ID: 1167573394

View in Genome Browser
Species Human (GRCh38)
Location 19:50305047-50305069
Sequence GCCACGGAACTCTGTTCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167573392_1167573394 -10 Left 1167573392 19:50305034-50305056 CCTTGAATACTGGGCCACGGAAC No data
Right 1167573394 19:50305047-50305069 GCCACGGAACTCTGTTCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167573394 Original CRISPR GCCACGGAACTCTGTTCTGT GGG Intronic