ID: 1167567366

View in Genome Browser
Species Human (GRCh38)
Location 19:50265112-50265134
Sequence GTTGCTGCACTGCGGCCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 160}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167567360_1167567366 7 Left 1167567360 19:50265082-50265104 CCACCATGGAGCTCACAGTCTGG 0: 2
1: 4
2: 56
3: 304
4: 1106
Right 1167567366 19:50265112-50265134 GTTGCTGCACTGCGGCCTGTGGG 0: 1
1: 0
2: 0
3: 11
4: 160
1167567359_1167567366 11 Left 1167567359 19:50265078-50265100 CCTGCCACCATGGAGCTCACAGT 0: 1
1: 2
2: 37
3: 219
4: 1063
Right 1167567366 19:50265112-50265134 GTTGCTGCACTGCGGCCTGTGGG 0: 1
1: 0
2: 0
3: 11
4: 160
1167567363_1167567366 4 Left 1167567363 19:50265085-50265107 CCATGGAGCTCACAGTCTGGGAC 0: 1
1: 0
2: 1
3: 40
4: 269
Right 1167567366 19:50265112-50265134 GTTGCTGCACTGCGGCCTGTGGG 0: 1
1: 0
2: 0
3: 11
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167567366 Original CRISPR GTTGCTGCACTGCGGCCTGT GGG Intronic
900867596 1:5279577-5279599 GCTGCTGCACTCCAGCCTGGGGG - Intergenic
901626982 1:10630111-10630133 TCAGCTGCACTGCGGCCTGGTGG + Exonic
901835217 1:11919777-11919799 GTGGCTGTGCTGCTGCCTGTAGG - Exonic
902931631 1:19735506-19735528 GTTCCTGCACTACAGCCTTTTGG - Intronic
903953390 1:27009550-27009572 GTTGCTGCAGTCCAGCCTGTGGG + Intronic
904186633 1:28710104-28710126 GTTACTGCACTCCAGCCTGGGGG + Intronic
904726929 1:32556112-32556134 GTTACTGCACTCCAGCCTGGGGG - Intronic
904797667 1:33069566-33069588 GTCACTGCACTTCGGCCTGGGGG + Intronic
905342607 1:37289632-37289654 CCTGCTTCACTGCGGCCTGGGGG + Intergenic
905435235 1:37951224-37951246 ATTGCAGCACTGCAGCCTGCAGG + Intergenic
912350130 1:109004683-109004705 GTTGATGCACAGAGGCCTATCGG - Exonic
912785140 1:112595459-112595481 ACTGCTGCACTGCAGCCTGAGGG - Intronic
915529776 1:156496686-156496708 GCTGCTGCACTGCGGGAGGTGGG - Intronic
916336876 1:163682097-163682119 CTTGCTGAACTGTGGGCTGTGGG + Intergenic
916786312 1:168089637-168089659 GTTGGTGCACTGGCGCCTGGAGG - Intronic
917487892 1:175471484-175471506 GTTACTGTACTGAGGACTGTAGG + Intronic
921637660 1:217515134-217515156 GCTGCTGCACTCCAGTCTGTGGG - Intronic
922952188 1:229568369-229568391 GTCACTGCACTCCGGCCTGGGGG + Intergenic
1064500523 10:15967164-15967186 TTTGCTGCACTGCGGCTTCACGG + Intergenic
1065908840 10:30283720-30283742 GTTGGTGAACTACAGCCTGTAGG + Intergenic
1069297979 10:66870956-66870978 GTTGATGCACTGTGGACTGAAGG + Intronic
1073792561 10:106955117-106955139 TTTGCTGCACTGTGGCTGGTGGG + Intronic
1074790948 10:116887356-116887378 GCTGCTGAGCTGCGGCCTGAAGG + Intronic
