ID: 1167569221

View in Genome Browser
Species Human (GRCh38)
Location 19:50276535-50276557
Sequence TTTCCAAAAGGCCCTTCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 211}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167569221_1167569226 -1 Left 1167569221 19:50276535-50276557 CCTGAGGAAGGGCCTTTTGGAAA 0: 1
1: 0
2: 1
3: 21
4: 211
Right 1167569226 19:50276557-50276579 AAGGGTTTTGAAAGGTGAATAGG 0: 1
1: 1
2: 6
3: 56
4: 602
1167569221_1167569225 -9 Left 1167569221 19:50276535-50276557 CCTGAGGAAGGGCCTTTTGGAAA 0: 1
1: 0
2: 1
3: 21
4: 211
Right 1167569225 19:50276549-50276571 TTTTGGAAAAGGGTTTTGAAAGG 0: 1
1: 0
2: 5
3: 54
4: 439

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167569221 Original CRISPR TTTCCAAAAGGCCCTTCCTC AGG (reversed) Intronic
900431435 1:2604914-2604936 TGGCCACACGGCCCTTCCTCTGG + Intronic
901674777 1:10876770-10876792 GCTCCCATAGGCCCTTCCTCAGG + Intergenic
901954048 1:12771180-12771202 TTTCCCCCAGGCCCTTGCTCAGG - Intergenic
903133286 1:21292997-21293019 TTTTCAAAAGTCTTTTCCTCTGG - Intronic
903601489 1:24544700-24544722 TTTCCTATATGCCCTCCCTCTGG - Intergenic
904647350 1:31977827-31977849 TTTCCAAAATTCCCTCCCTCAGG - Intergenic
904897427 1:33827413-33827435 TCCCCAAAAGGCCTTTCCTCAGG + Intronic
905008212 1:34728560-34728582 TTTCCAAAAGACACATCCCCAGG + Intronic
906549926 1:46656108-46656130 GTTCCAAGTGTCCCTTCCTCTGG - Intronic
906612378 1:47212355-47212377 TTTCCCCAAGCCTCTTCCTCAGG + Intergenic
906738723 1:48159484-48159506 TTTCCTAAACGCCCATTCTCTGG - Intergenic
907267841 1:53273643-53273665 TTTCCACAAGTTCCTTCTTCTGG + Intronic
911107117 1:94142490-94142512 AGTCCAAAAGGCCCATCTTCAGG - Intergenic
911450735 1:98057196-98057218 ATTTCAAAAAGCCCTTCTTCGGG - Intergenic
912671461 1:111631586-111631608 ATTGCAAAAGTCCCTTCTTCTGG - Intronic
912734263 1:112136025-112136047 TTGCCAGAAGTCCCTTCCTAGGG - Intergenic
916405412 1:164493229-164493251 TTTCCAAGAGGCCTTTCCTGAGG + Intergenic
916678464 1:167083672-167083694 AGCTCAAAAGGCCCTTCCTCAGG - Intronic
917586990 1:176437286-176437308 ATCCCAAGAGTCCCTTCCTCTGG + Intergenic
919017964 1:192065254-192065276 TTTCCCAAAAGCAGTTCCTCAGG + Intergenic
920646192 1:207806136-207806158 TTTACAAAAGAGCCTTCCCCAGG - Intergenic
922011455 1:221592839-221592861 TTTCCAGTAAGCCCTTCCTAGGG + Intergenic
922847459 1:228699012-228699034 TTTCCAAAAGACCCAATCTCAGG + Intergenic
1064112086 10:12548335-12548357 TTTCCAATATGTCCATCCTCAGG + Intronic
1064612092 10:17114293-17114315 TTTCCATAAGGCCAATCCACTGG + Intronic
1065222897 10:23514227-23514249 TCTCCAAATGGCTCTTCCTGTGG + Intergenic
1066501343 10:35997737-35997759 TATCCAAGAAGCCCTTCCTGGGG - Intergenic
1066629212 10:37442051-37442073 TATCCAAGAAGCCCTTCCTGGGG - Intergenic
1067801286 10:49361160-49361182 TTTCTAAAATGCTCTTCCTGGGG + Intergenic
1068854481 10:61783483-61783505 TGTCAAAAGGGCTCTTCCTCTGG + Intergenic
