ID: 1167565092

View in Genome Browser
Species Human (GRCh38)
Location 19:50251011-50251033
Sequence CTGGATACACAGATCAAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 156}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167565086_1167565092 10 Left 1167565086 19:50250978-50251000 CCATTTGTGTGCCCAGCTCGGGG 0: 1
1: 0
2: 0
3: 15
4: 164
Right 1167565092 19:50251011-50251033 CTGGATACACAGATCAAACATGG 0: 1
1: 0
2: 1
3: 13
4: 156
1167565088_1167565092 -1 Left 1167565088 19:50250989-50251011 CCCAGCTCGGGGCCGAGCAAAGC 0: 1
1: 0
2: 0
3: 7
4: 84
Right 1167565092 19:50251011-50251033 CTGGATACACAGATCAAACATGG 0: 1
1: 0
2: 1
3: 13
4: 156
1167565089_1167565092 -2 Left 1167565089 19:50250990-50251012 CCAGCTCGGGGCCGAGCAAAGCT 0: 1
1: 0
2: 0
3: 4
4: 60
Right 1167565092 19:50251011-50251033 CTGGATACACAGATCAAACATGG 0: 1
1: 0
2: 1
3: 13
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167565092 Original CRISPR CTGGATACACAGATCAAACA TGG Intronic
905351340 1:37348634-37348656 CGGGATACACAGATGAACCTGGG - Intergenic
912244070 1:107942540-107942562 CAGGATACACAGATATAAAAAGG - Intronic
913532579 1:119743210-119743232 GTGGATACTCAGTTCAAAGAGGG + Intronic
915254600 1:154616787-154616809 CTGGGTACACAGATCTATCTGGG - Intronic
916791469 1:168129113-168129135 CTGTAAAGAAAGATCAAACAGGG + Intronic
918668532 1:187182546-187182568 CTTGATACTCAAATCAAACAAGG + Intergenic
919204265 1:194400369-194400391 ATGGAGAGACAGCTCAAACAAGG + Intergenic
919422590 1:197389201-197389223 CTGGATACACACCTTAAAGAGGG + Intronic
923469937 1:234281450-234281472 ATGGGTACAAAGAGCAAACAAGG - Intronic
924216182 1:241824717-241824739 CTGGAGCCACAGCTCAAAGATGG + Intergenic
924626806 1:245702414-245702436 ATGGAGACGCAGAGCAAACAGGG - Intronic
1063979596 10:11443003-11443025 ATGGAAACACAGGTCAAATAAGG + Intergenic
1065424767 10:25588378-25588400 CTGGCTTCAGTGATCAAACAAGG + Intronic
1065892826 10:30135614-30135636 GTGGCTACAGAGTTCAAACAGGG + Intergenic
1066497167 10:35953792-35953814 TTAGATAGACAGATCAGACAAGG + Intergenic
1067059378 10:43070204-43070226 CTGGACAGACAGAGCAAGCAGGG + Intergenic
1067439784 10:46302097-46302119 CTGGAATCACAGCTAAAACAGGG + Intronic
1068853908 10:61777093-61777115 CTGGAGACAGACATTAAACATGG - Intergenic
1070012238 10:72487435-72487457 CTGTAACCACAGATGAAACATGG + Intronic
1070662078 10:78314151-78314173 CTGGTTACAGAAATCAAACTGGG + Intergenic
1076184152 10:128433634-128433656 CTGGACACACAGCTCAGAAAAGG + Intergenic
1076736777 10:132462528-132462550 CTGGAGACCCAGGTAAAACAAGG - Intergenic
1077220297 11:1412774-1412796 CTGGCTGCACAGATCAACCCAGG + Intronic
1077925951 11:6682340-6682362 CTCGGTACAAAGATCAAACTGGG - Exonic
1078811227 11:14766336-14766358 CTGAATACTCAGGTTAAACATGG + Intronic
1079274907 11:19026298-19026320 CTGGAAAGACAGAGTAAACATGG - Intergenic
1080190283 11:29537238-29537260 AAGGTTACACAGATAAAACATGG + Intergenic
1080413509 11:32048549-32048571 GTGGCTAAACAAATCAAACATGG - Intronic
1082907869 11:58331443-58331465 CTGGATACTAAAACCAAACAAGG - Intergenic
1083132098 11:60634116-60634138 CTGGATATTCAGATCAGACAGGG - Intergenic
1085175051 11:74478571-74478593 ATGGAAACACACATAAAACAAGG - Intergenic
1085956280 11:81400076-81400098 CTGGAAATACTGAACAAACAAGG - Intergenic
