ID: 1167572574

View in Genome Browser
Species Human (GRCh38)
Location 19:50298280-50298302
Sequence CAGGTGAAAGAGGGGGCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 931
Summary {0: 1, 1: 0, 2: 13, 3: 83, 4: 834}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167572565_1167572574 15 Left 1167572565 19:50298242-50298264 CCTGTGATCCACAGTCAGGTTAG 0: 1
1: 0
2: 0
3: 13
4: 94
Right 1167572574 19:50298280-50298302 CAGGTGAAAGAGGGGGCAGGAGG 0: 1
1: 0
2: 13
3: 83
4: 834
1167572566_1167572574 7 Left 1167572566 19:50298250-50298272 CCACAGTCAGGTTAGAGTTTCTG 0: 1
1: 0
2: 1
3: 4
4: 127
Right 1167572574 19:50298280-50298302 CAGGTGAAAGAGGGGGCAGGAGG 0: 1
1: 0
2: 13
3: 83
4: 834

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167572574 Original CRISPR CAGGTGAAAGAGGGGGCAGG AGG Intronic
900145428 1:1157106-1157128 TAGCTGGAAGAGGGTGCAGGAGG + Intergenic
900432690 1:2610545-2610567 CTGATGAGTGAGGGGGCAGGGGG - Intronic
900519835 1:3100202-3100224 CACGTCACAGAGCGGGCAGGGGG - Intronic
900566321 1:3333849-3333871 CATGTGATAGAGTGGGCAAGAGG - Intronic
900769403 1:4528789-4528811 CAGGTGACAGAGGAGGCAGCAGG - Intergenic
901165236 1:7216143-7216165 CAGGAGGAAGAGGGTGAAGGGGG + Intronic
901644622 1:10709836-10709858 CAGGACAATGAGGGGGCCGGCGG + Intronic
901740321 1:11338024-11338046 GAGGTGAAAGAGGGGGAGGAGGG - Intergenic
901759038 1:11458899-11458921 CAGGCCCAGGAGGGGGCAGGAGG - Intergenic
902756063 1:18550051-18550073 CAGGAGCAAGAGAGGGGAGGAGG - Intergenic
903234550 1:21941329-21941351 GAGGAGGAAGAGGAGGCAGGAGG + Intergenic
903498637 1:23789646-23789668 CAGGTGATCGAGGTTGCAGGAGG + Intergenic
904009619 1:27382400-27382422 CTGGTGAGAGAAGGTGCAGGGGG + Intronic
904373867 1:30067175-30067197 AAGGAGGAAGAGAGGGCAGGTGG - Intergenic
905662831 1:39740584-39740606 CAGCTGCAAGAAGGTGCAGGTGG - Intronic
905861457 1:41354762-41354784 CACATGACAGAAGGGGCAGGGGG + Intergenic
906223215 1:44099550-44099572 CAGGTGAATCAGGAGTCAGGAGG + Intergenic
906226953 1:44130194-44130216 CAGGTGAAGGAGGTGTCAGGTGG + Exonic
906258448 1:44368123-44368145 CAGAAGAAAGAGAGGGCAGCTGG + Intergenic
907643255 1:56214081-56214103 CATGTGAAAGAGGGGCAAAGGGG - Intergenic
907811510 1:57875267-57875289 CAGGTGAGAGGGGAGACAGGAGG - Intronic
907857622 1:58319124-58319146 GGGGAGAAAGAGGGGGCTGGGGG + Intronic
909533972 1:76712978-76713000 AGGGTGAAAGAGGAGCCAGGAGG + Intergenic
909735633 1:78957684-78957706 AAAGTGCAAGAGGAGGCAGGAGG + Intronic
910243668 1:85115699-85115721 CAGGGGGAGGTGGGGGCAGGGGG + Intronic
910938241 1:92504761-92504783 CAGGAGAAAGCAGGGTCAGGTGG - Intergenic
911085474 1:93973934-93973956 CAGGAGAAAGCGGGGGGAGGGGG + Intergenic
911549580 1:99263351-99263373 CAGAAGAAAGTGGGGGCAAGAGG + Intergenic
912273393 1:108232034-108232056 CAGGTGACAGAGGAGGCACTTGG + Intronic
912294827 1:108462288-108462310 CAGGTGACAGAGGAGGCACTTGG - Intronic
913490357 1:119374149-119374171 CATGGGGAAGAGAGGGCAGGGGG - Intronic
914000214 1:143687821-143687843 GAGGTGGAAAAGGGGGCAGGTGG - Intergenic
914347881 1:146815409-146815431 CAGGTGAGAGAAGCTGCAGGTGG - Intergenic
914788489 1:150854881-150854903 AAGGGGAAAGAGAGGGAAGGAGG + Intronic
914790813 1:150876326-150876348 CAAGGGAGCGAGGGGGCAGGTGG - Intronic
914889119 1:151607250-151607272 CCAGTGAAAGAGGAGCCAGGGGG - Intergenic
914899968 1:151706618-151706640 CAGGTGGGAGAGGTGGCAGGAGG - Intronic
914916095 1:151820126-151820148 CAGGGGAAGGAGGGGGGAGCAGG - Intronic
915069605 1:153255210-153255232 CAGGTTAAAGGGGCAGCAGGTGG - Intergenic
915631063 1:157154605-157154627 GAGGTGAAGGAGGAGACAGGTGG - Intergenic
915631124 1:157154855-157154877 GAGGTGAGGGAGGGGGCTGGGGG - Intergenic
915820730 1:159021245-159021267 CAGGGGAAAGAGTGGGAGGGGGG - Intronic
917205237 1:172564464-172564486 CAGGAGAAAGAGAGTGAAGGGGG - Intronic
917772280 1:178292633-178292655 CAGTTCAAAGAGGGCACAGGAGG + Intronic
918485994 1:185028583-185028605 CAGGAGGAAGAGAGAGCAGGGGG + Intergenic
919838766 1:201594333-201594355 CAGGAGAAAGGGAGGGGAGGAGG + Intergenic
921568146 1:216745591-216745613 AAGGGAAAGGAGGGGGCAGGGGG - Intronic
921707978 1:218345812-218345834 CAGGAGAAGGAGGGAGCTGGAGG + Intergenic
921931171 1:220755456-220755478 CAGGAGGCAGAGGGAGCAGGGGG + Intronic
921991550 1:221372638-221372660 CAGGTGAAAGGGAGGCCAGAAGG + Intergenic
922717575 1:227885292-227885314 CAGGTGCAGCAGAGGGCAGGCGG + Intergenic
922765782 1:228155956-228155978 CAAGGGAGAGATGGGGCAGGAGG - Intronic
923482422 1:234397406-234397428 GAGGGGGAAGAGGGGGGAGGAGG + Intronic
923482432 1:234397425-234397447 GAGGGGGAAGAGGGGGGAGGAGG + Intronic
923621286 1:235581548-235581570 CAGGAGAAAGAGAGAGAAGGGGG - Intronic
923724641 1:236495552-236495574 CAGGTGGAGGAGGGTGGAGGTGG - Intergenic
924016674 1:239733311-239733333 TAGTTGAAAGAGGGGGAAGAAGG + Intronic
924113174 1:240720296-240720318 TAGGGGAAAGAGTGAGCAGGGGG - Intergenic
924369890 1:243336552-243336574 CAGGAGGAAGAGAGAGCAGGGGG + Intronic
1062786854 10:271934-271956 CAGGGGAGGGAGGGTGCAGGAGG - Intergenic
1062992919 10:1836808-1836830 CAGGTGGGAGAGGGGGCGGCAGG - Intergenic
1063300026 10:4842861-4842883 CAGGAGAAAGGGGAGGCAGTTGG + Intronic
1064478717 10:15719402-15719424 CAGGGGAGAGAAGGGGCTGGTGG + Intronic
1065016006 10:21463408-21463430 CAGGTGAAAAATGGGGTGGGAGG + Intergenic
1065355828 10:24840594-24840616 CAGGAGAAAGAGAGAGAAGGGGG - Intergenic
1065787167 10:29227367-29227389 CAAGAGAAAGATGGGGCAGAGGG + Intergenic
1065804699 10:29383681-29383703 AAGGGGAAAGAGCGGGCAGGAGG + Intergenic
1065824686 10:29559664-29559686 CAGGTAAAATAAGGGACAGGTGG - Intronic
1065939771 10:30553775-30553797 AAGGGGGAAGAGTGGGCAGGAGG - Intergenic
1066065113 10:31756240-31756262 CAGGTGTGGGAGGGAGCAGGAGG + Intergenic
1066305876 10:34140415-34140437 CAGGTGATACAGGTGACAGGAGG - Intronic
1067031755 10:42882791-42882813 CAGCTGAGTGAGGAGGCAGGAGG + Intergenic
1067091561 10:43268152-43268174 CAGGTGTAAGATGGGGCACTGGG + Intergenic
1067546015 10:47193172-47193194 CAGGGGAAACAGAGGGCAGGAGG + Intergenic
1067840953 10:49679199-49679221 CTGGTGACAGAAGGGGCCGGGGG + Intergenic
1068627383 10:59263976-59263998 AAGGTGCAAGAGGGCACAGGTGG + Intronic
1069560914 10:69428799-69428821 GAGGTGAAAGCAGGGGCAGATGG + Intergenic
1069573544 10:69508585-69508607 CATGTGTAAGAAGGGGCAGGAGG + Intergenic
1069926115 10:71851780-71851802 CAGGGGCACGTGGGGGCAGGTGG + Intergenic
1069931536 10:71885436-71885458 AAGGAGAAAGAGCAGGCAGGAGG - Intergenic
1069957448 10:72060702-72060724 CAGGAGAAAGAGGGGACTGGGGG + Exonic
1070387657 10:75940342-75940364 CAGATGCATGAGGGGACAGGTGG - Intronic
1070773862 10:79098768-79098790 CAGGTGGAGGAGGTGGCATGCGG + Intronic
1070789382 10:79180466-79180488 CATGGGACAGAGGAGGCAGGTGG - Intronic
1070959482 10:80488543-80488565 CAGGGGAGGGAGGGAGCAGGGGG + Intronic
1070974823 10:80597970-80597992 AGGATGAAAGAGGAGGCAGGTGG + Intronic
1070996514 10:80788369-80788391 CAGGACTAAGTGGGGGCAGGAGG + Intergenic
1072430922 10:95369860-95369882 CAGGTGATGGGTGGGGCAGGTGG - Intronic
1072618135 10:97063211-97063233 GAGGTGATGGATGGGGCAGGAGG + Intronic
1072618144 10:97063252-97063274 GAGGTGATGGATGGGGCAGGAGG + Intronic
1072621362 10:97081557-97081579 CAGAAGAAAGAAGGGGCTGGAGG + Intronic
1073146703 10:101285976-101285998 CAAGGGAAAGAGGAGGCAGAGGG - Intergenic
1073578740 10:104644963-104644985 CAGGTGGTTGAGGGTGCAGGAGG + Intronic
1073597694 10:104817344-104817366 AGGGTGGAAGAGGGGGGAGGAGG - Intronic
1074435149 10:113427441-113427463 GAGGTGACAGAGAGGGAAGGAGG - Intergenic
1074554419 10:114475152-114475174 CAGGTGAGAGACGAGGTAGGAGG - Intronic
1074842116 10:117364903-117364925 GGAGTGAAAGTGGGGGCAGGAGG + Intronic
1075016426 10:118913003-118913025 AAGATCAAAGAGGGGGCAGGAGG + Intergenic
1075346002 10:121682210-121682232 CAGGGGAAAGGGGGAGCTGGGGG + Intergenic
1075389606 10:122083176-122083198 CAAGAGAAAGAGGCTGCAGGTGG + Exonic
1075596846 10:123738081-123738103 CAGGAGAAAGAGAGGGCAGGGGG - Intronic
1075697423 10:124447398-124447420 CCCGCGAAAGAGGGGCCAGGGGG + Exonic
1075742249 10:124702943-124702965 GAGGTGAGAGAGGGAGCAAGAGG - Intronic
1075760083 10:124849050-124849072 CAGCTGTAAGAGGAGGCAGGAGG - Intergenic
1075801905 10:125159583-125159605 CAAGTGAAAGACGGGAAAGGAGG - Intronic
1076358269 10:129868632-129868654 CAGCAGAAGGAGGGTGCAGGGGG + Intronic