1068993704 10:63178837-63178859 TTTAAAAAAGGACCTTCCTGTGG - Intronic
1071900076 10:90111044-90111066 TTTCCCAAAGTCCTTTCCTTTGG + Intergenic
1072537634 10:96375357-96375379 TTTCCAAAAGGCGTTCCCTTGGG - Intronic
1076491889 10:130867302-130867324 TCTCCAAAGGGCCCTGCCTACGG - Intergenic
1076685226 10:132195646-132195668 TTTCTTCAAGGCCATTCCTCTGG + Intronic
1080289807 11:30658339-30658361 TTTCCACAATCCCCTTCCTCAGG + Intergenic
1081453594 11:43198095-43198117 ATTCCCAATGCCCCTTCCTCAGG - Intergenic
1081601194 11:44495857-44495879 TTTCTAACAAGCCTTTCCTCTGG - Intergenic
1084075368 11:66771134-66771156 TATCCAAATGGCACTTCTTCTGG + Intronic
1088096112 11:106103119-106103141 TTCTGAATAGGCCCTTCCTCCGG - Intergenic
1090440627 11:126722266-126722288 TTCCCAAAAGGCCCTTCTCCTGG + Intronic
1091224955 11:133951578-133951600 TTTCCAAGAGTCCTTTCCCCAGG + Intronic
1091958357 12:4667994-4668016 TTTCCATCAGGCCCTTTTTCTGG + Intronic
1092009437 12:5097303-5097325 TTCCCAAATGCCCCATCCTCTGG + Intergenic
1092024209 12:5227391-5227413 GTTCCCAAAGGCTCTTCCCCAGG + Intergenic
1092216696 12:6688840-6688862 TTTCTCAAAGACCCTTCCTTGGG + Intronic
1094645802 12:32322892-32322914 TTTCCAAAACGCCCTTCAAAAGG - Intronic
1095071235 12:37851077-37851099 TTTCCAAAAGGCTCTTTCAAGGG + Intergenic
1095795218 12:46211427-46211449 TTTACAAAAGGCCCTAACCCTGG + Intronic
1100545235 12:95596105-95596127 TTTTCATAAGGATCTTCCTCTGG - Intergenic
1100984291 12:100189769-100189791 TTCCCGACAGGCCCTGCCTCAGG - Intergenic
1101583813 12:106067209-106067231 GTTTCAAGATGCCCTTCCTCCGG + Exonic
1101816861 12:108152119-108152141 TTTCCTCTTGGCCCTTCCTCGGG - Intronic
1103873871 12:124112154-124112176 TATTCAAAAGTCACTTCCTCAGG + Intronic
1104010432 12:124926384-124926406 TTTTCCAAGGGCCCTCCCTCGGG + Intergenic
1106169007 13:27272562-27272584 CTTCCACAAGACCTTTCCTCTGG - Intronic
1107736793 13:43407175-43407197 TTTTCAGAAGGCCCCACCTCTGG - Intronic
1111054306 13:82927830-82927852 TTTTCAAAAGGACCCTCCTTAGG - Intergenic
1112567594 13:100564710-100564732 TTTTCAAATGGCCATTCCTGTGG - Intronic
1112594534 13:100795941-100795963 TTTCCAAAATGCCTTGCCTTTGG + Intergenic
1113205059 13:107907524-107907546 CTCCCACCAGGCCCTTCCTCCGG - Intergenic
1113567787 13:111329127-111329149 TTTCCAAAAGGGGCCTCCACAGG - Intronic
1114339019 14:21723736-21723758 TTTGGAAATGGCCCTTCCTCAGG - Intergenic
1114925520 14:27392698-27392720 TTTCCAAAAGTCATTTCCTTTGG - Intergenic
1115072542 14:29342041-29342063 TTTCCAAAATTACCTTCCCCTGG - Intergenic
1117748478 14:58896363-58896385 TTTCCAAAAGACCAGTCTTCAGG - Intergenic
1118654335 14:67931231-67931253 ATTTCAAAAGGCCCATCTTCAGG + Intronic
1121122312 14:91383645-91383667 TTTCCAACTGGCCATTCATCCGG - Intronic
1121379985 14:93456606-93456628 TTCCCAAAAGGTCCTTCTTAGGG + Intronic
1122475763 14:102007915-102007937 TCGCCACAAGGCCTTTCCTCGGG + Intronic