1086065880 11:82744168-82744190 CTGGATATTTGGATCAAACAAGG - Intergenic
1089142896 11:116301682-116301704 TGGGATACACTGATCTAACATGG + Intergenic
1091041722 11:132287133-132287155 CTGGTTAGACAGATCTGACAAGG - Intronic
1098179306 12:67829067-67829089 GTGGACACATAGCTCAAACATGG - Intergenic
1099079722 12:78161739-78161761 CTGTATACACACAACAATCATGG + Intronic
1101999385 12:109547345-109547367 CTGGTTGCTGAGATCAAACAAGG + Intergenic
1102520423 12:113474698-113474720 CTGGAAACACACACCAGACAGGG - Intergenic
1104409494 12:128546473-128546495 CTGGAAGCTCAGAACAAACAGGG - Intronic
1104947688 12:132423919-132423941 CTGGATCCACAGAGAGAACATGG + Intergenic
1107640876 13:42441907-42441929 CTGTATACACACAGCCAACAAGG + Intergenic
1108373099 13:49790515-49790537 CTTGTTACACAGATTAAATAAGG + Intronic
1108628983 13:52262224-52262246 CTGGATACTCTGATTAAAAATGG + Intergenic
1112334774 13:98505168-98505190 CCGGAAACACAGATCCACCAAGG + Intronic
1113010190 13:105755870-105755892 CTTGATATACTGGTCAAACAAGG + Intergenic
1113984555 13:114303452-114303474 CTGTATACACAGATGGAGCATGG - Intronic
1116929969 14:50680852-50680874 CAACATACACAAATCAAACATGG - Intergenic
1120046511 14:79813539-79813561 ATAGATATACAAATCAAACAAGG + Intronic
1120641519 14:87019167-87019189 CAGGATATACAGAGCAAAGAGGG + Intergenic
1122874577 14:104657941-104657963 CAGGAGACACAGATCTAGCAAGG + Intergenic
1124875825 15:33592471-33592493 CTGGATACAGATATCCAACAAGG - Intronic
1126342440 15:47656225-47656247 ATAGAAACACATATCAAACAAGG + Intronic
1129030268 15:72612529-72612551 GGGCATACACAGAACAAACAGGG - Intergenic
1129933498 15:79431419-79431441 CTGGATACATGGATCAGAAATGG - Intergenic
1132432473 15:101772814-101772836 AGGCATACACAGAACAAACAGGG + Intergenic
1132526361 16:417534-417556 ATGGATACACAGTTGACACAAGG + Intergenic
1135481069 16:22821039-22821061 CTGGCTACAGAGATGAAGCAGGG - Intronic
1135900563 16:26455813-26455835 CTGAGCACACAGAACAAACAAGG + Intergenic
1136654271 16:31700617-31700639 CAGGGTACACAGATCAAGCAGGG - Intergenic
1140953262 16:79839267-79839289 CTGGATACCCAGAGCAACTAGGG - Intergenic
1144669390 17:17124451-17124473 ATGGATACACAGCTCATCCAGGG + Intronic
1145056272 17:19706006-19706028 CTGGAAAGACAGACCACACAGGG - Intronic
1145077866 17:19870052-19870074 CTGTATTCACAGGCCAAACATGG + Intergenic
1145757848 17:27405795-27405817 TTGGATCCAGAGCTCAAACAAGG + Intergenic
1147623177 17:41881756-41881778 CTGGCTACACAGATCTACCAAGG + Intronic
1151057824 17:71053990-71054012 AGGGACACAGAGATCAAACAGGG + Intergenic
1151342002 17:73477552-73477574 CTGGATGCCCACATCAAAGATGG - Intronic
1156223603 18:35079723-35079745 CTGGATACAGAAATCTAACAGGG - Intronic
1158390003 18:57037224-57037246 CTGGAAACACAGAGGAAACTGGG - Intergenic
1158527997 18:58232557-58232579 CCGGTTACACAGATCAATTACGG - Intronic
1158901201 18:61963349-61963371 CTGGTTAAACAGATGAAAAAAGG + Intergenic
1164014039 19:21236159-21236181 CTGGACACACAGATAGAAAAGGG + Intronic
1165102374 19:33446616-33446638 CTGGATGCACTGTGCAAACAGGG - Intronic
1165560319 19:36673717-36673739 CTAGAGAAACAGAACAAACAGGG - Intergenic
1166342340 19:42146222-42146244 CTGGAGACACAGATGGAACCAGG + Intronic
1166352996 19:42209437-42209459 CTGAATACACAAATGAAACTAGG + Intronic
1167565092 19:50251011-50251033 CTGGATACACAGATCAAACATGG + Intronic