1076382197 10:130031664-130031686 CAGGAGAAAGAGAGAGAAGGGGG + Intergenic
1076584580 10:131536784-131536806 CAGGTGAAAGGAGGGGGTGGAGG + Intergenic
1076771324 10:132666981-132667003 CAGGTGGCAGAGGGGGTTGGGGG - Intronic
1076790678 10:132775196-132775218 CAGGGAGGAGAGGGGGCAGGGGG + Intronic
1076930947 10:133531458-133531480 GAAGTGACAGAGGGGGCAGAGGG - Intronic
1077015952 11:399312-399334 CAGGTGGCAGAGGGGGCAGGTGG - Intronic
1077015988 11:399400-399422 CAGGTGGAGGAGGGGGCAGGTGG - Intronic
1077016034 11:399513-399535 CAGGTGGAGGGGGGGACAGGTGG - Intronic
1077221983 11:1421943-1421965 CCCGGGAGAGAGGGGGCAGGTGG + Intronic
1077319870 11:1936376-1936398 GAGGGGAGAGCGGGGGCAGGAGG - Intronic
1077479409 11:2806638-2806660 CAGGTGGAAGATGGAGCTGGGGG - Intronic
1077531316 11:3096963-3096985 AAGAGGAAAGAGGGGGAAGGTGG + Intronic
1077922114 11:6649429-6649451 CAGGTGAGCATGGGGGCAGGTGG + Intronic
1077975795 11:7247247-7247269 CAGGGGAAAGGGTGGGAAGGGGG - Intronic
1078066824 11:8084034-8084056 CAGATGGGAGTGGGGGCAGGGGG + Intronic
1078393530 11:10957059-10957081 CAGGAGAGAGAGAGGGAAGGGGG - Intergenic
1078481658 11:11681609-11681631 CAGGTGAAAGAGAGAGAAGAAGG + Intergenic
1078619078 11:12891342-12891364 CAGGTGAGAGCAGGGGCTGGAGG + Intronic
1078697025 11:13644585-13644607 CAGGAGGAAGAGGGGAAAGGGGG + Intergenic
1078724490 11:13917462-13917484 AAGGGGAAAGAGTGGGCAGTAGG + Intergenic
1079326127 11:19494168-19494190 CAGCTGAAAGAAGTGGCAAGAGG + Intronic
1079450515 11:20597069-20597091 CGGCTGAAAGTGGGGGCAGGCGG + Intergenic
1079632157 11:22691104-22691126 CAGATGAAGGAGGGGGCGGGGGG + Intronic
1080722056 11:34859451-34859473 CAGGTCAAAGATGGCTCAGGAGG + Intronic
1080826619 11:35853989-35854011 CAGGAGACAGAGGGGACAAGGGG - Intergenic
1080855655 11:36109356-36109378 CACGTGAAGGTGGGGGCAGTGGG + Intronic
1080946551 11:36980750-36980772 CAGGAGAAAGAGAAGGGAGGAGG + Intergenic
1081160713 11:39744482-39744504 CAGGAGAGAGAGAGAGCAGGGGG - Intergenic
1081296553 11:41397250-41397272 GAGGTGGAAGAGGAGGCAGGAGG - Intronic
1081611493 11:44565734-44565756 CAGGTGAGCAAGGGGGCAGCGGG + Exonic
1081846765 11:46246364-46246386 CAGGGGAAAGGGTGGGAAGGGGG - Intergenic
1081851032 11:46275459-46275481 CTGGGGAAAGGGGTGGCAGGGGG - Intergenic
1082005542 11:47417045-47417067 AAGGTGGAATGGGGGGCAGGTGG - Intergenic
1082089476 11:48077617-48077639 AGGGTGAATGAGTGGGCAGGTGG - Intronic
1082767301 11:57180072-57180094 TGGGTGAAAGAAGGGGCAGGGGG + Intergenic
1082942022 11:58716144-58716166 GGGGTGAAAGAGAGGGTAGGAGG + Intronic
1083101089 11:60306909-60306931 AGGGTAAAAGAGTGGGCAGGTGG - Intronic
1083155149 11:60818278-60818300 CAGGTGATAGAGTTGGCAGAAGG - Intergenic
1083278538 11:61611274-61611296 GAAGGGGAAGAGGGGGCAGGTGG + Intergenic
1083697654 11:64453463-64453485 CAGGTAAAGGAGGGGGCAGGAGG + Intergenic
1083729506 11:64645139-64645161 AACGTGATAGAGAGGGCAGGAGG - Intronic
1083966418 11:66046589-66046611 CAGGAGTAAGAGAGGGGAGGAGG + Intronic
1084214805 11:67641495-67641517 AAGATGGATGAGGGGGCAGGGGG - Intergenic
1084686519 11:70699025-70699047 CAGCTCACAGAGGAGGCAGGAGG + Intronic
1084763663 11:71293569-71293591 CAGGAGGAAGTGGGGGGAGGAGG + Intergenic
1084911243 11:72391237-72391259 CAGTTGAAGGAGGGGACAGCAGG - Intronic
1085034617 11:73292606-73292628 CAGGGGAAAGAGGGGGATGGGGG - Intronic
1085311011 11:75516618-75516640 CCAGTGAAGGAAGGGGCAGGAGG + Intronic
1085865282 11:80283403-80283425 CAGTGGGAAGAGGGAGCAGGAGG - Intergenic
1086561555 11:88175163-88175185 CAGGTGAGCGCGGGGGGAGGGGG - Exonic
1086589416 11:88494566-88494588 CAGGAGAAAGAGAGAGAAGGGGG - Intergenic
1086876611 11:92104087-92104109 TAGGAGAAAGAGGTGGCAAGAGG + Intergenic
1086936907 11:92755047-92755069 GAGGTGATAGAGGAGACAGGAGG + Intronic
1087140269 11:94758288-94758310 CAGATCAAAGTGGTGGCAGGAGG + Intronic
1087466191 11:98509711-98509733 CAGGGGAAAGAGTGGGAAGGAGG - Intergenic
1088172595 11:107016262-107016284 CAGGTGAAAGTGCTGTCAGGAGG + Intronic
1088645104 11:111911647-111911669 CTGGTCAAAGAGGCGGCTGGGGG + Exonic
1088946610 11:114519633-114519655 CAGGTGGAAGGAGGGGCAGGAGG + Intergenic
1088968266 11:114747611-114747633 CAGGAGAGAGAGAGGGCAAGGGG + Intergenic
1089126922 11:116183007-116183029 CAGGTGAAGGAGGGGGAGAGAGG - Intergenic
1089176439 11:116552180-116552202 CAGGGTGAAGAGGGTGCAGGTGG - Intergenic
1089390689 11:118099672-118099694 GATGGGAAGGAGGGGGCAGGGGG - Intronic
1089457884 11:118635840-118635862 AAGGTGAAAGATGGAGGAGGAGG + Intronic
1089796990 11:120988922-120988944 AAGGAGACAGAGAGGGCAGGTGG - Intergenic
1089839265 11:121400164-121400186 CAGGGGCAAGAGGTGGGAGGGGG + Intergenic
1090687058 11:129133132-129133154 CAGGGGGAAGAGTGAGCAGGAGG + Intronic
1090725713 11:129525645-129525667 GAGGGGAAAGAGGAGGCTGGGGG + Intergenic
1090805650 11:130200442-130200464 CAGGAGCAAGAGAGAGCAGGAGG + Intronic
1090941610 11:131392607-131392629 CAGGTTGAAGAGAGGGCAGGAGG + Intronic
1091752764 12:3032966-3032988 CAGCTGATGGAGGGGGAAGGCGG - Intronic
1091957169 12:4655767-4655789 CAGGGGAAAGAGGGTAGAGGAGG + Intronic
1093016548 12:14161155-14161177 CAGGAGAGGGAGGGGGGAGGAGG + Intergenic
1093709884 12:22318549-22318571 CAGGGAAAAGAGGGGGAAGGAGG - Intronic
1093718882 12:22414787-22414809 CAGGAGGAAGAGAGGGAAGGGGG + Intronic
1094464944 12:30743123-30743145 CAGGTAGAAGCGGGGGCGGGGGG - Intronic
1094808913 12:34118841-34118863 CAGGTGCAAGATGGGTCATGGGG - Intergenic
1095177178 12:39106343-39106365 CAGTTGGAAGAGGGGCCTGGTGG - Intergenic
1095681160 12:44977655-44977677 AAGGAGAAAGAGGGTGCAAGAGG - Intergenic
1095752772 12:45729609-45729631 GAGGGGAAGGAGGGAGCAGGAGG - Intergenic
1095818075 12:46446712-46446734 GAGGTGAAAGGAGGGGAAGGAGG + Intergenic
1095996625 12:48092173-48092195 CTGGTGAAGGAGGGGACAGCAGG + Intronic
1096584520 12:52611123-52611145 CAAGAGAAGGAGGGGGCAGGGGG + Intronic
1096762398 12:53852992-53853014 AAGGGGAAAGAGGTGGTAGGGGG - Intergenic
1096805967 12:54141298-54141320 CTGGGGAGAGAGGGGACAGGTGG - Intergenic
1097387045 12:58962466-58962488 AAGGTGAAAGTGAGGGAAGGAGG + Intergenic
1098061694 12:66569731-66569753 CAGGATAGAGAGGGGGCTGGGGG + Intronic
1098287253 12:68920065-68920087 CAAGAGAAAGAGGGGGTGGGAGG - Intronic
1098719301 12:73875318-73875340 CTGGTGAAAGCAGGAGCAGGAGG - Intergenic
1100679107 12:96899478-96899500 CAGGTGGAGGAGGGTGCAGAGGG - Intergenic
1101023577 12:100578236-100578258 CTGAGGAAAGATGGGGCAGGTGG + Intronic
1101048764 12:100838722-100838744 CATGGGAAAAATGGGGCAGGTGG + Intronic
1101427908 12:104602932-104602954 CAGGTGAGAGATTGGGAAGGGGG - Intronic
1101446075 12:104737819-104737841 GAGGTGAAAGATGAGCCAGGCGG + Intronic
1102119594 12:110429818-110429840 CAGGTGGAAGATGGGGGTGGCGG + Intergenic
1102383163 12:112484493-112484515 CAGGGGCAGGAGGAGGCAGGTGG + Intronic
1102733018 12:115131155-115131177 CAGGGGAAAGGGTGGGAAGGAGG - Intergenic
1102784508 12:115593377-115593399 CAGGGGAAAGGGTGGGAAGGTGG - Intergenic
1103344476 12:120240265-120240287 CAGGTGACAGATGGGGGATGAGG + Intronic
1103348086 12:120264758-120264780 CAGGGGAATGAGGTGGAAGGTGG - Intronic
1103896614 12:124277667-124277689 GAGGAGAAAGAGGAGGAAGGGGG - Intronic
1104292941 12:127485793-127485815 CAGGTGACTGAAGGAGCAGGGGG - Intergenic
1104356807 12:128094031-128094053 GAGGTGGGAGTGGGGGCAGGGGG + Intergenic
1104404932 12:128509286-128509308 AAGGGGAAAGAGCGGGCGGGAGG + Intronic
1104428790 12:128699593-128699615 CTGGTGACAGAAGGGGAAGGTGG - Intronic
1104536344 12:129621388-129621410 CATGTGGCAGTGGGGGCAGGGGG - Intronic
1104547765 12:129727585-129727607 CAGGTCAGAGAGAGGGCAAGAGG + Intronic
1104554525 12:129787745-129787767 CAGGGCAAAGAGTGGGCATGAGG + Intronic
1104581149 12:130011724-130011746 CAGGAGGAAGAGAGAGCAGGAGG + Intergenic
1104731740 12:131108963-131108985 CAGGTGGAAGTGGGGACAGAAGG + Intronic
1104781277 12:131422095-131422117 CAGGTGGAGGAGGAGGGAGGAGG - Intergenic
1104957995 12:132475262-132475284 CCGGGGAGAGAGGGGGCGGGGGG - Intergenic
1105255188 13:18739619-18739641 CAGCTGAAAGAGGAGGCCAGAGG - Intergenic
1105281411 13:18964865-18964887 GAGGAGAAAGTGGGGGGAGGGGG - Intergenic
1105765165 13:23552138-23552160 AAGGGGAAAGAGTGGGTAGGAGG + Intergenic
1106353812 13:28959622-28959644 ATGGTGAGAGAGGGAGCAGGAGG + Intronic
1106623809 13:31398005-31398027 CAGGAGCAAGGCGGGGCAGGGGG - Intergenic
1107251802 13:38372623-38372645 CAGGGGAAAGGGTGGGAAGGGGG + Intergenic
