ID: 1167574212

View in Genome Browser
Species Human (GRCh38)
Location 19:50309928-50309950
Sequence GTTGCAGGGGACCCAGGTGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 418
Summary {0: 1, 1: 0, 2: 2, 3: 56, 4: 359}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167574212_1167574231 21 Left 1167574212 19:50309928-50309950 CCCCCACCTGGGTCCCCTGCAAC 0: 1
1: 0
2: 2
3: 56
4: 359
Right 1167574231 19:50309972-50309994 TAAACACAGAGGAGCGGGGCAGG 0: 1
1: 1
2: 1
3: 22
4: 233
1167574212_1167574233 26 Left 1167574212 19:50309928-50309950 CCCCCACCTGGGTCCCCTGCAAC 0: 1
1: 0
2: 2
3: 56
4: 359
Right 1167574233 19:50309977-50309999 ACAGAGGAGCGGGGCAGGCAGGG 0: 1
1: 0
2: 5
3: 57
4: 541
1167574212_1167574234 29 Left 1167574212 19:50309928-50309950 CCCCCACCTGGGTCCCCTGCAAC 0: 1
1: 0
2: 2
3: 56
4: 359
Right 1167574234 19:50309980-50310002 GAGGAGCGGGGCAGGCAGGGAGG 0: 1
1: 0
2: 17
3: 200
4: 1780
1167574212_1167574218 -10 Left 1167574212 19:50309928-50309950 CCCCCACCTGGGTCCCCTGCAAC 0: 1
1: 0
2: 2
3: 56
4: 359
Right 1167574218 19:50309941-50309963 CCCCTGCAACCTCCCATCAAAGG 0: 1
1: 0
2: 0
3: 9
4: 139
1167574212_1167574225 15 Left 1167574212 19:50309928-50309950 CCCCCACCTGGGTCCCCTGCAAC 0: 1
1: 0
2: 2
3: 56
4: 359
Right 1167574225 19:50309966-50309988 GACCCCTAAACACAGAGGAGCGG 0: 1
1: 0
2: 0
3: 11
4: 146
1167574212_1167574226 16 Left 1167574212 19:50309928-50309950 CCCCCACCTGGGTCCCCTGCAAC 0: 1
1: 0
2: 2
3: 56
4: 359
Right 1167574226 19:50309967-50309989 ACCCCTAAACACAGAGGAGCGGG 0: 1
1: 0
2: 2
3: 16
4: 181
1167574212_1167574224 10 Left 1167574212 19:50309928-50309950 CCCCCACCTGGGTCCCCTGCAAC 0: 1
1: 0
2: 2
3: 56
4: 359
Right 1167574224 19:50309961-50309983 AGGATGACCCCTAAACACAGAGG 0: 1
1: 0
2: 2
3: 5
4: 132
1167574212_1167574232 25 Left 1167574212 19:50309928-50309950 CCCCCACCTGGGTCCCCTGCAAC 0: 1
1: 0
2: 2
3: 56
4: 359
Right 1167574232 19:50309976-50309998 CACAGAGGAGCGGGGCAGGCAGG 0: 1
1: 0
2: 3
3: 61
4: 564
1167574212_1167574228 17 Left 1167574212 19:50309928-50309950 CCCCCACCTGGGTCCCCTGCAAC 0: 1
1: 0
2: 2
3: 56
4: 359
Right 1167574228 19:50309968-50309990 CCCCTAAACACAGAGGAGCGGGG 0: 1
1: 0
2: 0
3: 12
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167574212 Original CRISPR GTTGCAGGGGACCCAGGTGG GGG (reversed) Exonic
900266354 1:1759228-1759250 TTTGCAGGTGACCCAGGAAGAGG - Exonic
900394213 1:2446484-2446506 GCTGCAGGGGTCCCAGGAGGCGG + Intronic
900517978 1:3092177-3092199 GTGCCTGGGGCCCCAGGTGGTGG + Intronic
902872998 1:19325464-19325486 GATGCAGGGGGCCCAGGGGTTGG - Intronic
902925575 1:19693800-19693822 CAAGCAGGGGACACAGGTGGAGG - Intronic
905107725 1:35574134-35574156 CTGGCAGGGGACCCATATGGCGG + Exonic
906020919 1:42628555-42628577 TGTGCAAGGGACCCAGGGGGAGG + Intronic
906547301 1:46628863-46628885 CTTGCAGGGGGGCCATGTGGAGG + Intergenic
906810947 1:48826451-48826473 GGTGCAAAGGAACCAGGTGGTGG - Intronic
907245781 1:53108216-53108238 GTGGGAGGCGACCCAGGTGGAGG - Intronic
907391755 1:54162763-54162785 GTTGCAGTGAACCAAGATGGCGG + Intronic
907464746 1:54627682-54627704 GTGGCAGTGGGCCCAGGTTGGGG + Intronic
908414577 1:63900390-63900412 GTTGCAGTGAGCCAAGGTGGTGG + Intronic
910263598 1:85314940-85314962 TTTACAGGGGACCCAGATGAGGG - Intergenic
913049978 1:115109058-115109080 GTTGCTGCAGATCCAGGTGGTGG - Intergenic
914490082 1:148146350-148146372 GTTGGCGGGGGCCCCGGTGGAGG + Intronic
917211148 1:172633169-172633191 GAAGAAGGGGCCCCAGGTGGGGG - Intergenic
