ID: 1167565089

View in Genome Browser
Species Human (GRCh38)
Location 19:50250990-50251012
Sequence AGCTTTGCTCGGCCCCGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 60}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167565089_1167565095 28 Left 1167565089 19:50250990-50251012 CCAGCTCGGGGCCGAGCAAAGCT 0: 1
1: 0
2: 0
3: 4
4: 60
Right 1167565095 19:50251041-50251063 CCTCACAAAGATCCCTATCTGGG 0: 1
1: 0
2: 0
3: 7
4: 116
1167565089_1167565092 -2 Left 1167565089 19:50250990-50251012 CCAGCTCGGGGCCGAGCAAAGCT 0: 1
1: 0
2: 0
3: 4
4: 60
Right 1167565092 19:50251011-50251033 CTGGATACACAGATCAAACATGG 0: 1
1: 0
2: 1
3: 13
4: 156
1167565089_1167565093 27 Left 1167565089 19:50250990-50251012 CCAGCTCGGGGCCGAGCAAAGCT 0: 1
1: 0
2: 0
3: 4
4: 60
Right 1167565093 19:50251040-50251062 TCCTCACAAAGATCCCTATCTGG 0: 1
1: 0
2: 0
3: 8
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167565089 Original CRISPR AGCTTTGCTCGGCCCCGAGC TGG (reversed) Intronic
900514541 1:3074992-3075014 AGCTTTGGTGGGCCCAGAGCAGG + Intronic
904367299 1:30022429-30022451 AGATTTGTTCGGCCCCCAGGGGG + Intergenic
905629889 1:39512565-39512587 AGCTCTGCTCCACCCCGAGAGGG - Intronic
905667870 1:39773625-39773647 AGCTCTGCTCCACCCCGAGAGGG + Intronic
920311079 1:205048584-205048606 AGCTATGCCAGGCCCAGAGCTGG - Intronic
922571371 1:226636352-226636374 GGCTTTGCTGTGCCCCTAGCAGG - Intronic
1063060795 10:2550345-2550367 AGCAGTGCTGGGCCCAGAGCAGG - Intergenic
1067077436 10:43196287-43196309 AGCAGTGCTCAGGCCCGAGCAGG + Intronic
1068367443 10:56068775-56068797 AGCCTTGCTTGGCTCAGAGCAGG + Intergenic
1077530721 11:3093598-3093620 CGCTTTTCTGGACCCCGAGCGGG - Exonic
1077921041 11:6641817-6641839 AGATATGCTCAGCCCCCAGCAGG + Intronic
1080383596 11:31797834-31797856 TGCTTTGCGCGGCTCCGAGGGGG - Intronic
1083445562 11:62706166-62706188 CGCTTTGCCCACCCCCGAGCTGG - Intronic
1090519422 11:127462328-127462350 AGCTCTTCTCAGCCACGAGCAGG - Intergenic
1091507817 12:1090925-1090947 AGCTTTGCTCTGTCCCAGGCTGG + Intronic
1108678691 13:52760928-52760950 AGCATTGCTCAGACCTGAGCAGG - Intergenic
1113694102 13:112331768-112331790 AGCTTGGCTCGGCTCCGGGGAGG - Intergenic
1125283963 15:38072838-38072860 AGCATTCCTCAGCCCCGCGCGGG + Intergenic
1132013840 15:98299009-98299031 AGCTTTCCTGGGCCTCCAGCTGG + Intergenic
1137300650 16:47144419-47144441 AGCCTTGCTCGACCCTGGGCAGG + Intergenic
1139481670 16:67234172-67234194 GGCTTCGCTGGGCCCGGAGCAGG + Exonic
1143034463 17:3986441-3986463 GGCTGTGCTTGGCCCAGAGCCGG - Intergenic
1144956446 17:19021181-19021203 AGCTCTGCTGGGCCCCGGTCTGG + Exonic
1146546608 17:33744211-33744233 AGGTTTGCTCTGACCCTAGCAGG - Intronic
1152237594 17:79146705-79146727 AGCTTTTCTGGGCCCTGGGCAGG - Intronic
1152920368 17:83063519-83063541 AGCTTTGCTGTGCACCGTGCAGG + Intergenic