1107424619 13:40280867-40280889 CAGGTTAAGGAAGGTGCAGGGGG + Intergenic
1107490477 13:40876416-40876438 CAGGTGCTTGAGGGAGCAGGGGG + Intergenic
1108054806 13:46474902-46474924 GAGGTTAAGGAGGGGGCAGGAGG + Intergenic
1108056228 13:46488136-46488158 CAGGAGAAAGAGGGAGCAGGAGG + Intergenic
1108529113 13:51312365-51312387 CAAAGGAAAGAAGGGGCAGGAGG - Intergenic
1108981927 13:56524680-56524702 CAGGAGAAAGAGAGTGAAGGGGG + Intergenic
1110462345 13:75759080-75759102 CAGGTGAGAGAGAGCGAAGGGGG + Intronic
1110544768 13:76744129-76744151 CAGGGGAAAGGGTGGGAAGGGGG + Intergenic
1111215905 13:85140578-85140600 AAGGGGAAAGAGTAGGCAGGAGG + Intergenic
1111334477 13:86802391-86802413 GTGTTGAAAGAGGGGCCAGGTGG - Intergenic
1111918941 13:94390535-94390557 CAGGAGGAAGAGAGGGAAGGGGG + Intronic
1111957171 13:94771994-94772016 CAGGTGAAAGTGGGGGGTGGGGG - Intergenic
1112275463 13:98013862-98013884 CAGGTGACAGAGGAGACAGGAGG + Intronic
1112285932 13:98104475-98104497 CAGGAGGCAGAGGGAGCAGGGGG + Intergenic
1112682971 13:101788169-101788191 AAAGTGGAGGAGGGGGCAGGGGG - Intronic
1112743096 13:102496680-102496702 CAGGAGAAAGAGTGTGAAGGGGG + Intergenic
1112855021 13:103757889-103757911 GAGGTGGAGGAGGAGGCAGGAGG - Intergenic
1113060309 13:106315204-106315226 CAGGAGAGAAAGGGGGCAGAGGG - Intergenic
1113076296 13:106470998-106471020 CTGGTCACAGAGGGGGCAGAGGG + Intergenic
1113673969 13:112195787-112195809 GAGGGGAAGGAGGGGGGAGGAGG - Intergenic
1113768136 13:112893764-112893786 CAGGAGAAAGCTGGGGCACGTGG - Intergenic
1114151368 14:20043477-20043499 CAAGTGAAAGAGGAGGCAAATGG - Intergenic
1114573907 14:23695319-23695341 CTGGAAAAAGAGGGGGGAGGGGG + Intergenic
1114587082 14:23825145-23825167 CAGGTGTAAGAGGAAGCAGGAGG + Intergenic
1114658951 14:24332771-24332793 CAGGTGAGAGGGGCGGCAGGCGG - Exonic
1114726329 14:24941545-24941567 CAGGGGGAGGAGGGAGCAGGAGG + Intronic
1114756889 14:25269616-25269638 CAGCCGACAGAGTGGGCAGGTGG - Intergenic
1115475576 14:33810154-33810176 CAGGTGAAAGAGGCAGGTGGAGG + Intergenic
1115692387 14:35858305-35858327 CAAATGAAAGATGGAGCAGGAGG - Intronic
1116442703 14:44972008-44972030 AAGGAGGAAGAGAGGGCAGGAGG + Intronic
1117670317 14:58099630-58099652 CAGAGAAAATAGGGGGCAGGTGG + Intronic
1117888268 14:60388557-60388579 CAGGAGCAAGAGAGGGCAGGAGG - Intergenic
1118832243 14:69445235-69445257 GAGGTGAAGGAGGTGGAAGGGGG - Intronic
1119042101 14:71284045-71284067 TAGTTGAAAGTGGGGGCTGGGGG + Intergenic
1119150623 14:72356308-72356330 CAGGAGAGAGAGAGAGCAGGGGG - Intronic
1119763915 14:77175998-77176020 CAGGGGTAAGAGAGGGCAGAGGG + Intronic
1120577987 14:86207768-86207790 CAGGAGAAAGAGAGCGAAGGGGG + Intergenic
1121106769 14:91285353-91285375 CAGGTGCAAGAGACGGGAGGGGG + Intronic
1121109520 14:91303198-91303220 GAGGTGAAGGAGGGTGGAGGTGG - Intronic
1121265071 14:92596450-92596472 CAGGTGAAAGAGCTTGCACGTGG - Intronic
1121431554 14:93891720-93891742 CAGGTGAAGGAGAGGAGAGGGGG - Intergenic
1121744046 14:96274109-96274131 CAGGGGAGGGAGCGGGCAGGTGG + Intergenic
1121894969 14:97638301-97638323 CAGGAGAAAGAGAGAGAAGGGGG - Intergenic
1122030460 14:98908096-98908118 CAAGGGAAGGAAGGGGCAGGTGG - Intergenic
1122217340 14:100212999-100213021 GGGGTGGCAGAGGGGGCAGGGGG + Intergenic
1123032272 14:105457512-105457534 GGGGTGGAAGAGGGGCCAGGAGG + Intronic
1123449636 15:20351699-20351721 CAGGGGAAAGAGAGAGCATGGGG + Intergenic
1123670540 15:22652272-22652294 CAGGTGAAAGAGGTGGGGAGGGG - Intergenic
1124373279 15:29115403-29115425 CAGGAGGAGGAGGGGCCAGGCGG + Intronic
1124526522 15:30458709-30458731 CAGGTGAAAGAGGTGGGGAGGGG - Intergenic
1124772132 15:32548974-32548996 CAGGTGAAAGAGGTGGGGAGGGG + Intergenic
1125214855 15:37259935-37259957 CAGAAGAAAGAGCAGGCAGGAGG - Intergenic
1125581282 15:40787766-40787788 GAGGTGAAACTGGAGGCAGGTGG - Intronic
1125919069 15:43514332-43514354 CAGCTGAAAGAGGAGCCAGCAGG - Intronic
1126167289 15:45664490-45664512 CAGAATAAAGAGGGGGCTGGGGG - Intronic
1126186757 15:45837954-45837976 CAGAAGAAAGTGGGGACAGGTGG + Intergenic
1126915070 15:53457289-53457311 CTGGGGGAACAGGGGGCAGGTGG - Intergenic
1127315166 15:57788204-57788226 CAGGAAATAGATGGGGCAGGTGG + Intergenic
1127884957 15:63190264-63190286 CAGGGGAATGAGCGGTCAGGAGG + Intronic
1128247642 15:66143926-66143948 GAGGGGACAGAGGGGGCAAGAGG + Intronic
1128389791 15:67175113-67175135 GAGGGGAAGGAGGAGGCAGGTGG + Intronic
1128740989 15:70083561-70083583 AAGGTGGGGGAGGGGGCAGGGGG - Intronic
1129197164 15:73975549-73975571 AAGGTGAAAGATGGGCCGGGCGG + Intergenic
1129227276 15:74177260-74177282 AAGAGGAAAGAGGGGACAGGTGG + Intergenic
1129362585 15:75033679-75033701 CAGGACACAGAGCGGGCAGGTGG - Intronic
1129450500 15:75648550-75648572 CAGGAGCAAGAGGAGGAAGGAGG + Exonic
1129674240 15:77623673-77623695 GAGGGGAAAGGGGAGGCAGGTGG - Intronic
1129832608 15:78680652-78680674 CAGGTGCAAGGGGAGGCTGGGGG - Intronic
1129922796 15:79334498-79334520 CAGGTGAAGGAAGGGTCGGGGGG + Intronic
1130038017 15:80379137-80379159 AAGGTGAGAGAGAAGGCAGGTGG - Exonic
1130337090 15:82965792-82965814 CAGATAAAAGAGGGGTCATGGGG + Intronic
1130626912 15:85524848-85524870 ATGGGGAAAGAGGGGGCAGGAGG - Intronic
1130694188 15:86113585-86113607 CAGGTGAAAGAGGTGAAAGGTGG - Intergenic
1130884842 15:88084243-88084265 CAGGGGAGTGAGGGGGCAGTGGG - Intronic
1131116169 15:89797376-89797398 CAGGTGAAAGAGCGAGCCGGAGG - Intronic
1131425776 15:92344387-92344409 CAGGTGCTAGAGGGGTGAGGAGG + Intergenic
1131770058 15:95727506-95727528 CAGGAGGAAGAGAGGGAAGGGGG + Intergenic
1132219337 15:100093612-100093634 CAGCTGATAGTGGGGGTAGGGGG - Intronic
1132225218 15:100135096-100135118 CAGGAGAAAGAGGAAGAAGGTGG + Intronic
1132373104 15:101311425-101311447 CAGGAGCAAGAGAGGGAAGGAGG - Intronic
1132405853 15:101541555-101541577 CAGGTGGAAGAGGGGACAGGAGG - Intergenic
1132626588 16:894354-894376 CAGGTGGACGGGGGGACAGGTGG - Intronic
1133105044 16:3501986-3502008 CAGGTGATACAGGCGGTAGGAGG + Intronic
1133196540 16:4174871-4174893 CAGAGGAGAGAGGGGGCTGGAGG + Intergenic
1133246227 16:4450620-4450642 CAGTTGAAAGAGGGGGGCTGTGG + Intronic
1133271434 16:4612653-4612675 CAGGTGCTAATGGGGGCAGGAGG - Intronic
1134566725 16:15258055-15258077 CGGGGGCAGGAGGGGGCAGGGGG - Intergenic
1134735768 16:16498644-16498666 CGGGGGCAGGAGGGGGCAGGGGG + Intergenic
1134839850 16:17393043-17393065 AAGGGGAAAAAGTGGGCAGGAGG - Intronic
1134846999 16:17448694-17448716 GAGGAGGAAGAGGGGGGAGGAGG + Intronic
1134931758 16:18213578-18213600 CGGGGGCAGGAGGGGGCAGGGGG - Intergenic
1135061804 16:19277410-19277432 AAGGGAAAAGAGGGGGCAGGAGG + Intergenic
1135164481 16:20126594-20126616 CAGTTGAGAGAGGAGACAGGAGG + Intergenic
1135675154 16:24408782-24408804 CAGGAGAAAGAGGAGAGAGGAGG + Intergenic
1135678909 16:24440371-24440393 CAGTAGCAAGAAGGGGCAGGTGG + Intergenic
1135874395 16:26184776-26184798 CAGGTGAATGAGGGGGTGGATGG - Intergenic
1135914017 16:26587410-26587432 CTTGTGACAGAGGGGGCAGTAGG + Intergenic
1137585818 16:49663707-49663729 CGGGAGACAGAGGGGACAGGAGG + Intronic
1137740686 16:50769803-50769825 GAGGTTAAGGATGGGGCAGGAGG - Intronic
1138036082 16:53608074-53608096 CAGGAGAAAGAGGTGGGAAGAGG - Intronic
1138150183 16:54649685-54649707 CAGAGGAAAAAGGGGGCAGATGG + Intergenic
1138526328 16:57609666-57609688 CTGAAGAAAGAGAGGGCAGGTGG - Intergenic
1138553108 16:57757815-57757837 CAGGGCAAAGAGTGGGCAGTGGG + Intergenic
1138749243 16:59398817-59398839 GTGGTGGAAGAGAGGGCAGGTGG - Intergenic
1139440045 16:66962032-66962054 CAGGAGGCAGAGGGAGCAGGGGG + Intronic
1139525910 16:67516391-67516413 CAGAGACAAGAGGGGGCAGGCGG + Intergenic
1139701553 16:68710961-68710983 GAGGGGAAGGAGGGGGGAGGGGG + Intronic
1139986154 16:70900123-70900145 CAGGTGAGAGAAGCTGCAGGTGG + Intronic
1140563370 16:76010556-76010578 AAGGGGAAAGAGGGGAGAGGAGG + Intergenic
1141515877 16:84544650-84544672 CATCTGACAGAGGAGGCAGGCGG + Intronic
1142156931 16:88536810-88536832 CAGGTGATAGCGGGGACGGGAGG + Exonic
1142188304 16:88705349-88705371 CAGGGGAGAGAGAGAGCAGGAGG - Intronic
1142223998 16:88868654-88868676 AAAGGGAAAGAGCGGGCAGGAGG + Intergenic
1142245014 16:88966406-88966428 CAGGTGGGAGAGGGGCCGGGAGG - Intronic
1142255075 16:89009820-89009842 CAAGGGAGAGAGGAGGCAGGTGG + Intergenic
1142894165 17:2963794-2963816 CAGGGGAGGGAGGGGGCCGGTGG - Intronic
1144009266 17:11130515-11130537 CAGGAGGAAGAGGGTGAAGGGGG + Intergenic
