ID: 1167573392

View in Genome Browser
Species Human (GRCh38)
Location 19:50305034-50305056
Sequence GTTCCGTGGCCCAGTATTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167573392_1167573397 -3 Left 1167573392 19:50305034-50305056 CCTTGAATACTGGGCCACGGAAC No data
Right 1167573397 19:50305054-50305076 AACTCTGTTCTGTGGGCAGTGGG No data
1167573392_1167573409 26 Left 1167573392 19:50305034-50305056 CCTTGAATACTGGGCCACGGAAC No data
Right 1167573409 19:50305083-50305105 TGGGGGCAATGGGGAGCCATGGG No data
1167573392_1167573408 25 Left 1167573392 19:50305034-50305056 CCTTGAATACTGGGCCACGGAAC No data
Right 1167573408 19:50305082-50305104 CTGGGGGCAATGGGGAGCCATGG No data
1167573392_1167573410 30 Left 1167573392 19:50305034-50305056 CCTTGAATACTGGGCCACGGAAC No data
Right 1167573410 19:50305087-50305109 GGCAATGGGGAGCCATGGGAAGG No data
1167573392_1167573405 17 Left 1167573392 19:50305034-50305056 CCTTGAATACTGGGCCACGGAAC No data
Right 1167573405 19:50305074-50305096 GGGGAGCCCTGGGGGCAATGGGG No data
1167573392_1167573398 -2 Left 1167573392 19:50305034-50305056 CCTTGAATACTGGGCCACGGAAC No data
Right 1167573398 19:50305055-50305077 ACTCTGTTCTGTGGGCAGTGGGG No data
1167573392_1167573400 7 Left 1167573392 19:50305034-50305056 CCTTGAATACTGGGCCACGGAAC No data
Right 1167573400 19:50305064-50305086 TGTGGGCAGTGGGGAGCCCTGGG No data
1167573392_1167573403 15 Left 1167573392 19:50305034-50305056 CCTTGAATACTGGGCCACGGAAC No data
Right 1167573403 19:50305072-50305094 GTGGGGAGCCCTGGGGGCAATGG No data
1167573392_1167573401 8 Left 1167573392 19:50305034-50305056 CCTTGAATACTGGGCCACGGAAC No data
Right 1167573401 19:50305065-50305087 GTGGGCAGTGGGGAGCCCTGGGG No data
1167573392_1167573404 16 Left 1167573392 19:50305034-50305056 CCTTGAATACTGGGCCACGGAAC No data
Right 1167573404 19:50305073-50305095 TGGGGAGCCCTGGGGGCAATGGG No data
1167573392_1167573402 9 Left 1167573392 19:50305034-50305056 CCTTGAATACTGGGCCACGGAAC No data
Right 1167573402 19:50305066-50305088 TGGGCAGTGGGGAGCCCTGGGGG No data
1167573392_1167573396 -4 Left 1167573392 19:50305034-50305056 CCTTGAATACTGGGCCACGGAAC No data
Right 1167573396 19:50305053-50305075 GAACTCTGTTCTGTGGGCAGTGG No data
1167573392_1167573394 -10 Left 1167573392 19:50305034-50305056 CCTTGAATACTGGGCCACGGAAC No data
Right 1167573394 19:50305047-50305069 GCCACGGAACTCTGTTCTGTGGG No data
1167573392_1167573399 6 Left 1167573392 19:50305034-50305056 CCTTGAATACTGGGCCACGGAAC No data
Right 1167573399 19:50305063-50305085 CTGTGGGCAGTGGGGAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167573392 Original CRISPR GTTCCGTGGCCCAGTATTCA AGG (reversed) Intronic