1076064806 10:127440731-127440753 AGCGCTGCTCTGCGGCCTGTGGG + Intronic
1079836891 11:25346871-25346893 GTCACTGCACTACAGCCTGTGGG - Intergenic
1080711924 11:34756992-34757014 GTTGCTGTACTGAGTACTGTAGG - Intergenic
1081563875 11:44244142-44244164 GTTGATGCACTCTGACCTGTGGG - Exonic
1083773800 11:64883252-64883274 TTTGCTGCTCTGCAGCCTGGGGG + Intronic
1083827999 11:65213950-65213972 GCTGCTGCCCTGCGGCCTGCTGG + Intergenic
1088358772 11:108969682-108969704 GTTGCTGTCCTGTGACCTGTAGG - Intergenic
1091600000 12:1912350-1912372 GTGTCTGCACTGAGGCCTATGGG - Intronic
1094397454 12:30023889-30023911 GTTACTGCACTGAATCCTGTAGG - Intergenic
1100862132 12:98817492-98817514 GATGCTGGCCTGCGGCCTCTGGG - Intronic
1101969181 12:109300866-109300888 GCTGCTGCACTCCAGCCTGGGGG + Intronic
1102627345 12:114245723-114245745 GTTGCTACACTGCCCCTTGTTGG - Intergenic
1103822760 12:123712004-123712026 GCTACTGCACTCCAGCCTGTGGG + Intergenic
1104234583 12:126921281-126921303 GCTGCTGCACTCCAGCCTGGTGG - Intergenic
1105548337 13:21368308-21368330 GTTGCTTAACTATGGCCTGTGGG + Intergenic
1112526895 13:100158138-100158160 GTTGCTGTACTGGATCCTGTAGG + Intronic
1114650376 14:24280907-24280929 GTGGCTGCACTCCAGGCTGTAGG + Intergenic
1115028630 14:28768437-28768459 CTCGGTGCCCTGCGGCCTGTCGG + Exonic
1115796082 14:36937130-36937152 GTTGCTGCAGTGCAGCCTCAGGG - Intronic
1118251805 14:64169063-64169085 GTTGGTGCCCTGTGCCCTGTTGG + Intronic
1119298745 14:73553673-73553695 GCTGCTGCACTCCAGCCTGGGGG - Intronic
1122430981 14:101643227-101643249 GCTGCTGCACTCCAGCCTGGGGG + Intergenic
1124966243 15:34435210-34435232 GTGGCTGCAGTGAGGGCTGTTGG - Intronic
1124982845 15:34581293-34581315 GTGGCTGCAGTGAGGGCTGTTGG - Intronic
1125143594 15:36439548-36439570 GTTGCTGCACTTCAGCCTCTAGG + Intergenic
1126494355 15:49273991-49274013 GTTGCTGCCCTTGGGCCTGAAGG + Intronic
1127029043 15:54841209-54841231 GCTGCTTCAGTGTGGCCTGTGGG - Intergenic
1128240675 15:66099121-66099143 GTTGCAGGACTGGGGCCTGCAGG + Intronic
1130146334 15:81276543-81276565 GTTGCTCCCCTGGGGCCTGTTGG - Intronic
1130688544 15:86060370-86060392 GCTGCTGCACTCCAGCCTGGGGG - Intergenic
1132938974 16:2497567-2497589 GGTGCCACGCTGCGGCCTGTTGG + Intronic
1133158766 16:3895010-3895032 GTTACTGCACTGAGTACTGTGGG - Intergenic
1133487718 16:6236473-6236495 GCTGCTGCACTCCAGCCTGAGGG - Intronic
1134492143 16:14703329-14703351 GCTGCTGCGGTGCCGCCTGTAGG + Intergenic
1134497524 16:14742451-14742473 GCTGCTGCGGTGCCGCCTGTAGG + Intronic
1139297213 16:65911877-65911899 GTTACTGTACTGCAGACTGTAGG - Intergenic
1140907724 16:79423510-79423532 GTTGGTGAACTACAGCCTGTGGG + Intergenic
