTCAGCCCAGCGCTGGG - Intergenic
1167565088 19:50250989-50251011 GCTTTGCTCGGCCCCGAGCTGGG - Intronic
1167650352 19:50725304-50725326 GCTGGGCTGGGCGCCGAGCTCGG - Exonic
925090945 2:1155729-1155751 TCTTTCCTCAGCCCCAAGCTTGG - Intronic
926707520 2:15847169-15847191 GCTGGGCTAGGCCCCGTGCTGGG + Intergenic
926801347 2:16663692-16663714 GCTTTGCTCTGCTCTCAGCTGGG + Intronic
928826550 2:35428720-35428742 GCTCTGCTCTGCCCCCTGCTGGG + Intergenic
930818852 2:55625541-55625563 GCTGTGCTCAGCCACTAGCTGGG - Intergenic
936567510 2:113592415-113592437 GCTGTGCTGGGGCCTGAGCTGGG - Intergenic
946955269 2:224922773-224922795 GCTTTTCTCAGCCCCAAGATAGG - Intronic
947532612 2:230922334-230922356 GCCCTGCTCAGCCCCGAGCCCGG + Intronic
948681263 2:239636236-239636258 CCTTTGCTGGTCCCAGAGCTGGG + Intergenic
948811225 2:240479396-240479418 GCTGTGCTCTGCCCCTAGCTGGG - Intergenic
1168832505 20:854409-854431 GCCTAGCTCAGCCCCTAGCTTGG + Intronic
1169451289 20:5713954-5713976 GTCTTGCTCTGCCCCGAGGTTGG + Intergenic
1172056720 20:32159351-32159373 TCTGTGCTGGGCCCCGAGCTGGG - Intronic
1172229190 20:33325633-33325655 GCTTTCCTCAGCTCCCAGCTTGG - Intergenic
1177505031 21:22008551-22008573 ACTTTTCTGGGCCCAGAGCTTGG + Intergenic
1178915210 21:36702164-36702186 GAATTGCTGGGCCCCGAGTTTGG + Intronic
1183786887 22:40034498-40034520 GCTTTCCTCAGTCCCTAGCTGGG - Exonic
1184605774 22:45574020-45574042 CCTGTGCTGGGCACCGAGCTTGG + Intronic
1184649499 22:45913115-45913137 CCTTTGCTGGGCCCTGAGCAGGG + Intergenic
949904996 3:8851954-8851976 GCTGTGCATGGCCTCGAGCTAGG - Intronic
950548517 3:13653079-13653101 GCTTTGCTGGGCCCCCTGCAGGG - Intergenic
955032805 3:55237389-55237411 GCATTGCTGGGACACGAGCTTGG + Intergenic
955228820 3:57081496-57081518 GCTGTGCTTGGCCCTGAGGTGGG + Intergenic
958044579 3:88267974-88267996 GCTTTGCTCGTGCCCGAGTGAGG + Intergenic
958779316 3:98522653-98522675 GCCGTGCTCGGCCCCGGGCCAGG + Intronic
969448182 4:7257312-7257334 GTTTTGCTCAGCACCGACCTTGG + Intronic
974010770 4:56605270-56605292 GCTTTGCCAGGCCCTGTGCTTGG + Intergenic
977513740 4:97994766-97994788 GTGTTGGTCGGCCCCAAGCTAGG + Intronic
987127970 5:14833028-14833050 GCTTTGATGGGCCCCAAGCTTGG + Intronic
992809487 5:80372273-80372295 GCTTTATTCGGCCGGGAGCTTGG - Intergenic
994590289 5:101762379-101762401 GCTTCTCTCGGACCCCAGCTTGG - Intergenic
1002926992 6:1610495-1610517 GCTCTGCTCGCCGCCGAGGTAGG - Exonic
1013231365 6:108164759-108164781 CCTTGGCTCGGCCTCGAGCTCGG - Intronic
1017587881 6:155947065-155947087 ACTTTGCTCTGCCCCAAGCAGGG - Intergenic
1019388222 7:770635-770657 CCTCTGCACGGCCCCCAGCTGGG + Intronic
1019492771 7:1322845-1322867 GCTCTGCCCGGCTCCGTGCTCGG + Intergenic
1022528343 7:31052412-31052434 GCTGCGCTCGGCCCCGGGCAGGG + Intergenic
1023867690 7:44246086-44246108 GCTTTGCCCAGACCTGAGCTGGG + Intronic
1027237081 7:76304367-76304389 TCTTTGCTCAGGCCCGTGCTGGG + Intergenic
1027405370 7:77854876-77854898 GCTTTGCTCTGGCCCATGCTGGG + Intronic
1033142739 7:138841967-138841989 GCATTGCTCTGCCCAGAGCCAGG - Intronic
1035750748 8:1994391-1994413 GCTTTGCTCAGCCCCGTGCATGG + Intronic
1047509541 8:125505879-125505901 GCTATCCTCAGCCCAGAGCTTGG - Intergenic
1049885024 9:21118-21140 GCTGTGCTGGGGCCTGAGCTGGG + Intergenic