1144208233 17:12994134-12994156 CAGGGGAAGGCGGGGGCTGGGGG - Intronic
1144740889 17:17581691-17581713 CAGGAGGGAGAGGGGGGAGGGGG - Intronic
1144778208 17:17795397-17795419 GGGGTGAAGGAGGAGGCAGGTGG + Exonic
1146272500 17:31493567-31493589 CAGGAAAACGAGGGAGCAGGGGG - Intronic
1146306376 17:31732876-31732898 CAGGTGGGGTAGGGGGCAGGGGG - Intergenic
1146659174 17:34653162-34653184 CTGGTGAACCATGGGGCAGGAGG - Intergenic
1146915051 17:36673072-36673094 CAGGTGATATAGGAGGAAGGTGG + Intergenic
1147053975 17:37819707-37819729 AAGGAGGAAGAGGGGGAAGGAGG - Intergenic
1147429926 17:40364672-40364694 AAAATGAAAGAGGGAGCAGGAGG - Exonic
1148384917 17:47227519-47227541 GAGGTGAAAGGAGAGGCAGGAGG - Intergenic
1148447008 17:47743975-47743997 GAGGTAGAAGAGGGGGCAAGAGG + Intronic
1148465967 17:47865509-47865531 CAGGTGCCTGAGGGGGGAGGTGG - Intergenic
1148520555 17:48270934-48270956 CAGGTTTAAGCGGGGGGAGGGGG + Intronic
1149076151 17:52597726-52597748 CAGGTGCCTGAGGGAGCAGGGGG - Intergenic
1149718597 17:58819700-58819722 CAAGTAAGAGAGAGGGCAGGAGG + Intronic
1150266748 17:63837218-63837240 CAGGTTAAAGAGGAGGAAGATGG - Exonic
1150334860 17:64323283-64323305 GAGGTCATAGAGGGGACAGGGGG + Exonic
1150357899 17:64504157-64504179 CAAGAAAAAGAGGGGGTAGGTGG + Intronic
1150862139 17:68811640-68811662 CAGGAGGAAGAGAGAGCAGGAGG - Intergenic
1151170377 17:72240871-72240893 AAGTTGACAGAGGGGGCAGTTGG - Intergenic
1151331815 17:73414561-73414583 GAGGGGACAGAGTGGGCAGGAGG - Intronic
1151527638 17:74681799-74681821 CAAGTGATGGATGGGGCAGGTGG - Intronic
1151836115 17:76584018-76584040 CAGGTGAAAGCCAGGTCAGGAGG + Intronic
1151887783 17:76933314-76933336 CAGAGGGTAGAGGGGGCAGGCGG - Intronic
1152400772 17:80065065-80065087 GAGATGAAAGAGGGAGGAGGGGG - Intronic
1152400786 17:80065102-80065124 GAGATGAAAGAGGGAGGAGGGGG - Intronic
1152936207 17:83138503-83138525 GAGGAGAAAGAGAGAGCAGGAGG + Intergenic
1153167030 18:2273825-2273847 CAGGAGCAAGAGGGAGAAGGAGG + Intergenic
1153702689 18:7712038-7712060 CAGGAGATACAGGGGTCAGGAGG - Intronic
1153759186 18:8313737-8313759 CAGGGGAAAGGGGGAGAAGGGGG - Intronic
1154162236 18:11989300-11989322 CTGGAGGAAGAGGAGGCAGGAGG + Intronic
1154435832 18:14340983-14341005 CAGCTGAAAGAGGAGGCCAGAGG + Intergenic
1155144066 18:23069081-23069103 AAGGGGAAAGAGGAAGCAGGAGG + Intergenic
1155161059 18:23196374-23196396 CAGATGAAAGGGCCGGCAGGAGG + Intronic
1156643541 18:39131607-39131629 CAGGAGAAAGAGAGAGCAAGGGG + Intergenic
1157294523 18:46433226-46433248 CAGGTGGAAGTGGCGGCAGGAGG - Exonic
1157524894 18:48373280-48373302 CAGGAGCAAGAGGGGTCAGGAGG - Intronic
1157621158 18:49018178-49018200 CAGGAGAAGGAAGGGACAGGCGG + Intergenic
1157727777 18:49978163-49978185 CAGGTGGTAAAGGGGGCAGGAGG - Intronic
1157977383 18:52341666-52341688 CAGGAGAAAGAGGGACCTGGAGG + Intronic
1158079886 18:53577278-53577300 CAGGAGAAAGAGAGGGAAGCAGG - Intergenic
1158525501 18:58209340-58209362 GAGGAGGAGGAGGGGGCAGGAGG - Intronic
1159677487 18:71303968-71303990 CAGGAGGAAGAGGGAGCAGGGGG - Intergenic
1160067400 18:75588676-75588698 CAGGTGAAATAGGGGAGGGGGGG + Intergenic
1160208738 18:76858935-76858957 CAGGTGGAGGCGGGTGCAGGTGG + Intronic
1160208753 18:76858979-76859001 CAGGTGGAGGCGGGTGCAGGTGG + Intronic
1160208809 18:76859155-76859177 CAGGTGGAGGCGGGTGCAGGTGG + Intronic
1160208836 18:76859243-76859265 CAGGTGGAGGCGGGTGCAGGTGG + Intronic
1160475116 18:79177182-79177204 GAGGCGGAAGAGGGGGAAGGGGG - Intronic
1160490363 18:79332609-79332631 GAGGTGGAAGCGGAGGCAGGAGG + Intronic
1160730902 19:641250-641272 CACGTGAACAAGGGCGCAGGTGG + Intronic
1160818048 19:1045234-1045256 CAGGCGAGGGAGGGGGCGGGGGG + Intronic
1160843838 19:1158065-1158087 CAGAAGAAAGAGGCGGGAGGCGG - Intronic
1161239347 19:3213380-3213402 CAGGAGAGAGAGGGAGGAGGGGG + Intergenic
1161303682 19:3555733-3555755 CAGGTGGCAGGAGGGGCAGGCGG - Intronic
1161383141 19:3977088-3977110 CAGGTGATGGATGGAGCAGGTGG - Intronic
1161559209 19:4962231-4962253 CAGGAGAAACATGAGGCAGGTGG + Intergenic
1161627808 19:5337337-5337359 CAGGTGAACGCGGGGCCACGGGG + Intronic
1162017519 19:7853475-7853497 CAGGTGAAGGACGGCGCAGGTGG - Intronic
1162024159 19:7884401-7884423 GAGGGGAAAGAGGGAGGAGGAGG + Intergenic
1162187927 19:8921843-8921865 CAGGGGGAAGAGGGGACAGGGGG - Intronic
1162630853 19:11925643-11925665 CAGGAGAAAGTGGGGACTGGGGG - Intronic
1162767484 19:12928707-12928729 CAGGTGGGAGCTGGGGCAGGGGG - Intronic
1162901089 19:13795799-13795821 CAGGTGACCGCGGGGGAAGGGGG + Exonic
1162955075 19:14092881-14092903 AAAGTGGGAGAGGGGGCAGGAGG + Exonic
1163518957 19:17780717-17780739 CAGGTGAGAGGGGAGGTAGGTGG + Intronic
1163675655 19:18654119-18654141 TAGATGGAAGAGTGGGCAGGTGG - Intronic
1163718424 19:18885986-18886008 CAGGTGCACCAGGAGGCAGGAGG - Intronic
1163763654 19:19150569-19150591 CAGGGGAATGAGGAGGCATGAGG - Intronic
1163966343 19:20750607-20750629 CAGGTGCTTGAGGGAGCAGGGGG + Intronic
1164160911 19:22624853-22624875 CATGTGAAAGTGGGGGTGGGGGG - Intergenic
1164481089 19:28611477-28611499 CAGGTGCCTGAGGGAGCAGGGGG - Intergenic
1164757008 19:30697121-30697143 CAGGTGAGAGAGAGAGCAAGTGG + Intronic
1165722210 19:38087658-38087680 CAGGTAGACGAGGGAGCAGGAGG + Intronic
1165747421 19:38238245-38238267 CCGGAGACAGAGGAGGCAGGAGG + Intergenic
1166075523 19:40411749-40411771 CAGGGGAAAGAGGGGTGGGGAGG + Intronic
1166199951 19:41231045-41231067 CAGGTGACAGAGTTGGGAGGTGG + Exonic
1166343175 19:42150657-42150679 CAGGAGAGAGAAAGGGCAGGAGG - Intronic
1166542855 19:43617095-43617117 CAGGCCAAAAAGGGGGAAGGAGG - Intronic
1166560287 19:43728314-43728336 CAGGAGCAAGAGGGGGCAGGTGG - Exonic
1166668206 19:44694248-44694270 CAGGGGAAAGTGGGAGAAGGTGG - Intergenic
1167017084 19:46848225-46848247 CAGGTGTGATGGGGGGCAGGGGG + Intronic
1167112255 19:47469341-47469363 CAGGAGAAACAGGGGCCAGCCGG + Intronic
1167448976 19:49556160-49556182 CAGGAGAAAGCGGGGGGGGGGGG + Intronic
1167478171 19:49712877-49712899 CAGAGGAAAGAGGGGGCTGGGGG + Intronic
1167565316 19:50252419-50252441 GAGGTCACAGAGGTGGCAGGGGG + Intronic
1167572574 19:50298280-50298302 CAGGTGAAAGAGGGGGCAGGAGG + Intronic
1167622972 19:50568956-50568978 CAGGGGACAGAGGGGCCTGGAGG + Intergenic
1167707975 19:51093118-51093140 CAGGTGGAAGATGGGGAAGCCGG + Intergenic
1168104318 19:54157215-54157237 CAGGGGAAGGAGGGGACAAGTGG + Intronic
1168252454 19:55148309-55148331 AAGGTGAAAGGGGAGACAGGTGG - Intronic
1168510154 19:56967360-56967382 GAGGAGAAAGAGGGGGCAGGGGG - Intergenic
1202647180 1_KI270706v1_random:153102-153124 CAGGTGGAGGAGTGGTCAGGAGG - Intergenic
925115547 2:1375463-1375485 AAGGGGAAAGAGCGAGCAGGAGG + Intronic
925207044 2:2015697-2015719 CAAGGGAAGGAGGGGGCGGGAGG + Intronic
925221303 2:2143640-2143662 CAGGTGTTAGAGGGGACAGAAGG + Intronic
925898753 2:8493886-8493908 CAGGTCAGAGAGGAGGAAGGAGG - Intergenic
926092022 2:10057614-10057636 AAGGAGATAGAGGGGGAAGGAGG - Exonic
926326018 2:11785645-11785667 GTGGTGAGAGAGGGGGCGGGAGG - Intronic
926439632 2:12874525-12874547 CAGTTGGAAGAGGGGCCAAGTGG + Intergenic
927842244 2:26453158-26453180 CAGGAGAAAGAGTGGGAAGAAGG - Intronic
927970973 2:27306335-27306357 CAGGTGAAGGAGGTGGCCGAGGG + Exonic
928723687 2:34147903-34147925 GAGGGGACAGAGGTGGCAGGGGG + Intergenic
928798782 2:35060240-35060262 CAGGTGAAAAAGTGGGAAGGGGG + Intergenic
928826437 2:35427027-35427049 GAGGAGAAGGAGGAGGCAGGAGG + Intergenic
929031225 2:37651687-37651709 CAGGTGGGAGAGGATGCAGGAGG + Intronic
929641909 2:43589677-43589699 CAGGGGAAAGGGTGGGAAGGGGG + Intronic
930193792 2:48488234-48488256 GAGGTGAAAGGGGAGGCAGTGGG - Intronic
931282680 2:60807921-60807943 CAGGTGAAAGCTGGGGGAGGTGG + Intergenic
931615086 2:64147566-64147588 CAGATGAAAGATGGGTCAGAGGG + Intergenic
932061005 2:68497441-68497463 CAGGAGAAAGAGAGAGAAGGGGG - Intronic
932300451 2:70663382-70663404 GAGGAGAGAGAGGAGGCAGGAGG + Exonic
932703793 2:74008292-74008314 GAAGTGAAAGAGAAGGCAGGAGG - Intronic
933632184 2:84671370-84671392 CAGCTGCAAGAGGGTGCAGATGG - Intronic
933734133 2:85481429-85481451 CAGGTGGAAAAGGAGGCAAGAGG - Intergenic
933804511 2:85988485-85988507 CAGGTGGGAGATGGGTCAGGAGG - Intergenic
933809104 2:86021399-86021421 AGGGTGGAAGTGGGGGCAGGAGG + Exonic
934490165 2:94756852-94756874 CAGCTGAAAGAGGAGGCCAGGGG - Intergenic
935163334 2:100548190-100548212 CAGGTGGGAGAGGGAGAAGGGGG + Intergenic