917459207 1:175214575-175214597 GTGGCAGGGGACAGGGGTGGGGG + Intergenic
918049062 1:180958789-180958811 GTTGTGAGGGACCCAGGGGGAGG - Intergenic
918996953 1:191773753-191773775 GTTGCAGAAGACCCAGGGGGAGG - Intergenic
919803649 1:201368122-201368144 GGTGCAGGGGCCTCAGGGGGTGG - Intronic
920002870 1:202811431-202811453 GTTGCACGGCGCCCAGGGGGAGG - Intergenic
920100765 1:203515716-203515738 GTGGCAGGGGAGAAAGGTGGAGG + Intergenic
921046651 1:211482535-211482557 GGAGAAGGGGTCCCAGGTGGAGG + Intronic
921547860 1:216493988-216494010 GTTGCAGTGAGCCCAGATGGCGG - Intergenic
922205527 1:223443070-223443092 GTTGGGGGGGACCCAGTGGGAGG + Intergenic
922746002 1:228044399-228044421 GTAACAAGGGACCCAGGAGGGGG - Intronic
922850743 1:228731729-228731751 GTTGTTGGGGACCCAGGGGTGGG + Intergenic
923596225 1:235362395-235362417 GAGGCAGGGGCCACAGGTGGTGG - Intergenic
923620759 1:235577317-235577339 GCTGCATGGGAACCAGCTGGAGG - Intronic
924515433 1:244761565-244761587 GTTGCATGAGTCCCACGTGGTGG + Intergenic
1062883149 10:995013-995035 GGTGCAGGAGACCCAGGAGGTGG + Intronic
1062971989 10:1655060-1655082 GATGCAGGGGACACAGGGCGAGG + Intronic
1063160853 10:3417001-3417023 GGTGCAGGGCACAGAGGTGGGGG + Intergenic
1065695251 10:28373696-28373718 GAGGCAGGGGACCCAGGGAGAGG - Intergenic
1065917692 10:30366504-30366526 GTTGCAGGAGACCCAGGGGAGGG - Intronic
1067038556 10:42936102-42936124 GGTGCAGGGGACCTAGGTAGGGG - Intergenic
1067181025 10:43986131-43986153 GATGCAGGGGACAGAGGAGGAGG - Intergenic
1069973873 10:72197379-72197401 GATGGAGGGAACCCAGGAGGTGG + Intronic
1071088123 10:81887841-81887863 ATGGAAGGGGACCCAGGTGTAGG + Intronic
1072163619 10:92790740-92790762 TTTGCAGGGGACACAGTGGGAGG + Intergenic
1073560887 10:104495940-104495962 GAGGAAGGGGACCCAGGTAGGGG + Intergenic
1073678211 10:105673590-105673612 GATGCAATGGACCCTGGTGGAGG + Intergenic
1075724991 10:124606516-124606538 GCTGCAGGGTCCCCAGGTGCAGG + Intronic
1076080816 10:127578968-127578990 GGTGGAGGGGACCCAGTGGGTGG - Intergenic
1076145608 10:128117434-128117456 GTCTCTGGGGAGCCAGGTGGGGG - Intronic
1076458704 10:130623463-130623485 GCTGCAGGAGACCCAGCTGCTGG + Intergenic
1076688230 10:132207808-132207830 GGTGCAGGGGACACCTGTGGAGG - Exonic
1077170887 11:1165225-1165247 GTTGCAGGGGAACAACATGGCGG - Intronic
1077555767 11:3225401-3225423 TTTGCCTGCGACCCAGGTGGAGG + Intergenic
1083300667 11:61738213-61738235 GAGGCAGGGTGCCCAGGTGGGGG - Intronic
1083663957 11:64264863-64264885 GTGCTAGGGGACCCAGGAGGTGG + Intronic
1083675726 11:64323660-64323682 CCTTCAGGGGTCCCAGGTGGGGG + Intergenic
1083782499 11:64925573-64925595 GTTGCAGGAGGCCCTGGGGGGGG + Exonic
1084321683 11:68376948-68376970 CTTGCTGGGGACCCTGGTGAGGG - Intronic
1084361796 11:68673534-68673556 GTTGTGGGGGACCCAGTGGGAGG - Intergenic
1084603921 11:70161932-70161954 GTGGCAGGGAACCCAGGCAGTGG + Intronic
1084752419 11:71213006-71213028 GGAGCAGGGACCCCAGGTGGAGG + Intronic
1085017794 11:73186553-73186575 GAGACAGGAGACCCAGGTGGAGG - Intergenic
1085134557 11:74074359-74074381 GCTGCAGGGGACCTGGGTGGAGG + Exonic
1085397400 11:76213517-76213539 TTTGCAGGGGCACCAGATGGGGG + Intergenic
1088591106 11:111404033-111404055 GTGGGAGGGGACCCAGTGGGAGG + Intronic
1089686153 11:120148008-120148030 TTTTCAGGGAAGCCAGGTGGAGG + Intronic
1090236084 11:125148467-125148489 GTACCAAGGGACCCAGGTTGAGG + Intergenic
1092173148 12:6385559-6385581 GGTGCAGGGGACACAGGAGGTGG + Intronic
1092257986 12:6937395-6937417 GAGGCAGGGGCCGCAGGTGGTGG - Exonic
