ID: 1167567197

View in Genome Browser
Species Human (GRCh38)
Location 19:50264153-50264175
Sequence TGTTGTCCACAGAACTTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 149}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167567197_1167567200 17 Left 1167567197 19:50264153-50264175 CCAGTGAAGTTCTGTGGACAACA 0: 1
1: 0
2: 0
3: 14
4: 149
Right 1167567200 19:50264193-50264215 ATGAAGTATGATAATATGCACGG 0: 1
1: 0
2: 2
3: 25
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167567197 Original CRISPR TGTTGTCCACAGAACTTCAC TGG (reversed) Intronic
907517174 1:55000102-55000124 TATTTTCCACAGAGCTTCACAGG + Intronic
908520260 1:64934697-64934719 TGGAGTCCACAGGACTTCACCGG - Intronic
910167158 1:84339607-84339629 TGCTGGCCACAGAGTTTCACTGG + Intronic
911503682 1:98721694-98721716 TTTATTTCACAGAACTTCACAGG - Intronic
915056047 1:153132119-153132141 TCTTGGCCACAGAAAGTCACAGG - Intergenic
917271298 1:173277444-173277466 GGGTGTCCTCAGAACTTCAACGG + Intergenic
917701045 1:177581482-177581504 TATTGTCCACAGGACATTACTGG - Intergenic
918740301 1:188122025-188122047 TGTTCTTCACACAACTTAACTGG - Intergenic
921804345 1:219437025-219437047 GGTGGTTCATAGAACTTCACAGG - Intergenic
1064749055 10:18507286-18507308 TGTCTTCCACAGAACTTTTCTGG - Intronic
1065022644 10:21513305-21513327 TGTTCTGCACAGAACCTGACTGG + Intergenic
1065471972 10:26091540-26091562 TGATGTCCCCAGCACTTAACAGG + Intronic
1067545339 10:47188740-47188762 TGGTGTCCTCAGAACCTCACAGG + Intergenic
1068598930 10:58935254-58935276 TGTTGGCCAGAGAAAATCACAGG - Intergenic
1069203492 10:65653316-65653338 TGCTGACCACAGCACTTCAGTGG - Intergenic
1075719028 10:124574400-124574422 TCGAGTCCCCAGAACTTCACAGG + Intronic
1076375762 10:129983673-129983695 TTCTGTCCAGAAAACTTCACAGG - Intergenic
1077424680 11:2469180-2469202 TGTTGTCCACATATCTTCTTTGG + Intronic
1078913765 11:15758461-15758483 TCTTGTCCACAAAAGTCCACTGG - Intergenic
1081785176 11:45741410-45741432 TGTTATCCACAGAGGTTGACTGG - Intergenic
1084384321 11:68833160-68833182 TGCTGCCCAAAGAACTTCAAGGG + Intronic
1085135105 11:74079615-74079637 TTTAGTCCTCAGAACTTCTCAGG - Intronic
1085489415 11:76900935-76900957 TGTTGTACACATGACTTCACAGG - Intronic
1086514846 11:87599926-87599948 TGAGGTCCAAAGAACTTCACTGG + Intergenic
1087165034 11:94994638-94994660 TCTGGTTCACAGAACATCACTGG - Intronic
1088872719 11:113905117-113905139 TGTTTTCCATATAGCTTCACAGG - Intronic
1089549704 11:119263725-119263747 TGTTTTCCACAAAGCCTCACAGG - Intronic
1093450283 12:19306211-19306233 TGTTGTGAACAGAAATTCACCGG + Intronic
1096592415 12:52669715-52669737 TGTTCTCCACAGACCTTCAGTGG + Intergenic
1097346246 12:58496460-58496482 TGGTGTCCACCCCACTTCACAGG + Intergenic
1099196636 12:79624612-79624634 TGTTATCAAAAGAACTGCACTGG - Intronic
1100383047 12:94079732-94079754 TGTTGTGAACAGAGCCTCACCGG + Intergenic
1101288096 12:103337274-103337296 TCTTGTCCCCAGAACTCCAGTGG - Intronic
1101346305 12:103889410-103889432 TGTGCTCCACTGCACTTCACAGG + Intergenic
1106530462 13:30585893-30585915 TCTTGACCACAAAACTTCTCAGG + Intronic