935283753 2:101545138-101545160 AAGGGGAAAGAGTGGGAAGGAGG - Intergenic
935294239 2:101634951-101634973 CTGGGGAAGGAGGAGGCAGGTGG - Intergenic
935706509 2:105861946-105861968 CAGGTGGAAGAAAGGGAAGGGGG - Intronic
936245933 2:110827380-110827402 CAGGTGAATGAGCTGGCATGTGG + Intronic
936352115 2:111720686-111720708 CACACCAAAGAGGGGGCAGGGGG - Intergenic
937039222 2:118808007-118808029 CAGGAGGGAGAGGGGGGAGGTGG + Intergenic
937061343 2:118982408-118982430 CAGGTAACAGAGGGTGCAGTGGG + Exonic
937808159 2:126169730-126169752 CAGGTGGCAGAGGTGGCAGTGGG + Intergenic
938242178 2:129751712-129751734 AAGGAGGAAGAGGGGGAAGGGGG + Intergenic
938273765 2:129998076-129998098 CAGGAGAAAGAGGAAGCATGGGG + Intergenic
938278117 2:130045608-130045630 CAGGAGAAAGAGGAAGCATGGGG + Intergenic
938329087 2:130436409-130436431 CAGGAGAAAGAGGAAGCATGGGG + Intergenic
938360858 2:130685084-130685106 CAGGAGAAAGAGGAAGCATGGGG - Intergenic
938437262 2:131291777-131291799 CAGGAGAAAGAGGAAGCATGGGG - Intronic
938442444 2:131348039-131348061 CAGGAGAAAGAGGAAGCATGGGG - Intronic
938712910 2:133990845-133990867 CAGATGAGATAGGGGTCAGGAGG + Intergenic
939867237 2:147486348-147486370 CGGGTGGAAGAGAGGGCATGCGG - Intergenic
940000783 2:148964692-148964714 CAGGCAAAATAGGGGGCATGAGG + Intronic
940159547 2:150696824-150696846 AAAGAGAGAGAGGGGGCAGGAGG + Intergenic
940789640 2:158018581-158018603 CAGGTGGCAGTGGGGGAAGGGGG + Intronic
940904270 2:159154556-159154578 CAGTTGAAACAAGGGGCAGGAGG - Intronic
940920050 2:159296194-159296216 CAGGCCAAAGAGATGGCAGGGGG + Intergenic
941040465 2:160616159-160616181 AAGGGGAAAGAGTGGGCAAGAGG - Intergenic
941168031 2:162104346-162104368 CAGGGGAAAGAGAGGGCACCAGG + Intergenic
941658451 2:168169839-168169861 CAGGTAAAAGAAGGGGCAGGGGG + Intronic
941728827 2:168893054-168893076 CAGGAGCAAGAGAGGTCAGGAGG + Intronic
942123568 2:172801918-172801940 CAGATCAAAGAGAGGGTAGGAGG - Intronic
942412634 2:175727117-175727139 CAGGTGAAAGAGGGGGGGATAGG + Intergenic
942455177 2:176133101-176133123 CAGGGGAAAGTGGGGGGAAGAGG + Intergenic
942590476 2:177540472-177540494 TATGTGAAAGTGGGGGCTGGGGG - Exonic
942961742 2:181837619-181837641 CAATTGAAAGAGGAGGAAGGTGG - Intergenic
942991526 2:182208348-182208370 CAGGAGAGAGAGAGTGCAGGGGG + Intronic
943532646 2:189103725-189103747 AAGGTGAAGGAGGGGAGAGGAGG + Intronic
943689892 2:190858841-190858863 CGGGGGAAAGACGGGGAAGGAGG + Intergenic
945908355 2:215619240-215619262 CAGCTGAGAGAAGGGGAAGGAGG + Intergenic
946911365 2:224464503-224464525 CAGGAGAAAGAGAGAGAAGGGGG + Intergenic
947257696 2:228183336-228183358 CAGGGGAAAGTGTGGGAAGGGGG - Intergenic
947663049 2:231884228-231884250 CGGGTGTAAGAGGGCACAGGTGG + Intergenic
947851960 2:233295447-233295469 CTGGTGAGAGAGGAGTCAGGTGG + Exonic
947945699 2:234100219-234100241 CAGGTGACAGAGGGGGCCGTTGG + Intergenic
948538417 2:238666127-238666149 CAGGTGGAAGAAGGGCTAGGAGG - Intergenic
948674998 2:239591949-239591971 CAGGAGGAAGAGGAAGCAGGGGG + Intergenic
948839878 2:240643624-240643646 CAGGAGACAGAGAGGGCTGGGGG - Intergenic
948933341 2:241146775-241146797 CAGGTGCAAGAGTGGGGAAGAGG + Intronic
1169293428 20:4372146-4372168 CAATTGAAAAAGGGGGCAGGCGG - Intergenic
1169598945 20:7234920-7234942 CAGGTGAAATAAAGTGCAGGTGG + Intergenic
1169712412 20:8579850-8579872 CAGGAGACAGAGGGAGCAAGGGG + Intronic
1170134824 20:13061387-13061409 TAGGTGGTGGAGGGGGCAGGTGG - Intronic
1170367738 20:15616175-15616197 CAGGAGACAGAGGGCGCAGTGGG - Intronic
1170390176 20:15864081-15864103 AAGGTGAAAGAAGGAGAAGGAGG - Intronic
1170525182 20:17228916-17228938 CAGGGGAAAGAAGGCGCCGGCGG + Intronic
1171074672 20:22110545-22110567 CAGGGGAAAGAGCAGGCAAGGGG - Intergenic
1171148976 20:22810311-22810333 CTGGTTCAAGAAGGGGCAGGAGG + Intergenic
1171869306 20:30513123-30513145 CAGGAGACAGATGGGGCCGGGGG + Intergenic
1171950774 20:31419717-31419739 CAGGTGAGAGAGAGGGCACCAGG - Intergenic
1172228770 20:33323151-33323173 GAGAAGAAAGAAGGGGCAGGAGG + Intergenic
1172484060 20:35287964-35287986 CAGGTGAAGCTGGGGGCAGAGGG + Exonic
1172719515 20:36988866-36988888 CAGGAGGAAGAGAGAGCAGGGGG - Intergenic
1172772761 20:37391252-37391274 CAGATGAAAGAGGAGGCTGCAGG - Intronic
1173705158 20:45104799-45104821 CAGGGTAAAGAAAGGGCAGGAGG - Intergenic
1173733368 20:45343461-45343483 CTGGAGGGAGAGGGGGCAGGGGG - Intronic
1174106216 20:48164262-48164284 TGTGTGAAAGAGTGGGCAGGTGG - Intergenic
1174351265 20:49970075-49970097 CAGGTGAATGAGGGGGTTGGGGG - Intergenic
1174756660 20:53165746-53165768 CAAGTGAAAGAGTGGCCAAGTGG + Intronic
1175027998 20:55923340-55923362 CAGGTGAGAGAGAGTGAAGGAGG - Intergenic
1175199130 20:57266175-57266197 CAGGTGGCAGAGGGGGCAGGCGG + Exonic
1175645310 20:60665931-60665953 CAGGGGAAAGGGTGGGAAGGGGG + Intergenic
1176138583 20:63535758-63535780 CAGGTGAGGGGGGGGGCGGGAGG - Intronic
1176138616 20:63535828-63535850 CAGGTGAGGGGGGGGGCGGGAGG - Intronic
1176180506 20:63747414-63747436 AGGTTGGAAGAGGGGGCAGGGGG + Intronic
1176201423 20:63862527-63862549 CAGGTGACAGGGGGCGCAGGCGG - Exonic
1176201734 20:63863965-63863987 CGGGTGAAGGAAGGGGCAGTGGG + Intergenic
1176258696 20:64167469-64167491 CTGGTGGAACAGGGGTCAGGAGG + Intronic
1176363867 21:6020799-6020821 CCCGTGTATGAGGGGGCAGGAGG + Intergenic
1176841202 21:13844651-13844673 CAGCTGAAAGAGGAGGCCAGAGG - Intergenic
1177402625 21:20624996-20625018 CAGGAGAAAGAGAGTGAAGGGGG + Intergenic
1177515541 21:22147128-22147150 CAGGAGAAAGAGAGAGAAGGTGG - Intergenic
1178329076 21:31671577-31671599 GAGGTGACAGACAGGGCAGGTGG - Exonic
1178505254 21:33157395-33157417 GAGGAGAAAGAGGGAGGAGGAGG - Intergenic
1178505259 21:33157414-33157436 GAGGAGAAAGAGGGAGGAGGAGG - Intergenic
1178505264 21:33157433-33157455 GAGGAGAAAGAGGGAGGAGGAGG - Intergenic
1179270848 21:39849887-39849909 AAGATGGAAGAGGGGACAGGAGG + Intergenic
1179299083 21:40090395-40090417 CAGGTGAGAAAGTGGGTAGGAGG - Intronic
1179471293 21:41612487-41612509 CAGGGAATAAAGGGGGCAGGCGG + Intergenic
1179487015 21:41716944-41716966 CAGGTGTAGGTGGGGGCGGGAGG - Intergenic
1179759651 21:43517746-43517768 CCCGTGTATGAGGGGGCAGGAGG - Intergenic
1180076702 21:45466832-45466854 AAGGTGAACGCGGGGGCAGCTGG + Intronic
1180148905 21:45937700-45937722 CAGGTGCAGGTGGGGCCAGGTGG + Intronic
1180738917 22:18039609-18039631 CTGTTGAAAGAGGGAGCAAGAGG + Intergenic
1180862007 22:19088933-19088955 CAGGTGAATGAGTGAGCAGGAGG + Intronic
1180875044 22:19171283-19171305 CAGGGGAAAGGAGGGGCGGGAGG + Intergenic
1180908111 22:19430340-19430362 AAGGAGAGAGAGGTGGCAGGAGG + Intronic
1180938582 22:19641962-19641984 GAGGTGGGGGAGGGGGCAGGGGG + Intergenic
1182192539 22:28477782-28477804 CAGTTGTACGAGAGGGCAGGTGG - Intronic
1182440600 22:30361829-30361851 GAGGGGAGAGAAGGGGCAGGTGG - Intronic
1182886076 22:33775414-33775436 CAGTTAAAAGAGGCAGCAGGTGG - Intronic
1183259928 22:36788123-36788145 CAAGTGAGAGAGGGAGAAGGAGG + Intergenic
1183500006 22:38173180-38173202 CAGCTGCAAGAGGGGGATGGTGG + Intronic
1183642445 22:39100835-39100857 CAGGTGAGAGCCGGGGCGGGGGG - Intronic
1184205233 22:42998126-42998148 CAGGTTAAGGAGGGAGCAGAAGG + Intronic
1184208940 22:43023870-43023892 CAGGTGGGAGACAGGGCAGGGGG + Intergenic
1184245032 22:43231516-43231538 CAGGTGGCAGAGGGAGCCGGTGG - Intronic
1184281742 22:43441345-43441367 CAGGTGACACAGTGGGCAGAGGG - Intronic
1184874043 22:47261482-47261504 CAAGTGGAAGAGGGAGGAGGAGG - Intergenic
1184982664 22:48105359-48105381 GAGAGGAAAGATGGGGCAGGTGG + Intergenic
1185197135 22:49478697-49478719 CAGGAGGAAGAGAGGGGAGGGGG + Intronic
1185295635 22:50052398-50052420 CAGGTAAGAGAGGGGAAAGGGGG + Intronic
949278041 3:2310514-2310536 GAGGTGAAAAAGTGGGAAGGCGG - Intronic
949493527 3:4610964-4610986 AAGGAGAAGGAGGGGGAAGGGGG - Intronic
949535706 3:4994969-4994991 CAGGGGAAGCAGGGGCCAGGTGG - Intergenic
949797255 3:7864482-7864504 ACGGTGAAAGAGGGGGCAAGAGG - Intergenic
949875973 3:8626386-8626408 CAGGAGGAAGGGGGTGCAGGTGG - Intronic
950018667 3:9770783-9770805 GAGTGGAAAGAGGGGGCGGGGGG + Intronic
950025527 3:9817436-9817458 AATGTGAAAGGGGGGACAGGAGG + Intronic
950483634 3:13260099-13260121 CTGGAGGAAGAGGGGGAAGGAGG + Intergenic
952256358 3:31698906-31698928 CAAGTGAGAGAGAGGGAAGGAGG - Intronic
952558382 3:34559924-34559946 GAGGAGCAAGAGGGAGCAGGTGG + Intergenic
952897629 3:38088720-38088742 CAGATGATAGAGGGGCCTGGGGG - Intronic