1124552379 15:30693443-30693465 ATTCCAAAGGGTCCTTCCTGGGG - Intronic
1124678860 15:31712223-31712245 ATTCCAAAGGGTCCTTCCTGGGG + Intronic
1125291315 15:38150823-38150845 TTTCCTAAAGGCCATTTGTCAGG + Intergenic
1126484978 15:49170149-49170171 CTTCCAATCGGCCCCTCCTCTGG - Exonic
1128712858 15:69885113-69885135 TTTCCACAAAGCCCTTCCATGGG - Intergenic
1129748007 15:78038416-78038438 TTCCCAACAGGCCCTGCCTCAGG - Intronic
1130050207 15:80478230-80478252 TTTCCAAAAGCCACATCCTGTGG - Intronic
1131036095 15:89222918-89222940 TTTCCAAAAGCCCTTTCCCTGGG + Intergenic
1132458117 16:35498-35520 TTGCCAAAGGGCCCTGCCCCAGG + Intergenic
1133018259 16:2954900-2954922 TGCCCAAATGGCCCTTCCTGGGG + Intergenic
1134368161 16:13598501-13598523 TTTCCAAAATGCTTTTCCTCCGG + Intergenic
1137517133 16:49156227-49156249 TCTCCAAAAGTCCTTTCCTGGGG - Intergenic
1139582373 16:67881076-67881098 TTTCCTGAAGGCCATTCCTGGGG - Exonic
1141072497 16:80970435-80970457 TTACCAAAAGGAACTTCCTTAGG + Exonic
1141216669 16:82031827-82031849 TTTCCAAAAGGCCCCTCTGCTGG + Intergenic
1142578560 17:925896-925918 TATCCAAAACTCCCTTTCTCTGG + Intronic
1144863486 17:18320329-18320351 TTTCCATAAAGCTCCTCCTCAGG - Intronic
1149722693 17:58862217-58862239 TTTGCCAAAAGCCCTTCCACTGG - Intronic
1153761647 18:8337683-8337705 AGTCCAAAAGTCACTTCCTCAGG - Intronic
1155136739 18:23002920-23002942 TTTGCAAAAGGTCCTTCTTGGGG - Intronic
1156138524 18:34076143-34076165 TTTACGAAAGGTGCTTCCTCTGG + Intronic
1156833814 18:41528421-41528443 TTTGCAAATGCCTCTTCCTCAGG + Intergenic
1157526964 18:48390879-48390901 TTGACAAAAGACCCTTTCTCTGG + Intronic
1160623033 18:80184118-80184140 TTTCCTAAACGCCCCTCATCTGG - Intronic
1163170836 19:15529933-15529955 TATTCAAATGACCCTTCCTCTGG - Intronic
1163429088 19:17256247-17256269 TCTCCAAAATGCCCTTCCTATGG - Intronic
1164694028 19:30229975-30229997 TTTCCAGAAGACCCTTAATCTGG + Intronic
1164981844 19:32620005-32620027 TTTACCAAAGGCCCTTCCAGAGG - Intronic
1165454220 19:35901292-35901314 TTACCCACAGACCCTTCCTCTGG - Intronic
1165753115 19:38273622-38273644 TTTCCACCAGTCCCTCCCTCTGG + Intronic
1166283913 19:41811838-41811860 TGTCCAAAAGGCCAGTGCTCAGG + Intergenic
1166975764 19:46604200-46604222 TTTCCCTAAGCCTCTTCCTCAGG + Intronic
1167569221 19:50276535-50276557 TTTCCAAAAGGCCCTTCCTCAGG - Intronic
925959330 2:9001156-9001178 TTTCCTGAAGGCCCTGCCTCAGG + Intronic
927154135 2:20212159-20212181 TCTCCAAATGCCCCCTCCTCAGG + Intronic
927508459 2:23629544-23629566 TGTCCACAAGGCCCATCCACTGG + Intronic
929161277 2:38834783-38834805 TTTCACAATGGCCCTTACTCTGG - Intronic
929643370 2:43603835-43603857 TTTCTAAATTGCCCATCCTCAGG - Intergenic
929671234 2:43877573-43877595 TTTCCAAAGTGTCCTTCCTGCGG + Exonic
929890063 2:45911469-45911491 TTTCCAGGAGGCCATACCTCTGG + Intronic
930294126 2:49531830-49531852 ATTCCAAATGACCTTTCCTCAGG - Intergenic