1141533357 16:84661835-84661857 CTGGTTGCACTGCGGGCTGTAGG - Exonic
1142097599 16:88250916-88250938 GCCGCTGCACTCCAGCCTGTGGG - Intergenic
1142570628 17:871443-871465 GCTGCTGCACTCCAGCCTGGGGG - Intronic
1142721833 17:1781366-1781388 GTCGCTGCACTGTGGCCCATGGG - Exonic
1143668157 17:8376679-8376701 GTTGCTGCTCGGGGGCCTCTGGG - Intronic
1146222485 17:31036891-31036913 GCTGCTGCACTCCAGCCTGGGGG - Intergenic
1146344731 17:32051438-32051460 GCTGCTGCACTCCAGCCTGGGGG + Intronic
1150885686 17:69082874-69082896 TTTCCTGCCCTGCAGCCTGTGGG + Exonic
1152018314 17:77766606-77766628 GTTGCTGCCCTGCTGCATGAAGG + Intergenic
1152260197 17:79262665-79262687 GTAGCTCCACTCCTGCCTGTGGG - Intronic
1155545003 18:26905578-26905600 GTTGCTGCAATGCAGTCTTTAGG + Intergenic
1157622507 18:49024559-49024581 GTCACTGCACTCCGGCCTGGGGG - Intergenic
1157721624 18:49929570-49929592 GTTGCTGCACTGCTCTCTTTGGG + Exonic
1159177601 18:64858592-64858614 GTTGTTATACTGGGGCCTGTTGG + Intergenic
1162129352 19:8516148-8516170 GCCACTGCACTGCGGCCTGGGGG - Intergenic
1162668329 19:12234019-12234041 GCTGCTGCACTCCAGCCTGGGGG + Intronic
1163552360 19:17972675-17972697 GCTCCTGCACTGTGGCCTATGGG - Intronic
1165135096 19:33662780-33662802 TTTGCTGCACTGCTCCCAGTGGG + Intronic
1166510827 19:43407782-43407804 CCTGCTGCACTGCGTCCTGTTGG - Intronic
1167405980 19:49308998-49309020 GTTGTTGGACTGGGGCATGTAGG + Exonic
1167567366 19:50265112-50265134 GTTGCTGCACTGCGGCCTGTGGG + Intronic
925155982 2:1649233-1649255 GTTGCTGCAGTGCTGTCCGTCGG + Exonic
928415295 2:31086752-31086774 GTTGGTGCACTACGGACTCTTGG + Intronic
929572244 2:43029962-43029984 GCTGCTGCACTCCAGCCTGAGGG + Intergenic
931271579 2:60708370-60708392 GTCACTGCACTCCAGCCTGTGGG + Intergenic
933630162 2:84646886-84646908 GTTACTGCACTCCAGCCTGGGGG - Intronic
933730635 2:85453655-85453677 GTGGCTACACTGCAGTCTGTGGG - Intergenic
933993406 2:87649833-87649855 GCTGCTGCACTCCAGCCTGGGGG + Intergenic
936300453 2:111301050-111301072 GCTGCTGCACTCCAGCCTGGGGG - Intergenic
937729638 2:125213124-125213146 GCTGCTGCACTCCAGCCTGGGGG - Intergenic
938109863 2:128556736-128556758 GCTCCTGAACTGCGGCCTCTGGG + Intergenic
939566225 2:143789330-143789352 GTCACTGCACTCCAGCCTGTGGG + Intergenic
944548471 2:200822026-200822048 GCTGCTGCATTCCGGCCTGTGGG + Intronic
1174440504 20:50548464-50548486 GTCACTGCACTCCGGCCTGGTGG - Intronic
1174768853 20:53279493-53279515 GTTGGTGAACTGTTGCCTGTGGG - Intronic
1175421924 20:58840173-58840195 GTGGCTGCCCGGCGGCCTATGGG - Intronic
1175806401 20:61831634-61831656 GAGGCTGCACTGTGGCCTGCCGG - Intronic
1175897786 20:62347013-62347035 GCAGGTGCACTGCAGCCTGTGGG + Exonic