1092830893 12:12443470-12443492 GTGGCAGGAAATCCAGGTGGGGG + Intronic
1095492123 12:42745811-42745833 GCTACAGGGGACTCAGGAGGGGG - Intergenic
1095905803 12:47376903-47376925 GGTTCAGGGGACCAAAGTGGAGG - Intergenic
1096431742 12:51550024-51550046 GTTGCAGGGGAACCAGCTCATGG + Intergenic
1098925754 12:76348295-76348317 GTTGCAGGTGGCCGAGGTGCTGG - Exonic
1099043231 12:77682116-77682138 GTGGCAGGGGACCAGGGTGTGGG - Intergenic
1100980532 12:100158951-100158973 GTTGCGGGAGACCCAGGTGAGGG - Intergenic
1101448628 12:104756243-104756265 GGTGCTGGAGACGCAGGTGGTGG + Intronic
1101959854 12:109240687-109240709 GATTCAGGGGACCCATGTGGAGG + Intronic
1103446565 12:120999037-120999059 GATGCAGGGGAGCCTGGAGGAGG - Intronic
1103805307 12:123568007-123568029 GTTGCAGTGAACCAAGATGGTGG + Intergenic
1104782914 12:131433071-131433093 GATGCAGGGGACACATGCGGGGG - Intergenic
1104927636 12:132321937-132321959 GGTGCAGGGGGCCGAGGCGGGGG - Intronic
1106615463 13:31323099-31323121 GTTGCAGGGGACGGAGGAGGGGG + Intronic
1106754736 13:32811247-32811269 CCTGCAGGGGACCCTGGTGATGG - Intergenic
1108014352 13:46058597-46058619 GTTGCAAGGGAGACAGGTGCTGG - Intronic
1108555220 13:51584744-51584766 GATGGAGGGGTCCCAGGAGGTGG + Exonic
1111388463 13:87561164-87561186 GTTGCAGTGAGCCGAGGTGGCGG - Intergenic
1113573072 13:111372583-111372605 GTTCCTGGAGACACAGGTGGGGG - Intergenic
1115554326 14:34532395-34532417 GTTGCAGTGAACCAAGATGGTGG + Intronic
1121108827 14:91298285-91298307 GTTGCCGGGAACCCGGGAGGCGG + Intronic
1122291959 14:100685670-100685692 GGTGGAGGGGACTGAGGTGGAGG - Intergenic
1122599028 14:102912221-102912243 GCTGCAGGGGACCCTGGGAGTGG - Intergenic
1123468541 15:20533680-20533702 GTTGCAGGAGACCCGGTTGAGGG - Intronic
1123468566 15:20533808-20533830 GCTGCAGGTGACCCAGGTAATGG + Intronic
1123473329 15:20570498-20570520 GCTGCAGGTGACCCAGGTAATGG - Intergenic
1123473362 15:20570681-20570703 GTTGCAGGAGGCCCAGGGGAGGG + Intergenic
1123476839 15:20596804-20596826 GGTGGAGAGGCCCCAGGTGGTGG + Intergenic
1123641172 15:22403560-22403582 GGTGGAGAGGCCCCAGGTGGTGG - Intergenic
1123644646 15:22429672-22429694 GTTGCAGGAGGCCCAGGGGAGGG - Intergenic
1123644679 15:22429855-22429877 GCTGCAGGTGACCCAGGTAATGG + Intergenic
1123649548 15:22467254-22467276 GCTGCAGGTGACCCAGGTAATGG - Intronic
1123649573 15:22467382-22467404 GTTGCAGGAGACCCGGTTGAGGG + Intronic
1123665966 15:22609580-22609602 GTTGCAGGAGACCCAGGGGAGGG - Intergenic
1123665996 15:22609763-22609785 GCTGCAGGTGACCCAGGTAATGG + Intergenic
1123728859 15:23128891-23128913 GTTGCAGGAGACCCGGTTGAGGG - Intronic
1123728884 15:23129019-23129041 GCTGCAGGTGACCCAGGTAATGG + Intronic
1123733629 15:23165509-23165531 GCTGCAGGTGACCCAGGTAATGG - Intergenic
1123733662 15:23165692-23165714 GTTGCAGGAGGCCCAGGGGAGGG + Intergenic
1123747023 15:23326356-23326378 GTTGCAGGAGACCCGGTTGAGGG - Intergenic
1123747048 15:23326484-23326506 GCTGCAGGTGACCCAGGTAATGG + Intergenic
1123751757 15:23362884-23362906 GCTGCAGGTGACCCAGGTAATGG - Intronic
1123751791 15:23363067-23363089 GTTGCAGGAGGCCCAGGGGAGGG + Intronic
1124279292 15:28349672-28349694 GTTGCAGGAGACCCGGTTGAGGG - Intergenic
1124279317 15:28349800-28349822 GCTGCAGGTGACCCAGGTAATGG + Intergenic
1124284129 15:28386808-28386830 GCTGCAGGTGACCCAGGTAATGG - Intronic
1124284161 15:28386991-28387013 GTTGCAGGAGACCCAGGGGAGGG + Intronic
1124298536 15:28524623-28524645 GTTGCAGGAGACCCAGGGGAGGG - Intronic
1124298568 15:28524806-28524828 GCTGCAGGTGACCCAGGTAATGG + Intronic