932192925 2:69756253-69756275 TTTCCAAATAGCCCTGCCTTGGG + Intronic
934662385 2:96150090-96150112 TCTCCCAGAGTCCCTTCCTCAGG - Intergenic
934856151 2:97731647-97731669 TTGCAATAAGGCCCTTCCTTAGG - Intronic
935949501 2:108315961-108315983 TTTCGAAGAAGACCTTCCTCTGG - Intergenic
938917725 2:135959764-135959786 TTTTCAAAAGGCTTTTCCACTGG + Intronic
940782035 2:157942995-157943017 CCTCCAAAAGGCCCTCCATCTGG - Intronic
940886631 2:158995519-158995541 TTTCCAAGAGTCCCGCCCTCGGG - Intronic
941168428 2:162108572-162108594 TTTCCCAAAGGGCTGTCCTCTGG + Intergenic
941794085 2:169581246-169581268 TTTTCCATAGGCCCTTCCCCAGG + Intergenic
941819531 2:169830283-169830305 TTTCCAAATTGCCCTCCCTAAGG + Intronic
943025369 2:182621402-182621424 TTTCCAAAAGGCTCAGCCCCTGG - Intergenic
943563268 2:189488517-189488539 CTTCCCAAAGGACCTTCCTGAGG - Intergenic
944526188 2:200622453-200622475 TTTGAAACAGTCCCTTCCTCTGG + Intronic
948051382 2:234981982-234982004 TTCCCAAAAAGCCCAGCCTCAGG - Intronic
948509569 2:238454672-238454694 TTTCCACAAGGCCCTGCCCTCGG - Intergenic
948779823 2:240312052-240312074 TTTCCAAATGTCCCTTTCTCTGG - Intergenic
1169340061 20:4789890-4789912 GCTCAAAAAGACCCTTCCTCTGG + Intronic
1169456533 20:5757428-5757450 TTTCAAAAATGCCCTTTATCAGG + Intronic
1175354550 20:58353880-58353902 TTTTCAAAAAGCCCTTGCTTTGG - Intronic
1175588391 20:60166347-60166369 TTTCCAAAAAGACGTTTCTCTGG + Intergenic
1175608698 20:60332319-60332341 GTTCCCAAAAGCCCTTCCTTGGG + Intergenic
1178891709 21:36525575-36525597 TTTCCAAAAGTTCCTTTGTCTGG - Intronic
1179730086 21:43362795-43362817 TTTCCAAAAGACTTTTCCTTTGG - Intergenic
1181026660 22:20131247-20131269 TTCCCAAAGGGCCCCGCCTCGGG + Intronic
1183672858 22:39283322-39283344 GTTCCATATGCCCCTTCCTCGGG - Intergenic
1184092970 22:42301987-42302009 CCTCCAAGAGGCCTTTCCTCTGG - Intronic
1184623716 22:45704898-45704920 TTTCTAAGAAGCCCTTGCTCAGG + Intronic
1185160042 22:49218954-49218976 TCTCAAAAAGGCCTGTCCTCAGG + Intergenic
949411637 3:3771923-3771945 TTTCTAAAAAGCCTTTCTTCTGG - Intronic
949510412 3:4761989-4762011 ATTCCAGAAGGCCCTCCCTGAGG + Intronic
949517345 3:4819687-4819709 ATCCCAGAAGTCCCTTCCTCCGG - Intronic
950190840 3:10975083-10975105 TTTACAACAGGGCCTTCCTCTGG + Intergenic
951895882 3:27609393-27609415 TTTCCATTAGGCCCTTTGTCAGG + Intergenic
952744746 3:36765833-36765855 TTTCCAATAGGTTCTTCCTTCGG - Intergenic
952773866 3:37026002-37026024 TTCCCAAAAGGCCATACCTGGGG - Exonic
953171220 3:40509596-40509618 TTTCCAAATGATCCTTTCTCTGG + Intronic
953523738 3:43669228-43669250 TTTTAATAAGGCCTTTCCTCAGG - Intronic
956177701 3:66488915-66488937 TTCCCAAAGGGTCCTTTCTCAGG - Intronic
958587201 3:96103788-96103810 TTTCCTAAATGCCCTTCTGCTGG + Intergenic
959347074 3:105209772-105209794 TTTCCTAATGGGCCTTCTTCAGG + Intergenic
960520822 3:118653303-118653325 TGTCAACAAGGCCCTTCCTTCGG + Intergenic