932126742 2:69151649-69151671 CTGGATTCACAGACCCTACAAGG + Intronic
933469414 2:82702261-82702283 CAGGATACACAGTTCCAAAAGGG + Intergenic
934558532 2:95300265-95300287 CTGGATCCACAGTCCAAAAATGG - Intronic
934613902 2:95759651-95759673 ATGGATAGACAGATGAAAGATGG + Intergenic
935360286 2:102240924-102240946 CTTGAGACACAGGACAAACAAGG + Intergenic
937542885 2:122981199-122981221 CTGGAGATACAGATCAAATCAGG + Intergenic
938736382 2:134190311-134190333 CTTGCTACAAAAATCAAACATGG - Intronic
939034216 2:137111712-137111734 CTGGCTAAACAGAATAAACAAGG - Intronic
946143658 2:217712907-217712929 CTGGGGACACAGCCCAAACATGG + Intronic
946185245 2:217977225-217977247 CTGGATAAACAGAACAAGGAGGG + Intronic
1169580297 20:7015284-7015306 ATGGATACACAGATCACAAATGG - Intergenic
1171269405 20:23801867-23801889 CTGGCTACACGGATCAGAGAAGG - Intergenic
1175604026 20:60297847-60297869 CTGTAAACACAGATGAAGCATGG + Intergenic
1176370484 21:6059212-6059234 CTGGTTCCAGAGAACAAACAGGG + Intergenic
1178142417 21:29699381-29699403 CTGGACACACAGATATACCAGGG + Intronic
1178179224 21:30140689-30140711 CTGGATATGCATATCAGACAAGG + Intergenic
1179489223 21:41729447-41729469 GTGGATACACCCTTCAAACACGG - Intergenic
1179753035 21:43479329-43479351 CTGGTTCCAGAGAACAAACAGGG - Intergenic
1180207381 21:46269600-46269622 CTGGAGCCACAGATCAACCAAGG + Intronic
1182569258 22:31224080-31224102 CTGCATACACAGAGCGCACAAGG + Intronic
1183844902 22:40534764-40534786 CTAGATAAACACACCAAACATGG - Intronic
1185175751 22:49325571-49325593 CTGGCTACACTGACCCAACAGGG - Intergenic
1185357430 22:50382301-50382323 CTGGATAAAAAAGTCAAACAGGG + Intronic
1203292563 22_KI270736v1_random:9576-9598 CTGGGTCCACAAATCTAACATGG - Intergenic
954011229 3:47640744-47640766 TTTGATTCACAAATCAAACAGGG + Intronic
954116369 3:48469004-48469026 CTGGACACACACAGCACACATGG + Exonic
955303179 3:57803698-57803720 CTGGAGGCACAAATCCAACATGG + Intronic
957089057 3:75710151-75710173 ATGGATACACAGTTTAAAAAGGG + Intronic
958515912 3:95115529-95115551 CTGTATACACATCTAAAACACGG + Intergenic
964467667 3:157015066-157015088 CTGGAAACAGAAGTCAAACAAGG + Intronic
970431618 4:15994165-15994187 CTGTGTTCACAGATTAAACAAGG - Intronic
971766355 4:30836969-30836991 CTTGAGACACATATAAAACATGG + Intronic
973148005 4:46853064-46853086 CTAGAAACACACATAAAACAAGG + Intronic
977103260 4:92845932-92845954 GTGGAAAAATAGATCAAACAGGG - Intronic
979664199 4:123293064-123293086 CTGGATATTCAGATCAGACGAGG + Intronic
979903083 4:126248252-126248274 CTTGATACCAAGATCAGACAAGG - Intergenic
980838390 4:138226455-138226477 CTGGATGCTCAGATAAAGCAGGG - Intronic
985285794 4:188335556-188335578 TTGGATACAGAAATCACACAAGG + Intergenic
985302200 4:188502731-188502753 CTTGGTATACATATCAAACAAGG + Intergenic
987926005 5:24342732-24342754 CTTATTACACAGATCATACACGG + Intergenic
989487354 5:42007562-42007584 CTGGGTACTCAGATTAATCAAGG - Intergenic
990095393 5:52105444-52105466 TTGGATAAATAGAACAAACACGG + Intergenic
998476628 5:142427678-142427700 CTGGGTAAACACAACAAACAAGG + Intergenic
999973542 5:156888845-156888867 CTGAATACAGATATCAGACAGGG + Intergenic
1002420713 5:179147448-179147470 CTTTAAACACAGATCCAACATGG - Intronic
1003735373 6:8872290-8872312 CTGGAAACAAAGATAAAACATGG - Intergenic
1004260249 6:14101641-14101663 CTGGAGTCACCGATTAAACAGGG - Intergenic