1124303381 15:28561808-28561830 GCTGCAGGTGACCCAGGTAATGG - Intergenic
1124303406 15:28561936-28561958 GTTGCAGGAGACCCGGTTGAGGG + Intergenic
1124319788 15:28703993-28704015 GTTGCAGGAGACCCAGGGGAGGG - Intronic
1124319819 15:28704176-28704198 GCTGCAGGTGACCCAGGTAATGG + Intronic
1124482692 15:30091254-30091276 GCTGCAGGTGACCCAGGTAATGG - Intronic
1124482723 15:30091437-30091459 GTTGCAGGAGACCCAGGGGAGGG + Intronic
1124489149 15:30143346-30143368 GCTGCAGGTGACCCAGGTAATGG - Intronic
1124489176 15:30143508-30143530 GTTGCAGGAGACCCAGGGGAGGG + Intronic
1124520854 15:30405781-30405803 GTTGCAGGAGACCCAGGGGAGGG - Intronic
1124520885 15:30405964-30405986 GCTGCAGGTGACCCAGGTAATGG + Intronic
1124532279 15:30518250-30518272 GCTGCAGGTGACCCCGGTAGTGG - Intergenic
1124532304 15:30518378-30518400 GTTGCAGGAGACCCAGCTGAGGG + Intergenic
1124537776 15:30560255-30560277 GCTGCAGGTGACCCAGGTAATGG - Intronic
1124537806 15:30560438-30560460 GTTGCAGGAGACCCAGGGGAGGG + Intronic
1124544232 15:30612316-30612338 GCTGCAGGTGACCCAGGTAATGG - Intronic
1124544263 15:30612499-30612521 GTTGCAGGAGACCCAGGGGAGGG + Intronic
1124564195 15:30799752-30799774 GCTGCAGGTGACCCAGGTAATGG - Intergenic
1124564226 15:30799935-30799957 GTTGCAGGAGACCCAGGGGAGGG + Intergenic
1124754353 15:32394816-32394838 GTTGCAGGAGACCCAGGGGAGGG - Intronic
1124754380 15:32394978-32395000 GCTGCAGGTGACCCAGGTAATGG + Intronic
1124760848 15:32447148-32447170 GTTGCAGGAGACCCAGGGGAGGG - Intronic
1124760879 15:32447331-32447353 GCTGCAGGTGACCCAGGTAATGG + Intronic
1124766349 15:32489267-32489289 GTTGCAGGAGACCCAGCTGAGGG - Intergenic
1124766374 15:32489395-32489417 GCTGCAGGTGACCCCGGTAGTGG + Intergenic
1124777755 15:32601732-32601754 GCTGCAGGTGACCCAGGTAATGG - Intronic
1124777786 15:32601915-32601937 GTTGCAGGAGACCCAGGGGAGGG + Intronic
1124957046 15:34366717-34366739 GCTGCAGGGGACCCTGGGGTTGG - Intronic
1125727171 15:41874030-41874052 GTGGCAGGAGCTCCAGGTGGAGG - Exonic
1126204540 15:46030285-46030307 GTTTCAGGGGACCCATATGCAGG + Intergenic
1127772881 15:62244775-62244797 GTTGCAGGAGACCCAGGAAAGGG - Intergenic
1129211588 15:74072895-74072917 GTTGCAGGAGACCCAGGGGAGGG - Intronic
1129275492 15:74442708-74442730 GCTGCAGGGGAGCTGGGTGGAGG - Intergenic
1129398816 15:75268189-75268211 GTTGCAGGAGACCCAGGGGAGGG + Intronic
1129402424 15:75292465-75292487 GTTGCAGGAGACCCAGGGGAGGG + Intronic
1129475966 15:75784899-75784921 GTTGCAGGAGACCTAGGGGAGGG + Intergenic
1129672485 15:77614949-77614971 GCTGCAGGAGATCCAGCTGGTGG - Exonic
1129728708 15:77917170-77917192 GTTGCAGGAGACCCAGGGGAGGG - Intergenic
1130484977 15:84393865-84393887 GTTGCAGGAGACCCAGGGGAGGG + Intergenic
1130707415 15:86246346-86246368 GTTGCTGGGGAGCCTGGAGGTGG + Intronic
1131188292 15:90293732-90293754 GTTGCAGGAGACCCAGGGGAGGG + Intronic
1131282563 15:91033247-91033269 GCTGCAGGTGACCCAGGTACTGG + Intergenic
1131291233 15:91108851-91108873 GAAGCAGGGAACCCAGGTGTGGG - Intronic
1131811082 15:96173770-96173792 GTGGCAGGAGAGCCAGATGGAGG - Intergenic
1132331350 15:101014333-101014355 GTTACAGGGGAACCAGCTGGCGG + Exonic
1132432667 15:101773699-101773721 GTTGCAGGAGACCCAGGGGAGGG - Intergenic
1132558899 16:584637-584659 GAGGCAGGGGACACAGGTAGGGG - Intergenic
1132613974 16:831392-831414 GCTGCAGGGATCCCAGGAGGAGG + Intergenic
1132831291 16:1929686-1929708 GGTGCTGGGGACCCAGGCCGAGG - Intergenic
1134096423 16:11421755-11421777 GTTGCTGGGGACCAGGGAGGAGG + Intronic
1136372100 16:29842911-29842933 GATGCATGGGACACAGCTGGCGG + Intronic