962301180 3:134244500-134244522 TGTCCAAAAGGCCCTGAATCAGG + Intronic
962679077 3:137780306-137780328 TTTCCAAGAGGTCCTGGCTCTGG - Intergenic
962690440 3:137891715-137891737 TTTACAAAGAGCCCTTCCTGAGG + Intergenic
964600423 3:158494894-158494916 CCTCCAAAAGGCCCTGCCTGAGG + Intronic
966709337 3:182954770-182954792 TTACCAAAAGGCACTTACTGAGG + Intronic
968188331 3:196649186-196649208 TTTCCAACAGTCCCTTCTCCAGG - Intronic
969042629 4:4312554-4312576 TTTCCAAAAAGTACTTCCTCTGG - Intronic
970815715 4:20154035-20154057 TTACTAAATTGCCCTTCCTCAGG + Intergenic
973702447 4:53550723-53550745 TTTTAAAAAGGCACTTCCCCAGG + Intronic
974250903 4:59381617-59381639 TTTCTAAGAGGAACTTCCTCAGG - Intergenic
976305532 4:83555683-83555705 GTTCCCATAGTCCCTTCCTCAGG - Intronic
977155231 4:93564147-93564169 TTTTTAAAAAGCCCTTTCTCTGG - Intronic
978591332 4:110327951-110327973 TTTAAAAATGGTCCTTCCTCGGG - Intergenic
980219640 4:129899314-129899336 ATTCAAAAAGGCCCATCCACTGG + Intergenic
982033512 4:151324662-151324684 ATTCCAAAAGGCCATTCATTTGG - Intronic
984888104 4:184468841-184468863 TTTCTAAAAGTCCCCTCCCCAGG + Intronic
984968623 4:185165911-185165933 TTTCTAAGTGGCCCTTCCCCTGG - Intronic
986216209 5:5721480-5721502 CCTCCAAAAGGCCATTCCTGAGG - Intergenic
987918948 5:24253451-24253473 TTTCCTAAATGGCCTTACTCAGG - Intergenic
989385688 5:40852898-40852920 TTTCCAAAAGCCTGTTGCTCTGG + Exonic
993766417 5:91864098-91864120 TTTCCACAGGGCCCTTCCACTGG + Intergenic
993776146 5:91999342-91999364 TCCCCAAATGGCCTTTCCTCTGG - Intergenic
995203430 5:109451625-109451647 TTTCCAAATGGCCTATCTTCAGG - Intergenic
997167880 5:131681135-131681157 TTTGGAAAAGGTCATTCCTCGGG - Intronic
997525598 5:134551075-134551097 TTTGCATAAGGCCTTTCCTGGGG + Intronic
998216861 5:140244141-140244163 TTACCAAAAGGCCCTTTCCTAGG - Intronic
999399319 5:151252690-151252712 TTTCCCAAAGGTCCTTCCAAAGG + Intronic
1000711275 5:164582095-164582117 TTTCCAGATGGCCCTTCATTTGG + Intergenic
1001094979 5:168769034-168769056 TCTCAAAGAGGCCCTTCATCAGG - Intronic
1001893905 5:175362507-175362529 TTTCCATGCAGCCCTTCCTCAGG - Intergenic
1002426386 5:179178831-179178853 TTTCCAAAAGCTTCTTCCTTGGG - Intronic
1005093105 6:22080055-22080077 TTTACAAAAGGCCATTCATCAGG - Intergenic
1005507035 6:26478297-26478319 TTCCCCAAAGGCTCTTTCTCTGG + Intergenic
1009036017 6:58117827-58117849 TTTACAAAAGGTGCTGCCTCTGG + Intergenic
1009211835 6:60871428-60871450 TTTACAAAAGGTGCTGCCTCTGG + Intergenic
1012960496 6:105616757-105616779 TTTCCAACTCTCCCTTCCTCTGG + Intergenic
1014738342 6:125121065-125121087 TCTCCAAAATTCCCGTCCTCTGG - Intronic
1014814393 6:125919408-125919430 TTCACAAAAGGCTCTTCGTCAGG - Intronic
1015974746 6:138778526-138778548 GTTCCAAAAAGGCCTTCCTGAGG + Intronic
1016496462 6:144668240-144668262 GGTGCAAAAGGCCCTTCCTTGGG + Intronic
1018469775 6:164085185-164085207 TTTCTCAAAGGCCCCTCCGCTGG + Intergenic
