ID: 1167569514

View in Genome Browser
Species Human (GRCh38)
Location 19:50278121-50278143
Sequence GGCCGAGGTGTCCGAGCTGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 183}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167569499_1167569514 25 Left 1167569499 19:50278073-50278095 CCCACACCAGGGCAAAGGTGCAT 0: 1
1: 0
2: 1
3: 8
4: 132
Right 1167569514 19:50278121-50278143 GGCCGAGGTGTCCGAGCTGCGGG 0: 1
1: 0
2: 1
3: 22
4: 183
1167569503_1167569514 19 Left 1167569503 19:50278079-50278101 CCAGGGCAAAGGTGCATGGGAGA 0: 1
1: 0
2: 0
3: 30
4: 247
Right 1167569514 19:50278121-50278143 GGCCGAGGTGTCCGAGCTGCGGG 0: 1
1: 0
2: 1
3: 22
4: 183
1167569500_1167569514 24 Left 1167569500 19:50278074-50278096 CCACACCAGGGCAAAGGTGCATG 0: 1
1: 0
2: 0
3: 11
4: 158
Right 1167569514 19:50278121-50278143 GGCCGAGGTGTCCGAGCTGCGGG 0: 1
1: 0
2: 1
3: 22
4: 183
1167569509_1167569514 -8 Left 1167569509 19:50278106-50278128 CCGGCTGGCCCTGGAGGCCGAGG 0: 1
1: 0
2: 5
3: 82
4: 601
Right 1167569514 19:50278121-50278143 GGCCGAGGTGTCCGAGCTGCGGG 0: 1
1: 0
2: 1
3: 22
4: 183
1167569498_1167569514 29 Left 1167569498 19:50278069-50278091 CCTTCCCACACCAGGGCAAAGGT 0: 1
1: 0
2: 2
3: 28
4: 192
Right 1167569514 19:50278121-50278143 GGCCGAGGTGTCCGAGCTGCGGG 0: 1
1: 0
2: 1
3: 22
4: 183
1167569508_1167569514 -7 Left 1167569508 19:50278105-50278127 CCCGGCTGGCCCTGGAGGCCGAG 0: 1
1: 0
2: 4
3: 77
4: 520
Right 1167569514 19:50278121-50278143 GGCCGAGGTGTCCGAGCTGCGGG 0: 1
1: 0
2: 1
3: 22
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167569514 Original CRISPR GGCCGAGGTGTCCGAGCTGC GGG Exonic