1137673239 16:50291443-50291465 GTGGCAGGGGCACCAGGTGGGGG + Intronic
1137995723 16:53209526-53209548 GTTGCAGAATACCCAGGTGAGGG + Exonic
1139477177 16:67208584-67208606 TGTGCAGGGGACCCAGGTGTGGG - Intronic
1141174691 16:81711032-81711054 GTTGCAGTGGTCACATGTGGGGG - Exonic
1142023886 16:87801971-87801993 CCTGCAGGGCACCCAGGTGGGGG - Intergenic
1142110001 16:88326165-88326187 GTGGGAGGGGACCCAGTGGGAGG + Intergenic
1142485550 17:245696-245718 GTGGCAGAGGGACCAGGTGGAGG + Intronic
1142750645 17:1985457-1985479 GAAGCAGTGGACCCAGGAGGGGG - Intronic
1142851443 17:2706701-2706723 GAGGCAGGGCAGCCAGGTGGAGG + Intronic
1143100696 17:4503205-4503227 GTCCCAGGAGCCCCAGGTGGAGG + Intronic
1143378512 17:6481040-6481062 GCAGCAGGGAACCCAGCTGGTGG - Intronic
1143559733 17:7686418-7686440 GTTGCAGGCGACCCGCGGGGTGG + Exonic
1143921487 17:10333931-10333953 GTGGGAGGGGACCCAGAAGGGGG + Intronic
1144762961 17:17717670-17717692 GGTTCAGAGGGCCCAGGTGGGGG - Intronic
1144809312 17:17988575-17988597 GTGGCAGTGGACACAGCTGGGGG + Intronic
1145190685 17:20841002-20841024 GTTGGCGGGGGCCCCGGTGGAGG + Intronic
1147614935 17:41822148-41822170 GGGGCAGGGGCCCCGGGTGGAGG - Intronic
1148124172 17:45228424-45228446 GGGGGAGTGGACCCAGGTGGTGG + Intronic
1148388748 17:47254732-47254754 GGTACTGGGGACACAGGTGGAGG + Intronic
1149911375 17:60570019-60570041 GCTGAAGTGGACCCAGCTGGAGG - Intronic
1151680992 17:75622679-75622701 ATTGCAGTGGTCCCAGGTGAGGG + Intergenic
1151700043 17:75737938-75737960 GAGGCTGGGGACCCTGGTGGGGG - Intronic
1151730322 17:75907205-75907227 GCTGCTGGCCACCCAGGTGGCGG + Intronic
1151984271 17:77531985-77532007 CTTGGAGGGGACCCAGGTGCTGG + Intergenic
1152643248 17:81457826-81457848 GTTGCTGGGTAACCAGGAGGGGG + Intronic
1152643319 17:81458006-81458028 GTTGCTGGGTAACCAGGAGGGGG + Intronic
1152701641 17:81822626-81822648 GTTGCTGGGGACCCCCTTGGGGG + Exonic
1152751792 17:82065702-82065724 GCTGCAGGGGCCCCGGGCGGCGG - Intronic
1152754931 17:82083255-82083277 GTTCCATGGGGCCCAGGTGGAGG - Exonic
1152879626 17:82807770-82807792 GTTGGAGGGGGCCGAGGAGGGGG - Intronic
1152911948 17:83010083-83010105 GCTGCAGGGGACCCTGGTGTGGG + Intronic
1152933489 17:83122511-83122533 ACGGCAGGGGAACCAGGTGGAGG + Intergenic
1154133923 18:11759966-11759988 GGTGCAGGGAACCCAAGTAGAGG - Intronic
1156809194 18:41225766-41225788 CTTGGAAGGGACCCAGGGGGAGG + Intergenic
1157522799 18:48356882-48356904 TGTGAGGGGGACCCAGGTGGTGG - Intronic
1160454692 18:78992430-78992452 GGTGCAGGGGCCGCAGGCGGGGG - Exonic
1160995822 19:1881589-1881611 GTTGGCGGGGGCCCCGGTGGAGG - Exonic
1161022157 19:2015584-2015606 GTTGCCGGGGGCCGGGGTGGCGG + Exonic
1161293854 19:3509633-3509655 GAGGCAGGGGAGACAGGTGGTGG - Intronic
1162153811 19:8663481-8663503 GGTGGAGGGGACGCTGGTGGTGG + Intergenic
1162446948 19:10729272-10729294 GTTGCAGTGATCCGAGGTGGAGG + Intronic
1162744757 19:12792129-12792151 GGTGCAGGGGGCGCAGGGGGCGG + Exonic
1163453327 19:17391771-17391793 GGCACAGGGGACCCAGATGGGGG - Intergenic
1164156577 19:22601100-22601122 GATGCAGGGGACCCAGGGACTGG - Intergenic
1164156607 19:22601262-22601284 GTTGCGGGGGACCCAGGTGTGGG + Intergenic
1165545129 19:36528761-36528783 GCTGCACGCGACCCAGGTGCTGG + Intergenic
1165808377 19:38595966-38595988 CGTGCAGGTGACCCAGGTAGAGG - Exonic
1166269152 19:41703152-41703174 GGTGATGGGGACACAGGTGGAGG - Intronic
1166541833 19:43610847-43610869 GATGCTGGGGACCCAGCAGGAGG - Intronic
1166858658 19:45796572-45796594 TTTGCAGTGAACCCAGGAGGTGG - Intronic