952997061 3:38894753-38894775 CAGCAAAAAGAGGTGGCAGGAGG - Exonic
953149406 3:40310201-40310223 CGGGTCAAGGACGGGGCAGGGGG - Intronic
953498432 3:43408956-43408978 CAGGAGAAAGAGGCTGCAGTGGG + Intronic
953805395 3:46063574-46063596 CAGGTGGAAAAGGTGGAAGGTGG + Intergenic
954807201 3:53227394-53227416 CAGGAGCAAGATGGGGCTGGAGG - Intronic
955796755 3:62645194-62645216 CAGGGGAAAGAGTGGGAAGGGGG + Intronic
956047636 3:65213418-65213440 CTGGTGAAAGAGGGGGCTCAGGG + Intergenic
956262286 3:67357186-67357208 CAACTGAAAGAGGGAGCAAGAGG + Intergenic
956678472 3:71755656-71755678 CAGGAGAAAGTGGGGGGTGGGGG + Exonic
956754085 3:72368374-72368396 CAGGGGGAAGAGAGGGAAGGTGG - Intergenic
957326800 3:78706223-78706245 CAAGTAGAAGATGGGGCAGGTGG + Intronic
957698170 3:83671554-83671576 CAGGAGGAAGAGAGGGAAGGGGG - Intergenic
958014303 3:87920245-87920267 CAGGGGAAAGGGTGGGAAGGGGG + Intergenic
958687154 3:97413379-97413401 CAGGGGAAAGAGCAAGCAGGAGG + Intronic
958863391 3:99471221-99471243 TTGGTTAAAAAGGGGGCAGGGGG - Intergenic
959769069 3:110071293-110071315 CAAGAGAGAGAGGGGGCAGTGGG - Intergenic
959845374 3:111026534-111026556 CAGGTGAAACACAGGGCATGAGG - Intergenic
959969227 3:112390138-112390160 GAGGTGGAAGAGGTGGAAGGAGG - Intergenic
960982116 3:123239239-123239261 CAGGAGGCAGAGGGAGCAGGAGG + Intronic
961476744 3:127151382-127151404 CAGGTGACAGAGGGAGTAGCGGG - Intergenic
961504012 3:127358239-127358261 CAGGGGAAAGAGGAGGCAAGGGG - Intergenic
961669423 3:128518034-128518056 CAGTTGAGGGAGGGGGCAGTGGG + Intergenic
961866180 3:129954985-129955007 CAGGGGAAAGATGGTGCAGCAGG + Intergenic
962018305 3:131467595-131467617 CAGGAGGAAGAGAGGGAAGGGGG - Intronic
962205248 3:133428801-133428823 CAGGTCAGAGCGAGGGCAGGCGG - Intronic
962403505 3:135081089-135081111 CAGGTGAAGGAGGGGAGGGGAGG + Intronic
962479432 3:135785782-135785804 CAGGGGACAGAGTGGGGAGGTGG + Intergenic
963234945 3:142947316-142947338 CAGGAGGAGGAAGGGGCAGGCGG + Intergenic
965039519 3:163488626-163488648 CAGGAGAAAGAGGAAGAAGGGGG + Intergenic
965389212 3:168084166-168084188 CAGGAGAGAGAGGGTGAAGGGGG - Intronic
965537237 3:169835975-169835997 CAAATGAAAGAGGTGGCTGGGGG - Intronic
965619558 3:170629338-170629360 CAGGGGAAATAGGGGCCAGCAGG + Intronic
966230077 3:177642104-177642126 CAGGTGAACGACAGGGCGGGAGG + Intergenic
966678854 3:182619063-182619085 CTGGTGAAAGAGGCAGCAAGAGG - Intergenic
966759889 3:183408401-183408423 CAGGTGTAATGGGGGCCAGGAGG - Intronic
966923336 3:184628776-184628798 CAGGTGAGTGAGGGGACTGGGGG - Intronic
967236951 3:187394091-187394113 GAGGGGAAAGAGGGAGCATGTGG + Intergenic
967327361 3:188254743-188254765 CGGGTGAAAGATGTGGCATGTGG + Intronic
967880341 3:194297224-194297246 GAGGGGACGGAGGGGGCAGGAGG - Intergenic
967941290 3:194768518-194768540 CTGGAGACAGAAGGGGCAGGAGG + Intergenic
968173667 3:196530053-196530075 CAGGGGAAAGGGTGGGAAGGGGG - Intergenic
968593983 4:1473077-1473099 CAGGTGGCAGGGTGGGCAGGTGG - Intergenic
968958501 4:3730744-3730766 CAGGTGCTGGTGGGGGCAGGGGG + Intergenic
969049658 4:4363650-4363672 GAGGGGACAGAGGGTGCAGGAGG + Intronic
969201247 4:5608109-5608131 AAGGGGAAAGAGAGGCCAGGAGG - Intronic
969364224 4:6684761-6684783 CAAGGGAAGGAGGAGGCAGGGGG + Intergenic
969368266 4:6713140-6713162 CAGGAGCAAGAGGTGACAGGAGG + Intergenic
969624425 4:8295115-8295137 CAGGTGAATGAGTGGGTGGGTGG - Intronic
969696513 4:8738135-8738157 CAGGTGGGGTAGGGGGCAGGGGG - Intergenic
969749949 4:9102447-9102469 CAGGTGCTTGAGGGAGCAGGGGG - Intergenic
970738904 4:19209581-19209603 CAGGAGAAAGAGAGTGAAGGGGG + Intergenic
970840516 4:20463229-20463251 CTGGGGAAAGAGGTGGGAGGTGG - Intronic
972053169 4:34765556-34765578 AAGGTGAAAAATGGGGGAGGGGG + Intergenic
972219371 4:36936162-36936184 CAGGGGAAAGAGGCGGCTGTGGG + Intergenic
972229526 4:37055015-37055037 CAGGTGAAAGAGGACACTGGAGG - Intergenic
972401778 4:38711305-38711327 CATCTGAAAGAGGAGGCAGGGGG - Intergenic
972688523 4:41373931-41373953 CAGGAGGAAGAGAGAGCAGGGGG - Intronic
972829758 4:42801820-42801842 CAGGAGAAAGAGCGAGAAGGGGG + Intergenic
972911680 4:43824183-43824205 CAGGAGCAAGAGGGAGCATGTGG + Intergenic
973006552 4:45014542-45014564 AAGGTGGTAGAGGGGGCAGCCGG - Intergenic
973319126 4:48792338-48792360 AAGAGGAAAGAGGAGGCAGGAGG + Intergenic
973889749 4:55357138-55357160 CAGGGGACAGAGGGTGCAGAGGG - Intronic
974005943 4:56557223-56557245 CAGGTGACAGAGGTGACAGAGGG + Intronic
974606629 4:64160200-64160222 CAGGAGAGAGAGAGGGAAGGCGG - Intergenic
975195029 4:71514320-71514342 CAGGAGGAAGAGGGTGAAGGGGG - Intronic
976463146 4:85336420-85336442 CATGTCAATGAGGGGCCAGGTGG - Intergenic
976726273 4:88218592-88218614 CAGGGGAAAGGGTGGGAAGGGGG - Intronic
976842911 4:89452628-89452650 TAGGGGAAAGTGGGGGCAAGAGG + Intergenic
977867902 4:102051778-102051800 CAGTTGAAAGTGGGGGTAGGAGG + Intronic
978168758 4:105643284-105643306 AAAGTGACAGAGGGGGAAGGAGG - Intronic
978340144 4:107714029-107714051 CAGTTGAAAGAGGGTTCAGAAGG - Intronic
978591432 4:110328813-110328835 CAGGAGAAAGAGAGAGAAGGGGG - Intergenic
978905745 4:114003526-114003548 CATGTCAATGATGGGGCAGGTGG + Intergenic
979212348 4:118120320-118120342 CAGGAGGCAGAGGGAGCAGGGGG + Intronic
980686439 4:136236406-136236428 CAGGAGAAAGAGAGAGCATGAGG - Intergenic
981259926 4:142707565-142707587 CAGGAGGAAGAGGGTGAAGGGGG - Intronic
981614637 4:146634055-146634077 CAGGTGAAGGAGGGCGCTTGGGG - Intergenic
981747251 4:148063703-148063725 CAGGTGGAAGAGGCTGCTGGAGG - Intronic
981888908 4:149713593-149713615 CAGCTGAAAGTAAGGGCAGGGGG - Intergenic
981912283 4:149995495-149995517 CAGGTGAGAGAGAGGGAAGGAGG + Intergenic
982111554 4:152061045-152061067 GAGGTGGAAGGGGAGGCAGGAGG + Intergenic
984510614 4:180674112-180674134 CAGGTGAAAGATGGTGATGGAGG + Intergenic
985000641 4:185479083-185479105 CAGGAGAAGGAGGTGTCAGGAGG - Intergenic
986190396 5:5491579-5491601 AAGATGAAAGACGGGGCAGGAGG + Intergenic
986197472 5:5551305-5551327 CAGGAGAGAGAGGGAGAAGGGGG + Intergenic
986748911 5:10767656-10767678 CACGTGAAAGAAGAGGAAGGAGG - Intergenic
987134055 5:14884675-14884697 CATGGGAAAGAGGGGGTTGGAGG + Intergenic
987289417 5:16494541-16494563 CAGGAGTAAGAGAGAGCAGGGGG - Intronic
987502319 5:18729214-18729236 CAGTTGAAAGAGGCAGAAGGAGG - Intergenic
987937092 5:24480404-24480426 AAGGGGAAAGAGTGAGCAGGAGG + Intergenic
987987117 5:25161877-25161899 CAGATGGCAAAGGGGGCAGGAGG + Intergenic
989690287 5:44135403-44135425 CTGGGGAAAGAGTGGGAAGGGGG - Intergenic
990358310 5:54992928-54992950 CAGGGGAAAGGGTGGGAAGGGGG + Intronic
990747465 5:58974725-58974747 CAGGTTGAAGAGGAGGCAGTAGG - Exonic
990995482 5:61728655-61728677 CAGGTGAAATGGGTGGCAGCAGG + Intronic
991437165 5:66608797-66608819 CAGGGGAAAGCGGGGGGCGGGGG + Intronic
991947647 5:71915238-71915260 CAGGGGAAAGAGCAGGAAGGAGG - Intergenic
992737869 5:79742028-79742050 GAGGAGAAAGAGGGAGGAGGAGG - Intronic
993086623 5:83370873-83370895 CAGGAGAAAGAGTTGGCATGGGG - Intergenic
993307183 5:86288047-86288069 CAGGTGACAGAGGAGGCACTTGG - Intergenic
993717001 5:91284993-91285015 AAGGAGAAAGAGCAGGCAGGTGG + Intergenic
993899225 5:93573001-93573023 CAGGTGCCAGAGGAGCCAGGAGG + Intergenic
993948087 5:94138680-94138702 CAGGGAAAAGAGTGGGCAGGGGG - Intergenic
994030168 5:95132663-95132685 CAGGTGAAAGGAGGGACAGTGGG - Intronic
994247141 5:97490664-97490686 CATGAGAGAGAGGGGGGAGGGGG - Intergenic
997419243 5:133752750-133752772 CAGGGGTCATAGGGGGCAGGGGG + Intergenic
998389857 5:141780438-141780460 CTGGGGAAGGAGGGGGCCGGTGG - Intergenic
998964707 5:147526724-147526746 GAGTTGGAAGAGGGGGCTGGAGG + Intergenic
999198662 5:149800670-149800692 CATGTGACAGATGGGGCAGGGGG + Intronic
999446296 5:151642639-151642661 CAGGAGAAAGAGAGGGCAAAGGG + Intergenic
999730939 5:154476406-154476428 CTGCTGAAAGAGCGGGAAGGAGG - Intronic
1000272284 5:159697450-159697472 CAGGTGAAAACAGGGGCAGGAGG - Intergenic
1001182013 5:169529306-169529328 AAGGGGACAGAGAGGGCAGGAGG - Intergenic
1001657210 5:173360812-173360834 TAGGTGAGGGAGGGTGCAGGAGG - Intergenic
1001718862 5:173840180-173840202 GAGGAGAAGGAGAGGGCAGGAGG + Intergenic
1001769884 5:174286312-174286334 GAGGAGAAAGATGGGGGAGGAGG + Intergenic
1002029963 5:176420644-176420666 AAGGGGAAAAAGTGGGCAGGAGG + Intergenic
1002295205 5:178226760-178226782 CAGGTAAAAGGAAGGGCAGGAGG + Intronic
1002574992 5:180169564-180169586 CAGCTGGGAGAGGGGGCTGGGGG + Intronic