1112491427 13:99867893-99867915 TGTTTGCCCCAGAACTTCTCTGG + Intronic
1113167816 13:107462786-107462808 TGCTGTCTATAGAATTTCACTGG + Intronic
1113288237 13:108877489-108877511 TGCTGTCCTCAGCACCTCACAGG - Intronic
1113301680 13:109028802-109028824 TGATTTCCACAGACCTTTACGGG + Intronic
1116171684 14:41410342-41410364 TATTGACTACAGAAATTCACTGG - Intergenic
1117093875 14:52277280-52277302 GGTTGTCAGGAGAACTTCACAGG + Intergenic
1118969203 14:70618615-70618637 GGTTGACCACAAAACTTCAGTGG + Intergenic
1121360959 14:93259126-93259148 TGTTGTACCCAGAGGTTCACAGG - Intronic
1122311807 14:100801971-100801993 TGCCATCCACAGATCTTCACTGG - Intergenic
1125369719 15:38960405-38960427 TGTTTTCTATAGATCTTCACTGG - Intergenic
1125499102 15:40227155-40227177 TTTTGTCCACAGATTTTAACTGG - Intergenic
1130144816 15:81265900-81265922 TTTTGTCCGCAGAACTACAGAGG + Intronic
1130834813 15:87639471-87639493 TGTGACCCACAGAACTTCAAAGG - Intergenic
1131370459 15:91876757-91876779 TGTTTTGCACAGCACCTCACAGG + Intronic
1131833484 15:96368779-96368801 TGGTCTCCACAGAGCTCCACAGG + Intergenic
1132244847 15:100286393-100286415 TGCTGGCCACAGTACTTCATAGG - Intronic
1132777759 16:1605237-1605259 TGTTTCCCAGAGGACTTCACAGG + Intronic
1135137084 16:19892959-19892981 TGTTGTCCAGAGAACCTCTCTGG + Intergenic
1137991336 16:53159470-53159492 CATTGTCCACAGAATCTCACAGG - Intronic
1138773965 16:59697929-59697951 TTTTGACCACAGATATTCACAGG + Intergenic
1139840309 16:69873317-69873339 TGTGGTCCACAGAAGATGACAGG - Intronic
1143112902 17:4562727-4562749 TCTTGTCCAAAGAACTTGTCAGG - Intergenic
1143269972 17:5668244-5668266 CGTGGTCCACAGAACCTCAGGGG - Intergenic
1144514741 17:15909622-15909644 TGTCCTCCACAGAACTTGACAGG + Intergenic
1145127611 17:20315068-20315090 TGTACCCCACAGAACTTGACAGG + Intronic
1146736433 17:35242753-35242775 TGTCCTCCAGAGAACTTCCCTGG - Intergenic
1152060037 17:78065682-78065704 TCTTGTCAACAGAATTCCACTGG + Intronic
1153352151 18:4092796-4092818 TCTTTTCCACAGACCTTTACTGG - Intronic
1157114354 18:44849166-44849188 TGTTGTCCACAGAAGCATACGGG - Intronic
1158400702 18:57118860-57118882 TGGTGTCCACAGAGCTTAGCAGG + Intergenic
1159745969 18:72235231-72235253 TGTTGTCCACAGGACTGGAGAGG + Intergenic
1163343161 19:16722963-16722985 TGCTGGCCATACAACTTCACTGG + Intronic
1163479839 19:17548554-17548576 TGTTCTCCACACACCTTCCCTGG - Intronic
1163533610 19:17864529-17864551 TGTAGACCACAGAACCCCACGGG + Intergenic
1164232429 19:23302189-23302211 TGTTGCCCAGAGAACATCAGTGG + Intergenic
1164391093 19:27822086-27822108 TGTTGGCCAGAGAACATCAGTGG + Intergenic
1164710263 19:30352184-30352206 TCTTGTCTACAGCACGTCACCGG + Intronic
1167567197 19:50264153-50264175 TGTTGTCCACAGAACTTCACTGG - Intronic
934219947 2:90073550-90073572 TGTGGTCCTCAGAGCTTCTCTGG + Intergenic
935944449 2:108272708-108272730 TTTTGATCACAGACCTTCACAGG - Intergenic
937982752 2:127624812-127624834 TGCTGCCCCCAGAACTTCAGGGG - Intronic
940143548 2:150522057-150522079 TGGTGTGCACAGAACATCTCAGG - Intronic
946561616 2:220920447-220920469 TGTTATCCAAACAACTTAACTGG - Intergenic