1166863572 19:45823198-45823220 TTTCCAGGGTACCCAGGTGTCGG + Intronic
1167073213 19:47232522-47232544 CTGGCAGGGGACCCACGTCGTGG + Exonic
1167079878 19:47271449-47271471 ACTGCAGGGGATCCCGGTGGGGG - Exonic
1167558554 19:50210832-50210854 AATGCAGGGGAGCCGGGTGGTGG - Intronic
1167574212 19:50309928-50309950 GTTGCAGGGGACCCAGGTGGGGG - Exonic
1167842684 19:52134905-52134927 GTTGCAGCAGACAGAGGTGGGGG + Intronic
1168723891 19:58570337-58570359 GTTACAGAGGACTCAGGTGAGGG - Exonic
1202647073 1_KI270706v1_random:152697-152719 GTAGCTGGGCGCCCAGGTGGTGG + Intergenic
925132650 2:1504430-1504452 TTTGGAGGGGTCCCAGGAGGAGG - Intronic
926261828 2:11271327-11271349 CTTGCAGGGGACCCAGTTATAGG - Intronic
927518938 2:23687817-23687839 CTTGCAGGGGACGCGGCTGGAGG + Intronic
927826939 2:26315755-26315777 GTGACAGGGGACCCTGGAGGAGG + Exonic
927916304 2:26938843-26938865 GGAGCAGGGGAGTCAGGTGGGGG - Intronic
929213313 2:39383419-39383441 GTTGTAGAGGAACCTGGTGGAGG - Intronic
929490042 2:42387994-42388016 GTGGCAGTGGACCCAGGTCCAGG - Intronic
931121457 2:59224898-59224920 GTTGCAGGAGAGCCTGGAGGGGG + Intergenic
932344874 2:70988881-70988903 TTTGTAAGGGGCCCAGGTGGGGG - Intronic
932371017 2:71187967-71187989 ATTGCAGGAGACCCCGGGGGTGG + Exonic
932847431 2:75150380-75150402 GTTGGGAGGGACCCAGGGGGAGG + Intronic
933750866 2:85601590-85601612 GTTGCTGGGGACTCAAGTTGAGG + Intronic
934025714 2:88000154-88000176 GAATCAGGGGACCCAGGAGGTGG + Intergenic
936117407 2:109713082-109713104 GTTTCAAGAGACCCAGGTGGAGG - Intergenic
936452113 2:112641559-112641581 GATGCTTGGGATCCAGGTGGGGG - Intergenic
936764910 2:115835047-115835069 TTTGCAGTGAACCCAGGGGGCGG + Intronic
937267990 2:120629441-120629463 GTGGCAGGTGTCCCAGGTGGGGG + Intergenic
937792707 2:125979226-125979248 CTTGCAAGGGTGCCAGGTGGTGG + Intergenic
938243266 2:129759160-129759182 CTTGCAGGGAACCCAGGGAGAGG - Intergenic
938548170 2:132353426-132353448 GTAGCTGGGCGCCCAGGTGGTGG - Intergenic
938570808 2:132560374-132560396 GTGGAAGGGGACCCAGGTTCAGG - Intronic
939341485 2:140901132-140901154 GTGGAAGGGGCTCCAGGTGGGGG + Intronic
939352484 2:141057507-141057529 GTTGGGGGGGACCCAGTAGGAGG + Intronic
940259074 2:151761707-151761729 GCTGCAGGCCACCCAGTTGGTGG + Intergenic
947625607 2:231616364-231616386 GCAGCAGGGAACCCAGGTGTGGG - Intergenic
947792399 2:232875900-232875922 GGTGCTGGGGCCCCAGGTGACGG - Intronic
947850304 2:233282231-233282253 GATGCAGAAGGCCCAGGTGGGGG + Intronic
948746098 2:240095496-240095518 GGTGCAGGGGTCCCGGGTGCAGG + Intergenic
948746117 2:240095556-240095578 GGTGCAGGGGCCCCTGGTGCAGG + Intergenic
948746158 2:240095690-240095712 GGTTCAGGGGCCCCAGGTGCAGG + Intergenic
948746187 2:240095780-240095802 GGTGCAGGGGCCTCAGGTGCAGG + Intergenic
948931401 2:241134798-241134820 GTGGCAGGGGTGTCAGGTGGGGG - Intronic
1168914114 20:1472346-1472368 ATGGCAGGGGAGCAAGGTGGAGG - Intronic
1170749079 20:19129378-19129400 GTTGCAGGGGTCACAGGGGCTGG + Intergenic
1171301455 20:24064465-24064487 GTTGCAGGGAAACAAGCTGGGGG + Intergenic
1171877041 20:30586198-30586220 GTAGCTGGGCGCCCAGGTGGTGG - Intergenic
1173097363 20:40048419-40048441 GTTGCAGGGGGATCACGTGGTGG + Intergenic
1173603292 20:44311097-44311119 GTTGCGGGGGACGCTGGTGCGGG - Exonic
1174934375 20:54851791-54851813 GTTGTAGGGCACCAAGTTGGTGG - Intergenic
1175258661 20:57661839-57661861 GTGGCAGTGGACACAGGTGTGGG - Intronic
1176113666 20:63421947-63421969 GTGGCAGGCGACCCGGCTGGCGG - Intronic
1176160685 20:63646298-63646320 GATGGAGGGGGACCAGGTGGGGG + Intronic