1004653793 6:17638382-17638404 CTGGAGAAACAGATCACAGATGG - Intronic
1008129964 6:47710081-47710103 ATAGAAACACACATCAAACAAGG + Intronic
1008483871 6:52014554-52014576 CTGGATAAACAGATGGATCATGG + Intronic
1008556053 6:52673586-52673608 AAGGATGCCCAGATCAAACAGGG - Intronic
1010595673 6:77760687-77760709 CAGGATACACTAATCTAACAAGG + Intronic
1013362962 6:109411519-109411541 CTGGTTACACAGATATAACCAGG + Intronic
1020723293 7:11776705-11776727 CTGGATAAACTGATAAAACATGG + Intronic
1026655931 7:72256525-72256547 CTGGATTCACAGATAAGACTTGG + Intronic
1027662743 7:81006532-81006554 CTGGCTACACAGGTCCAACTCGG + Intergenic
1030766261 7:113413472-113413494 CAGAATACCCAGATTAAACATGG - Intergenic
1032987903 7:137359277-137359299 CTGGATACATAGATATAACCAGG - Intergenic
1036055581 8:5249813-5249835 CTGGATCCAGAGATTAAAAAAGG + Intergenic
1036450783 8:8865407-8865429 CTGGATACAAAAATCAGAAATGG + Intronic
1037086325 8:14855357-14855379 CTTGATACCCAGATCAAGAATGG - Intronic
1040282201 8:46064199-46064221 CTGAATGCACACATCAAAAAGGG - Intergenic
1044086204 8:87945125-87945147 CTGGAAACACAGAAGAAACTTGG + Intergenic
1045180202 8:99772688-99772710 CAGTATACACATATAAAACAGGG - Intronic
1046707264 8:117468787-117468809 CTTGATATACAGATCAATCTAGG + Intergenic
1048061217 8:130921019-130921041 CTGGAGAAACAGAACCAACAGGG - Intronic
1049486828 8:142869510-142869532 CTGCTTATACAGATCAAATAAGG + Intronic
1049985937 9:951351-951373 CTGGAAACACAGACCAGACATGG + Intronic
1054826744 9:69581027-69581049 CAGGGGACACAGATCAAAGATGG + Intronic
1056782081 9:89558050-89558072 ATAGAAACACACATCAAACAAGG + Intergenic
1056988071 9:91383492-91383514 CTAGGTACACAGATTAAACCCGG - Intergenic
1058205380 9:102099761-102099783 CTGAATACAAAGATTAATCAGGG + Intergenic
1058580757 9:106454009-106454031 TTGGACACACAGAACACACAGGG - Intergenic
1062149105 9:135008285-135008307 CTGAATAGACAAATCAAACCCGG + Intergenic
1203488534 Un_GL000224v1:81811-81833 ATGGATACACAGTTTAAAAAGGG - Intergenic
1203501155 Un_KI270741v1:23707-23729 ATGGATACACAGTTTAAAAAGGG - Intergenic
1186119397 X:6343141-6343163 CTTTATGCAGAGATCAAACATGG + Intergenic
1186134558 X:6505401-6505423 CTGAATACACATATAAAACATGG + Intergenic
1187060101 X:15778495-15778517 ATGGATAAAGAGATCAATCAAGG + Intronic
1187185941 X:16985726-16985748 GTAGATACCCAGATCAATCAAGG + Intronic
1187670492 X:21661554-21661576 GTTGATAGACAGATCTAACAGGG + Intergenic
1189294063 X:39906457-39906479 CGTGAAACACAGATCAAACACGG + Intergenic
1190475745 X:50825646-50825668 CTGGGTACCCAGTTCAGACAGGG + Intergenic
1190779561 X:53580259-53580281 CTGGATCCACAGCCCAACCAAGG + Intronic
1192408697 X:70912980-70913002 CTGGAAACCCAAATCAAAAAGGG + Intergenic
1193021460 X:76797762-76797784 CTGGGTATTCAAATCAAACATGG - Intergenic
1193237029 X:79119963-79119985 CTTGATACCAAAATCAAACAAGG - Intergenic
1193326311 X:80181898-80181920 CTAGTTACACAGATATAACAAGG + Intergenic
1195171870 X:102276985-102277007 CTACATACACACATCAATCAAGG - Intergenic
1195186990 X:102410108-102410130 CTACATACACACATCAATCAAGG + Intronic
1195386781 X:104321106-104321128 CTGGATAAATAGACAAAACATGG + Intergenic
1196296016 X:113998342-113998364 CTGGTGACACAGATCAAACATGG - Intergenic
1198868731 X:141153713-141153735 CTGGAGAAACAGAGCAAATAGGG + Intergenic