947686186 2:232087544-232087566 TGGTGTCCACAGAGCTCCTCGGG - Exonic
1174755137 20:53150825-53150847 TGTTGGCCTCAGAGCTCCACTGG - Intronic
1181148491 22:20865795-20865817 TGTTGTCCACATGACTCCATGGG - Intronic
1181790327 22:25260600-25260622 TGTTGACCTCAGAACAACACAGG - Intergenic
1181826139 22:25517602-25517624 TGTTGACCTCAGAACAACACAGG - Intergenic
1181903518 22:26174456-26174478 TGCTCTCCCCTGAACTTCACGGG + Intronic
949146791 3:710390-710412 TGTTGTCGGCAGCACTTCTCAGG + Intergenic
949469123 3:4376050-4376072 TGTTGTCCCACGAACTGCACAGG - Intronic
950834151 3:15903284-15903306 AGTTGTCCAAAGAAGGTCACAGG + Intergenic
952856033 3:37771568-37771590 TCTGTACCACAGAACTTCACTGG + Intronic
953350979 3:42215983-42216005 TGTTGTCCCCAGCACTTCCCAGG + Intronic
954058264 3:48046594-48046616 TGATGCCCACATTACTTCACAGG + Intronic
954961357 3:54567858-54567880 TGTTTTCCATACAACATCACTGG - Intronic
955006226 3:54971206-54971228 TGTGGACCATACAACTTCACAGG - Intronic
955538269 3:59947764-59947786 TGCTGGCCAAAGCACTTCACTGG + Intronic
957581779 3:82083000-82083022 TGCTAACCACAGAACTTCTCAGG - Intergenic
967498501 3:190169492-190169514 TATTGACCTCAGAACCTCACTGG + Intergenic
967776347 3:193389954-193389976 AGTAGTCCACAGAAATTCATAGG - Intergenic
967799519 3:193640691-193640713 TTATGTCCACAGAACTTAAAGGG - Intronic
967982142 3:195072077-195072099 TTGTGTCCACAGGACCTCACAGG + Intronic
968469599 4:773346-773368 TGTTGTCCACAGCTCTGCTCGGG + Intergenic
977514274 4:97999934-97999956 TTTTCTCCACAGAAATTCTCTGG - Intronic
977811448 4:101360209-101360231 TGTCTGCCAAAGAACTTCACTGG - Intergenic
978689638 4:111491050-111491072 TGTTGTCCACTGTTATTCACTGG + Intergenic
978690474 4:111503638-111503660 TGTTGTGCACAGAAACACACAGG - Intergenic
979830758 4:125298426-125298448 TATTCTCCACATGACTTCACTGG - Intergenic
980222261 4:129934074-129934096 TGATTTCCACAGTACTCCACAGG + Intergenic
980399652 4:132264958-132264980 TATTTTCCACAGAATGTCACTGG - Intergenic
981409438 4:144411463-144411485 TGTGGTCCACCCTACTTCACAGG - Intergenic
982769203 4:159380169-159380191 TATTGTCCAGATAACTGCACTGG - Intergenic
983391783 4:167141073-167141095 TGTTTTCCATAGAGCTTCTCAGG - Intronic
983475530 4:168207744-168207766 TGTTGTCCCCAAAACTTAATTGG + Intergenic
986201007 5:5578319-5578341 CATTGTCCTCAGTACTTCACAGG - Intergenic
987159925 5:15131979-15132001 TGTTGGCCAAAGCACTTCATTGG + Intergenic
991288760 5:65010249-65010271 TTTTGTCCACATCACTTCTCTGG - Intronic
992915122 5:81442130-81442152 ATTTTTCCACAGAAGTTCACAGG - Intronic
993254639 5:85574050-85574072 TGATGTCCAAAGATCATCACAGG + Intergenic
995300447 5:110574728-110574750 TGTTCTTCACACAACTTCTCTGG + Intronic
997043873 5:130290261-130290283 TGTTCTCCACACAGCTTGACTGG - Intergenic
997217954 5:132129952-132129974 TTTTCTCCACAGACCTTTACTGG + Intergenic
998794250 5:145800888-145800910 TGTTTTGCACAGAACTTAAATGG - Intronic
999037806 5:148373176-148373198 TCTTCTCCACAGGAATTCACAGG + Intergenic
1001091023 5:168741015-168741037 TTTTGTACACAGAACTTCCAGGG + Intronic