1177322635 21:19543048-19543070 GAGGAAGGGGCCCCAGGTGGGGG + Intergenic
1178547622 21:33506203-33506225 GTTGCAGTGAACCCAGATCGTGG - Intronic
1179451938 21:41473731-41473753 GTCTCCCGGGACCCAGGTGGGGG + Intronic
1180096010 21:45555510-45555532 GTTGCAGGGAACGGAGGTGCAGG + Intergenic
1180161844 21:46001714-46001736 TTTGCAGGGTACCCAGGTCCCGG + Intronic
1180354831 22:11829772-11829794 GTAGCTGGGCGCCCAGGTGGTGG - Intergenic
1180383420 22:12162559-12162581 GTAGCTGGGCGCCCAGGTGGTGG + Intergenic
1181031426 22:20150316-20150338 GGGGCAGGGGCGCCAGGTGGTGG + Intronic
1181031449 22:20150365-20150387 GGGGCAGGGGCGCCAGGTGGTGG + Intronic
1181121602 22:20671007-20671029 GTTGGCGGGGGCCCCGGTGGAGG - Intergenic
1181283569 22:21736325-21736347 GTTGTAGGGGACGGACGTGGAGG + Intergenic
1181334564 22:22118028-22118050 GTTGGCGGGGGCCCCGGTGGAGG - Intergenic
1182366810 22:29784629-29784651 GCTCCAGGGGACCCACCTGGGGG - Intergenic
1182632172 22:31695019-31695041 GTTGCAGTGAACCCAGATCGCGG + Intronic
1182755285 22:32674089-32674111 GCGGGAGGGGACCCAGATGGAGG + Intronic
1182960033 22:34463169-34463191 GTAGCAGGGGCCACAGGTGAAGG - Intergenic
1183169149 22:36172236-36172258 GAGGAAGGGGCCCCAGGTGGGGG - Intergenic
1183228503 22:36566201-36566223 GTTGCAGGGGAGGAAGGTGGTGG - Intronic
1183296663 22:37033863-37033885 GAGACAGGGGACACAGGTGGAGG - Intergenic
1183748210 22:39704347-39704369 GTTGAAGGGCACAAAGGTGGAGG + Intergenic
1184127630 22:42499667-42499689 GTTGCAGTGGGCCCAGATCGCGG - Intergenic
1184287794 22:43481788-43481810 GATCCAGGGGACACAGGAGGGGG - Intronic
1184583171 22:45430591-45430613 GGTGCAGGGCTCCCAGGTGCAGG - Intronic
1185011259 22:48315970-48315992 TGTGCAGGGTACCCAGGAGGTGG + Intergenic
1185019909 22:48367957-48367979 GCTGTAGGGGAGCCAGGTGGGGG + Intergenic
1185025021 22:48403905-48403927 GAGGAGGGGGACCCAGGTGGGGG - Intergenic
1185100045 22:48835412-48835434 TTTGCAGGAGAGCCATGTGGTGG + Intronic
1185345795 22:50310018-50310040 TTTGCAGAGGGCCCTGGTGGAGG + Exonic
950443956 3:13025475-13025497 GTTGAAGGGGACCCTGCTTGGGG + Intronic
953563310 3:44011638-44011660 ATTGCAGGGGACCACGGGGGTGG - Intergenic
954848301 3:53578635-53578657 GGTGCAATGGAGCCAGGTGGTGG + Intronic
955385805 3:58478850-58478872 ATAGCATGGGACCCAGGAGGAGG - Intergenic
955407826 3:58636461-58636483 GTCGCAGGGGCATCAGGTGGTGG + Intronic
955458236 3:59149343-59149365 ATTGCAGGAGACCCAGAAGGAGG - Intergenic
958449765 3:94259146-94259168 GAGGGAGGGGCCCCAGGTGGGGG - Intergenic
959228018 3:103610752-103610774 GTTGAAGTCCACCCAGGTGGGGG + Intergenic
961079884 3:124017197-124017219 GTTGCTTGGGACTAAGGTGGGGG + Intergenic
961381864 3:126500607-126500629 GTTGCTGGAGAACTAGGTGGTGG + Intronic
961804247 3:129477430-129477452 TTTGCAAGGGATCCAGGTTGGGG + Intronic
962443257 3:135442752-135442774 GTTGCATGAGAACCAGGTAGAGG - Intergenic
963040046 3:141063785-141063807 TTTGCAGGAGACACATGTGGAGG + Intronic
963073617 3:141326405-141326427 GTTGCAGGGGAGCAGGGTGGGGG + Intronic
967229504 3:187324140-187324162 GAGGAAGGGGCCCCAGGTGGGGG + Intergenic
968874778 4:3260614-3260636 CTTGCAGTGAACCCAGGAGGCGG - Intronic
968889755 4:3362176-3362198 GGTGCTGGGGACCGAGGTGGGGG + Intronic
968962573 4:3752965-3752987 GTTCCAGGGGACAGAGGTGGAGG - Intergenic
971968506 4:33593006-33593028 GTTGGAGGGGAAGAAGGTGGAGG - Intergenic
973373328 4:49270860-49270882 GTAGCTGGGTGCCCAGGTGGTGG + Intergenic
983164003 4:164452179-164452201 GTAGAAGGGGTCACAGGTGGTGG - Intergenic