1019979889 7:4613745-4613767 TTTGCCAAAGGACCTTACTCTGG + Intergenic
1020129145 7:5549669-5549691 AGCCCAAAAGACCCTTCCTCAGG - Intronic
1021695211 7:23269690-23269712 TTTCCATCAGCCCCTTCCCCTGG + Intronic
1022449822 7:30504506-30504528 TGCCCAGAAGGCGCTTCCTCGGG - Intronic
1023117050 7:36872700-36872722 TATCCAAATGTCCCTTCCTACGG - Intronic
1024557133 7:50613452-50613474 TCACCAAAGGGCCCTGCCTCTGG - Intronic
1029881417 7:103814950-103814972 TTTGCAACTGTCCCTTCCTCTGG - Intronic
1032662161 7:133996572-133996594 TTTCCAAAAAGACCTTCTTAGGG + Intronic
1032928389 7:136636717-136636739 TTTTCAAATGGCCTTTCCACAGG + Intergenic
1038483341 8:27916893-27916915 CTTCTCAAAGGCCCTGCCTCCGG - Intronic
1038682063 8:29677981-29678003 TTTCCAAAAGACCTTGGCTCAGG - Intergenic
1039774865 8:40725350-40725372 TTTCCTGAGGGGCCTTCCTCAGG + Intronic
1041691927 8:60695937-60695959 TTTACAAATGGCCATTCCTGTGG + Intronic
1044288632 8:90440946-90440968 TTTTCAAAAGGCCACTCCTTGGG + Intergenic
1045878464 8:107010440-107010462 TTTCCAAAAGGCCCAATCTCTGG - Intergenic
1048044372 8:130759393-130759415 TTTCCCAGAGCCCCTTCCCCAGG + Intergenic
1049211474 8:141388454-141388476 TCTGCAGAAGGACCTTCCTCAGG - Intergenic
1049472118 8:142781113-142781135 TTTGCAAGAGGTCCTTTCTCTGG - Intergenic
1050084730 9:1952519-1952541 TTTCCTAATTGCCCTGCCTCTGG + Intergenic
1051681097 9:19609037-19609059 TTCCCTGAAGGCCCTTCCTCAGG + Intronic
1051796942 9:20882311-20882333 CTTCCAACAGGCCATGCCTCTGG - Intronic
1052161360 9:25263998-25264020 TTTCCCAGAGACCCTTCCTCAGG + Intergenic
1053483352 9:38432882-38432904 TTTCCAAAAGGCTCATCCTGTGG - Intergenic
1058046572 9:100363853-100363875 TTTCCAAAAGACCCAATCTCTGG - Intergenic
1059567055 9:115393464-115393486 TTTCCAGAAGGTCAGTCCTCAGG + Intronic
1060506554 9:124202312-124202334 TTTCCAAAACGCCCAGCCTGGGG - Intergenic
1060557221 9:124514210-124514232 CTTCCAGGAGGCACTTCCTCAGG - Intergenic
1061201323 9:129140101-129140123 TTTACAAAAGGCCGATTCTCTGG + Intronic
1061662194 9:132137617-132137639 TTTCTAATAGGCGCCTCCTCGGG + Intergenic
1061691809 9:132339181-132339203 TTTCTATAAAACCCTTCCTCAGG + Intronic
1062416458 9:136453480-136453502 TTTCCAACAGGCGCCTCCTGCGG + Exonic
1185509367 X:651622-651644 TTTCCAATAAGCCTGTCCTCAGG - Intronic
1187622891 X:21078305-21078327 TTAACAAAAGTCCCTTCCTCTGG - Intergenic
1187740454 X:22349915-22349937 CTACCAAATGGCCTTTCCTCTGG - Intergenic
1189351143 X:40276729-40276751 TTTCCCAAAGGCCCATCCTCTGG - Intergenic
1190415645 X:50178039-50178061 TTTCTGAAAGGCACTGCCTCTGG - Intergenic
1192585437 X:72315018-72315040 TTACAAAAAGGCACCTCCTCTGG + Intergenic
1193089641 X:77480653-77480675 TTTCCTAAAGGACCTGCCTGTGG + Intergenic
1197618793 X:128723147-128723169 TTTATAAAAGGCCATTCCTGTGG - Intergenic
1198004373 X:132477468-132477490 TTCCCAAAAGTCTCTTCCTGTGG - Intronic
1198231236 X:134691637-134691659 TTTCCAGAAGGGCCGTCCTAAGG - Intronic