1178119478 21:29453711-29453733 GTGTCTGCACTGCGGAGTGTTGG + Intronic
1178365398 21:31985650-31985672 GATGCTGCAGTGGGGCCCGTGGG + Intronic
1179710330 21:43209648-43209670 GTGGCTGCCCTCCGGCCGGTGGG + Intergenic
1179730730 21:43365896-43365918 GATGCTGCCCTGGGGCTTGTGGG + Intergenic
1180132455 21:45835331-45835353 GGAGCTGCTCTGTGGCCTGTTGG + Intronic
1181275824 22:21686980-21687002 GGAGCTGCACTGCGACCTGGTGG + Exonic
1183128543 22:35809810-35809832 GTTGCTGCTCTGCTCCCCGTGGG + Exonic
1184661725 22:45968558-45968580 GGTTGTGCACTGAGGCCTGTAGG - Intronic
1185261251 22:49865184-49865206 GTTACTACACTGAAGCCTGTAGG + Intronic
950093453 3:10313804-10313826 GCTGCTGCAGTGCAGCGTGTTGG - Intronic
951455308 3:22885520-22885542 GTTGGTGAACTGTGGCCCGTGGG - Intergenic
952063371 3:29537780-29537802 GCTACTGCACTCCAGCCTGTGGG + Intronic
952430023 3:33214208-33214230 GTTGCTGCACTTGGGCCTTCAGG - Intronic
953517525 3:43609727-43609749 GTTACTGCACTGAATCCTGTAGG + Intronic
953931552 3:47008325-47008347 GTAGCGGCACTACGGCCTCTGGG + Exonic
960027995 3:113030335-113030357 ACTGCTGCACTGCCGCTTGTGGG + Intergenic
962101498 3:132347518-132347540 GCTGCTGCACTCCAGCCTGGAGG - Intronic
965550518 3:169960426-169960448 GTCGCTGCACTCCAGCCTGGGGG - Intergenic
968080434 3:195842816-195842838 GTCACTGCACTGCAGCCTGGGGG - Intergenic
969360750 4:6662021-6662043 GTCACTGCACTCCAGCCTGTGGG + Intergenic
970069937 4:12146544-12146566 GTTGCTGGACTGCTGCCCATGGG - Intergenic
974341552 4:60619946-60619968 GTTGGTGCACTGATGGCTGTTGG - Intergenic
975114152 4:70660419-70660441 ATTGCTGCACTCCAGCCTGGGGG - Intronic
978562243 4:110045489-110045511 GCTGCTGCACTCCAGCCTGGGGG + Intergenic
984253545 4:177363789-177363811 GCTACTGCACTGCAGCCTGGGGG - Intergenic
990587177 5:57223872-57223894 ATCGCTGCACTCCGGCCTGGGGG - Intronic
991632085 5:68666424-68666446 GTTGGTAAACTGTGGCCTGTAGG - Intergenic
999325184 5:150639369-150639391 GTTCCTGCTCTGGGGCCTCTGGG + Intronic
1001482559 5:172098559-172098581 ACTGCTGCACTGCAGCCTGTTGG - Intronic
1001578870 5:172784671-172784693 GCCGCTGCACTGCAGCCTGGGGG + Intergenic
1002571319 5:180140772-180140794 GTGGCTGCACTGAGGGCTGACGG + Intronic
1003136910 6:3441020-3441042 GGTGCTGGGCTGGGGCCTGTAGG + Intronic
1005611888 6:27533825-27533847 GCTGCTGCACTCCAGCCTGGGGG + Intergenic
1007347117 6:41239650-41239672 GCTGCAGCACCGCGGGCTGTTGG - Intergenic
1007701431 6:43768691-43768713 GTTGGGGCTCTGAGGCCTGTGGG - Intergenic
1007727346 6:43924423-43924445 GCGGCTGCACTGCGGGCTCTGGG - Intergenic
1015519443 6:134115531-134115553 GTGGCTGCGCTGCGCGCTGTGGG + Intergenic