1004248753 6:14004804-14004826 TCTTGTCCACAGAGTTTCTCTGG + Intergenic
1007694018 6:43720161-43720183 TGGTGCCCCCAGAACTTCCCTGG - Intergenic
1008376060 6:50793650-50793672 TGATGCCCAAAGAACTTCAGAGG + Intergenic
1008384360 6:50871436-50871458 TGTTTTCCAAAGAATTTCAATGG + Intergenic
1009439731 6:63662973-63662995 TGTTGTCCACTCAACTTAAGGGG - Intronic
1012297025 6:97537318-97537340 TGGTGTCCACAGTCCTACACAGG - Intergenic
1013629517 6:111972530-111972552 TATTGTCCATATGACTTCACAGG - Intergenic
1014468354 6:121784029-121784051 TGTAGTCCCCAGTACTTCAGAGG - Intergenic
1025870035 7:65422770-65422792 TGTTGGCCAGAGAACATCAGTGG - Intergenic
1032708212 7:134440548-134440570 TGTTGTGCCCCCAACTTCACAGG + Intergenic
1037457285 8:19075977-19075999 TTTTCTCCAAAGAGCTTCACAGG + Intronic
1039615391 8:38951216-38951238 TGTTCGGCACAGAACTGCACAGG - Intronic
1042176360 8:66040569-66040591 TGTTTTCCACATTACTTGACTGG + Intronic
1044640805 8:94379428-94379450 TGTTGTCCATAAAACTCCACTGG + Intronic
1046842686 8:118877679-118877701 TGTTGTTCACAGAGGTTCTCTGG - Intergenic
1047319899 8:123768991-123769013 TGGTGTCCACAGGACTCGACTGG + Intronic
1047601956 8:126434470-126434492 TGTTGTCAACAGGACTGCATGGG - Intergenic
1047783185 8:128126593-128126615 TATTGTTCACAGATATTCACTGG + Intergenic
1048400002 8:134056574-134056596 TGATGTCCTCAGAACTTTATTGG + Intergenic
1048852537 8:138658565-138658587 TGCTGTCTGCACAACTTCACTGG + Intronic
1049156180 8:141068013-141068035 TGTTGTCCTAAGTGCTTCACAGG + Intergenic
1051750134 9:20332660-20332682 TTTTGACCAGAGCACTTCACAGG - Intergenic
1052652677 9:31323994-31324016 ATTTGTCCACAGCACTTCAAAGG + Intergenic
1053415553 9:37944913-37944935 TGTTGTACACAGGTCTGCACAGG - Intronic
1058073020 9:100620433-100620455 TGTTGTGACCAGAAGTTCACAGG - Intergenic
1059586989 9:115617763-115617785 TTTTTTCCACAGAGCTGCACTGG + Intergenic
1059919992 9:119149421-119149443 TGTGTTCCACAGAAGTTCAGAGG - Intergenic
1185913747 X:4011242-4011264 TGTTTTCCAGAGAACTTCATGGG - Intergenic
1186550023 X:10494281-10494303 TGTTTTCCACAAAATTTAACAGG - Intronic
1186878029 X:13836451-13836473 TTATATCCACAGAACTTCATTGG - Intronic
1187859293 X:23666296-23666318 TCTTGTACACAAAACTTCGCAGG - Intronic
1188595241 X:31892332-31892354 TGATGGGCATAGAACTTCACCGG + Intronic
1189220481 X:39367686-39367708 CTTTGTCCACAGCACTTCACTGG - Intergenic
1193109653 X:77715051-77715073 TGATGTCAACAGACCTACACTGG - Intronic
1193274490 X:79570168-79570190 TGTTGGCCAGAGAACATCAGTGG + Intergenic
1193608320 X:83595539-83595561 TGTTGTCAACTGAACTCCACAGG - Intergenic
1194329679 X:92566064-92566086 TGATGTCAACAGGATTTCACAGG + Intronic
1195291879 X:103437649-103437671 TGTTGTGCACAGCTCTGCACTGG - Intergenic
1196569758 X:117252026-117252048 TGTTTTAAACAGAACTTTACTGG + Intergenic
1199786943 X:151114334-151114356 TGCTGGCCAAAGTACTTCACTGG + Intergenic
1200638381 Y:5685256-5685278 TGATGTCAACAGGATTTCACAGG + Intronic
1200660436 Y:5950791-5950813 TGTGGTGCTCAGAACTTCTCTGG + Intergenic
1200665128 Y:6012720-6012742 TGATGGCCAAAGAGCTTCACTGG + Intergenic