1160904407 19:1445714-1445736 AGGCTTGCTGGGCGCCGAGCTGG - Intergenic
1164057340 19:21632939-21632961 AGTTTTGCTCGGGCCCAAGGTGG - Intergenic
1166687237 19:44802689-44802711 AGCATTGCTCAGCCCAGCGCTGG - Intergenic
1167565089 19:50250990-50251012 AGCTTTGCTCGGCCCCGAGCTGG - Intronic
928826549 2:35428719-35428741 AGCTCTGCTCTGCCCCCTGCTGG + Intergenic
930864594 2:56109941-56109963 AGCTTTGCTCAGCCCCTGTCTGG - Intergenic
938414474 2:131093129-131093151 ACCTTGGCGCCGCCCCGAGCCGG + Intronic
941453013 2:165682086-165682108 AGCTTTGCTCAGGCTGGAGCTGG - Exonic
948811226 2:240479397-240479419 TGCTGTGCTCTGCCCCTAGCTGG - Intergenic
1172056721 20:32159352-32159374 ATCTGTGCTGGGCCCCGAGCTGG - Intronic
1172127652 20:32634466-32634488 AGCCCTGCTGGGCCCGGAGCTGG - Intergenic
1173174650 20:40755091-40755113 AGGTGTGCTGGGCCTCGAGCGGG - Intergenic
1175899373 20:62354002-62354024 AGCTTTCCTCTGCCCTGGGCAGG - Intronic
1180559001 22:16601239-16601261 AGCTTGGCTCCCTCCCGAGCCGG + Intergenic
1184275368 22:43406695-43406717 GGCTTTGCTTGGCCCAGAGGAGG + Intergenic
1184649497 22:45913114-45913136 GCCTTTGCTGGGCCCTGAGCAGG + Intergenic
950548518 3:13653080-13653102 GGCTTTGCTGGGCCCCCTGCAGG - Intergenic
957665408 3:83218844-83218866 AACTTTGCTCTGCCTCAAGCAGG + Intergenic
973894290 4:55396363-55396385 GGCTGTGCAGGGCCCCGAGCCGG + Exonic
984763703 4:183383803-183383825 AACTTTGCTCACCCCAGAGCAGG - Intergenic
988716026 5:33829201-33829223 AGCTGTGCTCCTCCCCAAGCTGG + Intronic
1014505402 6:122248333-122248355 AACTTTGCTCGCACCAGAGCAGG + Intergenic
1017587882 6:155947066-155947088 AACTTTGCTCTGCCCCAAGCAGG - Intergenic
1019433413 7:1010116-1010138 AGCTGTGCTCAGGCCCGGGCTGG - Exonic
1019934583 7:4245982-4246004 AGCTCTGCGGGGCCCAGAGCAGG - Intronic
1022528342 7:31052411-31052433 CGCTGCGCTCGGCCCCGGGCAGG + Intergenic
1023345986 7:39271657-39271679 AGGTTTGCTCAGCCACGAGACGG - Intronic
1027237080 7:76304366-76304388 ATCTTTGCTCAGGCCCGTGCTGG + Intergenic
1027867147 7:83662625-83662647 AGCCTTGCTAGACCCTGAGCAGG - Intergenic
1032369085 7:131328150-131328172 AGCGTTGCTCGGCCTCGCTCGGG + Intronic
1037476669 8:19264552-19264574 AGCTTTGCTCAGCACTCAGCTGG - Intergenic
1038017501 8:23528362-23528384 AGCCTTGCTCGGTCCAGGGCAGG + Intergenic
1049273260 8:141707357-141707379 AGCTTTCCTCGACCCCCAGAGGG + Intergenic
1055655897 9:78450324-78450346 AGGTTTGCTGGCCCCCGATCGGG - Intergenic
1061374843 9:130217740-130217762 AGCTTTCCTGGGCCCCGGGCAGG + Intronic
1062151491 9:135021483-135021505 AGCTGTGTCCAGCCCCGAGCTGG - Intergenic
1186878251 X:13838643-13838665 AGCCTAGCTCAGCCCCCAGCTGG - Intronic
1188767798 X:34117799-34117821 AGCTTTTCTCAGTCCCCAGCTGG + Intergenic
1201920878 Y:19232394-19232416 AGCAGTGCTCTGCCCCGAGGTGG + Intergenic