1017466109 6:154695117-154695139 GCTGCTGCACTCCAGCCTGGGGG + Intergenic
1017971277 6:159314718-159314740 GGTGCTGCCCTGAGGCCTGTGGG + Intergenic
1018686322 6:166307482-166307504 GCTGCTGCACGGCGGCCTGCAGG - Exonic
1019051372 6:169186229-169186251 GTTCCTGCACGGAGGCCTCTAGG + Intergenic
1019817297 7:3210675-3210697 GACACTGCACTGCGGCCTGCTGG - Intergenic
1027250820 7:76397755-76397777 GATCCTGCACAGTGGCCTGTGGG - Exonic
1027524657 7:79252114-79252136 GCTGCTGCACTCCAGCCTGTGGG + Intronic
1027635147 7:80662400-80662422 GATGCTGTACTGAGACCTGTTGG + Intronic
1029555413 7:101265391-101265413 GCTGCTGCACTCCAGCCTGGGGG + Intergenic
1030211621 7:107002018-107002040 GCTGCTGCACTCCAGCCTGGGGG + Intergenic
1032177019 7:129639098-129639120 GTCACTGCACTGCAGCCTGGGGG - Intronic
1033288030 7:140059256-140059278 GTTGCTGCACAGCAGTCAGTCGG + Intronic
1038402127 8:27292236-27292258 GTTGCTGCACTGAATACTGTAGG - Intronic
1039010498 8:33088164-33088186 ATTGCTGCTCTGCTGCTTGTTGG - Intergenic
1039505508 8:38049520-38049542 GCTACTGCACTCCGGCCTGGGGG - Intronic
1045216504 8:100154379-100154401 GCTGCTGCACTCCAGCCTGATGG + Intergenic
1048253649 8:132888080-132888102 GGTGCTGCACTGTGGGATGTAGG - Exonic
1049202594 8:141348883-141348905 GTTACTGTACTGAGTCCTGTGGG - Intergenic
1049767791 8:144362986-144363008 CTTGCTCCTCTGCGGCCTGGGGG - Intergenic
1050863363 9:10465671-10465693 GTTGCTGTACTGAGTACTGTAGG - Intronic
1051370476 9:16355100-16355122 GTGGCTACACTGAGTCCTGTGGG - Intergenic
1055493132 9:76826430-76826452 GTTACTGCACTCCAGCCTGGGGG + Intronic
1056836912 9:89962822-89962844 GCTGCAGCACTGGGGCCTGTTGG - Intergenic
1057985093 9:99705237-99705259 GTTGGCACACTGTGGCCTGTGGG - Intergenic
1060876496 9:127087649-127087671 GTTGATGCACTGCAGCATGGTGG - Exonic
1061580410 9:131532437-131532459 GCTACTGCACTCCGGCCTGGGGG + Intergenic
1061854372 9:133433502-133433524 GTTGTTGCACTGCCGCCTCCTGG - Exonic
1062102957 9:134737975-134737997 GTTGCAGCCCTGGGGCCTGACGG + Intronic
1185761294 X:2691384-2691406 GCTGCTGCTCTTCGGCCTGCTGG + Exonic
1186699765 X:12077688-12077710 TTTGATGCACTGCTGCCAGTTGG + Intergenic
1190266437 X:48829806-48829828 GTGGCTGCTCTGTGGCCTGAAGG + Exonic
1190848021 X:54212183-54212205 GCTACTGCACTCCAGCCTGTGGG + Intronic
1194976749 X:100403719-100403741 GTTGCAGCACAGCTGCTTGTAGG - Intronic
1197492777 X:127139265-127139287 GTTTCTGCACTACAGTCTGTGGG - Intergenic
1200418046 Y:2934185-2934207 GCCACTGCACTGCAGCCTGTGGG - Intergenic
1200786704 Y:7267062-7267084 GCTGCTGCACTCCAGCCTGGGGG - Intergenic
1201632503 Y:16084568-16084590 GTCACTGCACTCCAGCCTGTTGG + Intergenic