1003864116 6:10348016-10348038 CAAATGGAAGAGGGAGCAGGAGG + Intergenic
1004128880 6:12900233-12900255 CAACAGAAAGAGGGGGAAGGAGG - Intronic
1004367975 6:15028032-15028054 AAGGGGAAAGAGTGGACAGGAGG + Intergenic
1004709585 6:18156283-18156305 CAGGTGAAAGAGGAAGGAAGAGG + Intronic
1005801499 6:29429695-29429717 GAGGAGAAAGAGGTAGCAGGGGG + Intronic
1005901091 6:30216791-30216813 CAGATGAAGGAGGGAGAAGGAGG - Intergenic
1005921528 6:30406213-30406235 CAGGGGAAAGAGCAGGCAGAAGG - Intergenic
1005958241 6:30679397-30679419 AGGGAGAAAAAGGGGGCAGGAGG + Intronic
1006026925 6:31152892-31152914 CAGGTGAAGGCGGGGACAGGAGG - Intronic
1006079385 6:31556476-31556498 CAAGTGAAAGAGGTGGTTGGTGG + Intronic
1006116799 6:31779954-31779976 CAGGGGATGGTGGGGGCAGGTGG - Intronic
1006263169 6:32894165-32894187 GAGGGGAAAGAGGGGGAAGGGGG - Intergenic
1006376156 6:33672749-33672771 GAGGTAAAAGCGGGGGCCGGGGG + Intronic
1006389140 6:33748337-33748359 CAGAGGTAAGATGGGGCAGGTGG + Intergenic
1006474322 6:34245003-34245025 CAGGTGGAAGATGGGGGTGGCGG - Exonic
1007219724 6:40268986-40269008 CAGGGGATAGAGGGTGGAGGGGG + Intergenic
1007409291 6:41652549-41652571 CAGGTGAGAGATGAGCCAGGTGG + Intronic
1007412479 6:41673089-41673111 CAGATGGAAGAGGGGACAGTGGG - Intergenic
1007519538 6:42440914-42440936 CACGTGGAGGAGGGGGCAGCAGG - Intronic
1007965994 6:46004201-46004223 GAGGTGAGAGAGGCTGCAGGTGG + Intronic
1008247408 6:49194915-49194937 GAGGAGAAACATGGGGCAGGGGG - Intergenic
1008738592 6:54577285-54577307 CATCTGAAAGAGAGGGCAGAAGG + Intergenic
1010452482 6:76018470-76018492 CTGTGGATAGAGGGGGCAGGTGG + Intronic
1010642967 6:78353656-78353678 CAGGTGGAAGAGGGAGCAAAGGG + Intergenic
1011087305 6:83556305-83556327 TGGGGGGAAGAGGGGGCAGGGGG + Intronic
1011286424 6:85729343-85729365 CAGGTGAAAGGGTGGGAGGGGGG - Intergenic
1011417442 6:87137319-87137341 GAGGAGAAAGAGGGGGAAGGAGG - Intergenic
1011553246 6:88548878-88548900 CAGGTGATAGTGGGGGTCGGGGG - Intergenic
1011806645 6:91079882-91079904 CAGGTGAAAGAGAGAGGAGATGG - Intergenic
1012511715 6:100010134-100010156 CAGGAGAAAGAGAGTGAAGGGGG + Intergenic
1013236945 6:108205520-108205542 GAGGTGGAAGGGGAGGCAGGAGG - Intergenic
1013435880 6:110106200-110106222 CGGGTGTAAGATGGGGCATGAGG + Intronic
1013624315 6:111921384-111921406 CAGGTGAGAAAGTGGGGAGGAGG + Intergenic
1013650763 6:112192402-112192424 CAGGTGAAGGAAGAGGCAGCAGG + Intronic
1013855989 6:114572584-114572606 CAGGAGAAAGAGAGTGAAGGAGG - Intergenic
1014022306 6:116605222-116605244 CAGGGGAAAGGGTGGGAAGGGGG + Intergenic
1014400826 6:120987594-120987616 CAGGAGACAGATGGAGCAGGGGG - Intergenic
1014466077 6:121758801-121758823 CAGGAGAAAGAGAGAGAAGGGGG - Intergenic
1014990985 6:128076011-128076033 AAGGTGACAGGGGTGGCAGGGGG + Intronic
1015091574 6:129364920-129364942 CAGGAGGAAGTGGGGGCTGGAGG + Intronic
1016050771 6:139527809-139527831 CAGGGGTGACAGGGGGCAGGTGG + Intergenic
1016264192 6:142212761-142212783 CAGGAGACAGAGAGGGAAGGGGG + Intronic
1016341931 6:143071716-143071738 GAGGAGAAAGAGGGAGAAGGAGG - Intronic
1016568053 6:145480302-145480324 CAGGAGGAAGAGAGGGAAGGGGG + Intergenic
1017102825 6:150863753-150863775 AAAGTGAAAGAGGTGGCAGCTGG - Intergenic
1017114724 6:150966313-150966335 CAGGAGAGAGAGGGCGAAGGAGG + Intronic
1017763506 6:157589173-157589195 CAGGAGGAAGAGGGTGCAAGGGG + Intronic
1017767093 6:157615923-157615945 GAGGTGAGAGAGGGGGCCAGAGG + Intronic
1017939136 6:159036105-159036127 CAGGTGGAAGAGGGGGTAGGAGG + Exonic
1017952458 6:159147523-159147545 CAGGAGGAAGAGAGAGCAGGGGG + Intergenic
1018047182 6:159975539-159975561 CAGGTGGAAGGAGGGGCAGGTGG + Intronic
1018168259 6:161121161-161121183 CAGGGGAAAGGGTGGGAAGGCGG - Intergenic
1018699471 6:166415467-166415489 CAGGGGAAAGACGGGGGATGTGG + Intronic
1018842130 6:167524986-167525008 CAGGGGAAGGAGGGGGCAGCAGG - Intergenic
1018946721 6:168352406-168352428 CAGGAGAAAGAGGTGGGGGGAGG + Intergenic
1019064335 6:169283530-169283552 CAGGTGAATGGGAGGGCATGAGG + Intergenic
1019262197 7:87887-87909 AAGGTGACAGAGGATGCAGGTGG + Intergenic
1019420518 7:948546-948568 CAGGTGAATGAGAGGCCAGAGGG - Intronic
1019423644 7:963157-963179 CAGGTGTCAGCGGGGGCAGGTGG + Intronic
1019502890 7:1374008-1374030 CAGGAGGAAGAGGGTGAAGGGGG + Intergenic
1019729541 7:2622661-2622683 CAGGGGGAGGTGGGGGCAGGAGG - Intergenic
1019729552 7:2622686-2622708 CAGGGGGAGGTGGGGGCAGGAGG - Intergenic
1020323037 7:6954195-6954217 CAGGTGCTTGAGGGAGCAGGGGG + Intergenic
1021055380 7:16041087-16041109 CAGGAGAAAGAGGGTGAAGGGGG - Intergenic
1021134120 7:16944859-16944881 AAGGGGAAAGAGCAGGCAGGAGG + Intergenic
1021382610 7:19985653-19985675 CAGGAGGAAGAGGGAGAAGGGGG - Intergenic
1021469145 7:20981486-20981508 AAGGAGAGAGATGGGGCAGGGGG - Intergenic
1022307702 7:29163694-29163716 CTGGTGACAGAGATGGCAGGAGG - Intronic
1022505553 7:30907034-30907056 CTTGTGAAGGAGGGGTCAGGAGG + Intergenic
1023807535 7:43884266-43884288 CAGGTGGAAGAGGAAGCAGCAGG + Intronic
1023862238 7:44223660-44223682 CAGGTGAAAGTGGAGGCATGAGG - Intronic
1023934906 7:44732791-44732813 CAGATGCAGGAGGAGGCAGGAGG + Intergenic
1024542270 7:50486600-50486622 CATGTGAATGAGGAGGAAGGGGG - Intronic
1024643011 7:51346863-51346885 CAGTTGGAAAAGGGGTCAGGAGG + Intergenic
1026502638 7:70956176-70956198 AAGGGAAAAGAGTGGGCAGGAGG - Intergenic
1026537992 7:71256179-71256201 CAGCTGAAAGCGGGGGCTTGCGG - Intronic
1026577279 7:71582811-71582833 CAGGGGAAAGGGTGGGAAGGGGG + Intronic
1026919392 7:74144194-74144216 AAGGAGAAAGAGTGGGCAGGAGG - Intergenic
1026972628 7:74477498-74477520 CAGGGGAGGGAGGGGGCATGGGG + Intronic
1027055514 7:75046832-75046854 CAGGTGAAAGACGGGGGTGCGGG + Intronic
1027164588 7:75825413-75825435 CAGGTGGAAAAGGAAGCAGGGGG + Intergenic
1027940219 7:84669046-84669068 CAAATAAAGGAGGGGGCAGGAGG - Intergenic
1028328600 7:89559663-89559685 CAGGGGAAGGAGGGGACAGGAGG + Intergenic
1028510352 7:91618651-91618673 CAAGTGAAAGAGTGGAAAGGGGG + Intergenic
1028760594 7:94491775-94491797 CAGGGGAAAGAGTGGGAGGGAGG + Intergenic
1029457460 7:100678441-100678463 CAGGTCGAAGAGGCGGCACGTGG - Exonic
1029608401 7:101613785-101613807 GAGGGGCAAGTGGGGGCAGGGGG + Intronic
1029983837 7:104903383-104903405 CAGGGGAAAACGGGGTCAGGAGG - Intronic
1030141831 7:106311891-106311913 CAGGTTAATGAGGGTGCAGAGGG - Intergenic
1030171259 7:106605266-106605288 CAGCAGAAAGAGTTGGCAGGCGG - Intergenic
1031002933 7:116438370-116438392 CTGGAGAAAGAGGGGGCTGTGGG + Intronic
1032170803 7:129583052-129583074 CAGGTGCTTGAGGGAGCAGGGGG - Intergenic
1032255847 7:130296556-130296578 AAGGAGAAAGAAGGGACAGGAGG - Intronic
1032433219 7:131879863-131879885 CAGATGAAGGATGGAGCAGGGGG + Intergenic
1032434786 7:131890910-131890932 AAGGTGAAAGAGAGGGCATAAGG - Intergenic
1032579988 7:133095460-133095482 CAGGAGAAAGGAGGGGAAGGTGG + Intergenic
1032616599 7:133479352-133479374 CTGGTGAAGGAGGGAGAAGGAGG - Intronic
1032769992 7:135042504-135042526 CAGGGGTTAGAGGTGGCAGGAGG + Intronic
1033019046 7:137703204-137703226 CAGGAGAGAGAGGGAGAAGGGGG + Intronic
1033078990 7:138277003-138277025 CAGGAGAAAGAGAGAGAAGGGGG + Intergenic
1033247432 7:139729567-139729589 CAGGTGAGAGAGGGCACACGAGG - Intronic
1033478793 7:141717801-141717823 CAGGTGTAAGAGGGGTATGGTGG + Intronic
1033584623 7:142764907-142764929 CAGGTGCCAGAGGTGCCAGGGGG - Intergenic
1033605765 7:142927584-142927606 CAGGAGGAAGAGAGAGCAGGAGG + Intronic
1033605769 7:142927600-142927622 CAGGAGGAAGAGAGAGCAGGGGG + Intronic
1034155738 7:148954942-148954964 CAGGTGAAGAAGGCGGCAGGCGG - Intergenic
1034155970 7:148956289-148956311 CAGGTGAAGAAGGCGGCAGGCGG + Intergenic
1034277746 7:149831025-149831047 CAGGAGAACGAGGTGACAGGGGG - Intergenic
1034398533 7:150846292-150846314 CAGGGGCAAGTGGTGGCAGGTGG - Intronic
1034453219 7:151149049-151149071 CAGGAGGAAGAGGGCTCAGGCGG - Exonic
1034551708 7:151824848-151824870 CAGAAGAAAGAGAGGGAAGGGGG - Intronic
1034975613 7:155447891-155447913 CAGGTGAGGGAGGTGGCTGGTGG + Intergenic
1035245443 7:157559829-157559851 CAGGAGAGAGACGGGGCGGGGGG - Intronic
1035344047 7:158186607-158186629 CTTCTGACAGAGGGGGCAGGTGG - Intronic
1035449106 7:158963951-158963973 CAGGTGGAAGAGGGGCCAGGTGG - Intergenic
1035869789 8:3125319-3125341 CAGGTGTGAGAGGGCGAAGGAGG + Intronic
1035989526 8:4473496-4473518 CAGGTGCAAGAGGGGAGTGGGGG - Intronic
1036050854 8:5195147-5195169 CAGGCAAAAGATGTGGCAGGGGG - Intergenic
1036134666 8:6149666-6149688 CAGGAGCAAGAGAGGGGAGGGGG + Intergenic
1036373024 8:8176787-8176809 CAGGTGCTTGAGGGAGCAGGGGG - Intergenic
1036726374 8:11224460-11224482 CAGGAGGAAGAGGGAGAAGGAGG + Intergenic
1036821350 8:11942486-11942508 CAGGTCAGGGAGGGGCCAGGAGG + Intergenic
1036877881 8:12488854-12488876 CAGGTGCTTGAGGGAGCAGGGGG + Intergenic
1036942690 8:13066869-13066891 CAGGGGAAAGGGTGGGAAGGGGG + Intergenic
1037056268 8:14445534-14445556 CAGCTGGAGAAGGGGGCAGGTGG - Intronic
1037171589 8:15899118-15899140 CCGGAGAAAGAGGAGGCACGTGG - Intergenic
1037353502 8:17991849-17991871 CAGGGGAAAGGGTGGGAAGGGGG - Intronic
1037674949 8:21043811-21043833 GTGGTGAAAGTGGGGGGAGGTGG - Intergenic
1037945691 8:22988076-22988098 CAGGAGATAGAGTGGGCATGAGG - Intronic
1038388678 8:27174268-27174290 CAGGTGAATGAGGAAGCTGGTGG - Intergenic
1038799157 8:30733595-30733617 CAGGTGCTTGAGGGAGCAGGGGG - Intronic
1039278418 8:35956495-35956517 CAGGTGCCTGAGGGAGCAGGGGG - Intergenic
1039436837 8:37565207-37565229 GAGGTGAAAAGGGGGGCTGGAGG - Intergenic
1039454346 8:37697491-37697513 CGGGGGAAAGGGCGGGCAGGCGG - Exonic
1039938742 8:42070567-42070589 GAGGCCAAAGCGGGGGCAGGGGG + Intergenic
1040707312 8:50144699-50144721 CAGGCGACTGAGTGGGCAGGAGG + Intronic
1040719422 8:50299296-50299318 AAGGAGAAAGAGGAGACAGGAGG - Intronic
1041392674 8:57360618-57360640 AAGGAGGAAGAGGGAGCAGGGGG - Intergenic
1042228440 8:66533600-66533622 CAGACGCTAGAGGGGGCAGGGGG - Intergenic
1042502383 8:69523607-69523629 GAAGTGAGAGAGGGGGAAGGAGG + Intronic
1043145532 8:76648861-76648883 CAGGAGGAAGAGTGTGCAGGGGG - Intergenic
1043310213 8:78849646-78849668 CAGGTGAGAGAGAGGAAAGGAGG - Intergenic
1044757199 8:95476484-95476506 CAGGAGAAATAGGAAGCAGGTGG + Intergenic
1045712027 8:104996003-104996025 CAGGTCAAAGTGGGAGCAGCAGG - Intronic
1047548627 8:125844752-125844774 GAGGAGAAAGAGGTGGCAGCTGG - Intergenic
1048977313 8:139680253-139680275 GGGGTGGCAGAGGGGGCAGGCGG + Intronic
1049075843 8:140395765-140395787 CAGGCGAGAGACAGGGCAGGGGG - Intronic
1049196747 8:141320054-141320076 CACTTGAAGAAGGGGGCAGGAGG + Intergenic
1049258580 8:141626805-141626827 AAGGTGAGAGAAGGGGCAGAGGG - Intergenic
1049507783 8:143013074-143013096 CAGGTGAAAGTGGGGGCCAGAGG - Intergenic
1050265105 9:3881659-3881681 CAGATGGATGATGGGGCAGGTGG - Intronic
1051093034 9:13432577-13432599 CAGGTGAGGGAGTTGGCAGGTGG + Intergenic
1052070754 9:24078871-24078893 CAGGTGAAAGGGAGGACAGTGGG + Intergenic
1052879232 9:33590483-33590505 GGGGTGAAAGATGGGGCTGGGGG + Intergenic
1053412761 9:37926267-37926289 GAGGTCAAAGAGGCGGCAGGAGG - Intronic
1053443602 9:38135423-38135445 CAGGAGGAAGGGGAGGCAGGAGG - Intergenic
1053496746 9:38553736-38553758 GGGGTGAAAGATGGGGCTGGGGG - Intronic
1053595019 9:39551809-39551831 AAGAGGAAAGAGGGGGGAGGGGG - Intergenic
1053852801 9:42306837-42306859 AAGAGGAAAGAGGGGGGAGGGGG - Intergenic
1053917419 9:42953964-42953986 CAGCTGAAAGAGGTGGCCAGGGG + Intergenic
1055766884 9:79672916-79672938 CAAGTGCAAGTGAGGGCAGGTGG + Intronic
1056078856 9:83069313-83069335 TGGGTGAAAGAAGGGGAAGGGGG - Intergenic
1056249405 9:84732716-84732738 CAGGTGAAAGGGGGTGGAGAAGG + Intronic
1056388576 9:86119470-86119492 CAGGAGACAGAGGGAGCAAGGGG + Intergenic
1057169490 9:92952649-92952671 AAGGAGAAAGAGGGGGAAGGAGG - Intronic
1057676661 9:97141292-97141314 GGGGTGAAAGATGGGGCTGGGGG - Intergenic
1057684859 9:97222382-97222404 CAGGTGGAGGAGTGGGCGGGAGG - Intergenic
1058189118 9:101891549-101891571 CAGGAGCAAGAGAGAGCAGGGGG + Intergenic
1058317466 9:103586585-103586607 CAGTTGAAAGATGGTGAAGGCGG - Intergenic
1059452005 9:114376524-114376546 CTGGTGATAGGGTGGGCAGGAGG + Exonic
1059460346 9:114425562-114425584 CAGGTGAAAGGAAGGGAAGGGGG + Intronic
1060026070 9:120172622-120172644 GAGGGGAAAGAGTGGGAAGGGGG + Intergenic
1060514802 9:124258731-124258753 CCGGTGAACCAGGGGCCAGGAGG + Intronic
1060605927 9:124913864-124913886 CAGGTGAAAGAGGGTGGAAGAGG + Intronic
1060705094 9:125791552-125791574 CAGGAGGAAGAGAGGGCAGGGGG - Intronic
1060912841 9:127364309-127364331 GAGGTGGGAGAGAGGGCAGGAGG + Intronic
1060952523 9:127612862-127612884 GGGGTGAAAGAGGGGGAAGGAGG - Intronic
1061166494 9:128925735-128925757 GGGGTGGAAGAGGAGGCAGGAGG - Intronic
1061216790 9:129226263-129226285 GAGGGGAAAGAGGGAGAAGGAGG + Intergenic
1061258711 9:129467483-129467505 CAGGAGAATGAGGGGGTGGGGGG + Intergenic
1061315919 9:129795720-129795742 CAGGAGAGAGAAGGGGCGGGGGG + Intergenic
1061373518 9:130211244-130211266 CAGGAGAAAGGGGTGGCAGAGGG - Intronic
1061493506 9:130959132-130959154 AGGGTGCAAGAGGGGGAAGGAGG - Intergenic
1061580807 9:131534733-131534755 CATGTGTTTGAGGGGGCAGGGGG - Intergenic
1061751014 9:132777038-132777060 CAGGTGACACGCGGGGCAGGAGG - Intronic
1062170801 9:135133625-135133647 CAGGTGTCAGAGCGGGCTGGAGG + Intergenic
1062238542 9:135524051-135524073 CATGGGGAAGAGGGTGCAGGAGG - Intronic
1062517117 9:136942296-136942318 CAGGTCAAAGATGCGGCAGGGGG + Exonic
1062526252 9:136979130-136979152 CAGGTGGGACAGCGGGCAGGTGG + Exonic
1062565975 9:137164149-137164171 CTGGAGACAGAGGGGCCAGGCGG - Intronic
1203697146 Un_GL000214v1:109268-109290 CAGGTGGAGGAGTGGGCGGGAGG - Intergenic
1185761208 X:2691127-2691149 GAGGAGACAGAGGGGGTAGGCGG - Intergenic
1186273805 X:7918758-7918780 CCGGTGAAAGAAGTGGCTGGTGG - Intronic
1186410532 X:9342096-9342118 GAAGTGAAAGAGGGAGGAGGGGG - Intergenic
1187036125 X:15541863-15541885 CAAGTGAAAGAGGGTGGGGGTGG + Intronic
1187204896 X:17172404-17172426 CAGGAGAAAGAGAGTGAAGGGGG - Intergenic
1188138248 X:26516344-26516366 AAGGTGGAAGGGGAGGCAGGAGG - Intergenic
1188305935 X:28559750-28559772 CAGGTGAGAGAGAGAGAAGGAGG + Intergenic
1189385837 X:40536182-40536204 AAGGTGGAGGTGGGGGCAGGGGG + Intergenic
1190054775 X:47175207-47175229 AAGGGGAGAGAGGGGGCGGGGGG - Intronic
1190314741 X:49143281-49143303 CAGGTGCCTGAGGGAGCAGGGGG + Intergenic
1190508503 X:51153478-51153500 TAGGTGAAAGAGTGGGAGGGTGG - Intergenic
1190592259 X:52016089-52016111 AAGGGGAAAGAGTGGGCAGGAGG - Intergenic
1190737069 X:53262600-53262622 CAGGGGAGAGAGGAGGCAGGGGG + Intronic
1190757451 X:53413224-53413246 CAGGAGAAAGAAGAGGTAGGTGG - Exonic
1191604927 X:63050953-63050975 CAGGAGACAGTGGGAGCAGGAGG + Intergenic
1192562030 X:72133535-72133557 AAGGTGAAGGAGAGGGAAGGAGG - Intergenic
1192587097 X:72327817-72327839 CTGGAGACAGAGGGGGCTGGTGG + Intergenic
1193143401 X:78053523-78053545 CAGGTGAAAGAGAGTGAAAGGGG + Intergenic
1193498842 X:82247407-82247429 CAGGAGAGAGAGAGGGAAGGGGG - Intergenic
1193517774 X:82490929-82490951 CAGGGGAAAGGGGGAGAAGGTGG + Intergenic
1194200473 X:90948776-90948798 CAGGAGAAAGAGAGGGAGGGAGG - Intergenic
1194360462 X:92943168-92943190 CGGGAGAAAGAGGGAGCAGGAGG + Intergenic
1194400583 X:93434678-93434700 CAGGTGCTTGAGGGAGCAGGGGG - Intergenic
1194744222 X:97610782-97610804 CAGGTGAAAGTGAGGGGAAGTGG + Intergenic
1196108158 X:111918073-111918095 CAAGGGAAAGAGGGGGCTTGTGG + Intronic
1197147643 X:123186758-123186780 TAGAGCAAAGAGGGGGCAGGAGG + Intronic
1197633889 X:128892400-128892422 CAGGTGAAACTGGGGGCTTGAGG - Intergenic
1197870629 X:131059353-131059375 CAGGTGGCTGTGGGGGCAGGTGG - Intronic
1198174939 X:134145805-134145827 CTGGAGAAAGAGTGGACAGGTGG - Intergenic
1198818724 X:140622157-140622179 CAGGAGGAAGAGAGGGAAGGGGG + Intergenic
1198860595 X:141065070-141065092 CAGGTGAAAGATGGGAAAGAAGG + Intergenic
1198902096 X:141522319-141522341 CAGGTGAAAGATGGGAAAGAAGG - Intergenic
1199540057 X:148948747-148948769 CAGGTGTAGGAGGGCCCAGGTGG - Intronic
1199735243 X:150679923-150679945 AAGGTGAGAGTGGGGGGAGGGGG + Intergenic
1200050766 X:153430015-153430037 GAGGTGAAGGTGGAGGCAGGAGG - Intergenic
1200133250 X:153862718-153862740 AAGGAGAAGGAGGCGGCAGGGGG - Exonic
1200668665 Y:6058986-6059008 CGGGAGAAAGAGGGAGCAGGAGG + Intergenic
1201153345 Y:11107331-11107353 CAGGTGGAGGAGTGGGCGGGAGG + Intergenic
1201567933 Y:15385920-15385942 CAGGAGAAAGAGGGGGAAGGGGG - Intergenic
1202037336 Y:20648199-20648221 CAGGTGCCTGAGGGAGCAGGGGG - Intergenic
1202161116 Y:21938088-21938110 GAGGTGTGAGAGGGGGCAGGTGG - Intergenic
1202230240 Y:22648285-22648307 GAGGTGTGAGAGGGGGCAGGTGG + Intergenic
1202312916 Y:23547880-23547902 GAGGTGTGAGAGGGGGCAGGTGG - Intergenic
1202557886 Y:26122714-26122736 GAGGTGTGAGAGGGGGCAGGTGG + Intergenic