983628621 4:169827874-169827896 GTTGCAGTGAGCCCAGATGGCGG - Intergenic
984232516 4:177115772-177115794 GTTGGAGGACACCCAGCTGGTGG + Intergenic
984568005 4:181354500-181354522 TTTGCAAGGGAACCATGTGGGGG + Intergenic
984839738 4:184057159-184057181 GTTGCAGCAGCCCCAGGGGGTGG + Intergenic
985025075 4:185732560-185732582 TCTGCAGGGGCCCCAGGAGGGGG - Intronic
985362128 4:189186636-189186658 GTAGAATGAGACCCAGGTGGTGG + Intergenic
985826475 5:2195398-2195420 GATGCAGGGGTCCCTTGTGGAGG - Intergenic
985869484 5:2542795-2542817 GCTGCAGGGGACACAGGGTGAGG + Intergenic
985896815 5:2753581-2753603 GTTGCAGGGGGCCCAGCCTGTGG - Intronic
986017189 5:3767596-3767618 GTTGCAGGGAAACCAGGAGATGG + Intergenic
986325508 5:6670289-6670311 GCTGCAGGGAAGCCAGGGGGTGG + Intergenic
987672934 5:21036596-21036618 GTGGGAGGGGACCCAGTGGGAGG + Intergenic
991899696 5:71447370-71447392 CCTGCAGGAGACCCAGGAGGTGG + Intergenic
994907363 5:105858989-105859011 GTTGCAGTGAGCCCAGATGGCGG - Intergenic
995525179 5:113045010-113045032 GTGGAAGGCGGCCCAGGTGGAGG - Intronic
997229914 5:132234742-132234764 GTTGCAGGGGTCCATGGGGGAGG - Intronic
997980639 5:138465680-138465702 GCTGCAGGGGACACAGTTGCGGG - Exonic
998445454 5:142194982-142195004 GTTGCAGTGAGCCGAGGTGGTGG + Intergenic
999206070 5:149848843-149848865 GGGGCAGGGGAGCCAGGAGGAGG + Exonic
1001027163 5:168233947-168233969 GTTGGGAGGGACCCAGGGGGAGG - Intronic
1001156350 5:169275751-169275773 TGTGGAAGGGACCCAGGTGGAGG - Intronic
1001628711 5:173158577-173158599 GTTGCTGGGGAACCAGGAGGCGG + Intronic
1005954759 6:30656164-30656186 TGTGCTGGGGGCCCAGGTGGAGG + Intronic
1006081153 6:31567625-31567647 GTTGCAGGGGAGAGAGGGGGAGG - Intergenic
1008106457 6:47444561-47444583 GTTGCAGTGAGCCCAGATGGCGG + Intergenic
1009460946 6:63912637-63912659 GTTGGAGGGGGGCCTGGTGGAGG + Intronic
1013514793 6:110875568-110875590 GCGGCAGGGGCCCCAGGTGGGGG + Intronic
1013924341 6:115450399-115450421 GTTGCAGTGAACCGAGGTGACGG + Intergenic
1014705549 6:124742174-124742196 GTTACAGGGTACCCAGATAGAGG + Intronic
1015717390 6:136206644-136206666 GTGGTTGGGGACCTAGGTGGTGG + Intergenic
1018434994 6:163751533-163751555 TTTCCACGGGACCCAGGTGTCGG + Intergenic
1018613250 6:165662760-165662782 CTGGCAGGGGACCCTGGGGGCGG + Intronic
1019187847 6:170231333-170231355 GATGCAGAGGACACAGGTGATGG + Intergenic
1020503059 7:8947466-8947488 GCTGTAAGGGAGCCAGGTGGGGG - Intergenic
1021311810 7:19106533-19106555 GCTGCCGGGGACTCAGGGGGAGG - Intronic
1023058245 7:36306743-36306765 GTTGCAGAAGACCCTGGAGGTGG - Intergenic
1024059787 7:45689253-45689275 GTGGGAGGGGACCCTGGTGGGGG + Intronic
1024245602 7:47467592-47467614 GTTGCTGGGGACCCAAGTCTGGG - Intronic
1026066938 7:67082956-67082978 GCTGCTTGGGTCCCAGGTGGAGG + Intronic
1026365048 7:69639857-69639879 CTTGGAGAAGACCCAGGTGGCGG + Intronic
1026709987 7:72729384-72729406 GCTGCTTGGGTCCCAGGTGGAGG - Intronic
1026739419 7:72969486-72969508 CTTGCAGGGGCGCGAGGTGGCGG - Intergenic
1026867920 7:73834749-73834771 GTGGAAGGCGACCCAGGTTGAGG - Exonic
1027104312 7:75395587-75395609 CTTGCAGGGGCGCGAGGTGGCGG + Intronic
1027350410 7:77306113-77306135 GGTGCAGTGGACTCTGGTGGGGG + Intronic
1027416101 7:77976316-77976338 GAGGAAGGGGCCCCAGGTGGGGG - Intergenic
1028226364 7:88256575-88256597 GTTGCCAGGGACAGAGGTGGGGG - Intergenic
1029422286 7:100477830-100477852 GAGGAAGGGGCCCCAGGTGGTGG + Exonic
1031762681 7:125734307-125734329 GTTGGAGGTGAGCCTGGTGGAGG - Intergenic
1031998153 7:128246345-128246367 GGTGCAGAGGACCCAGGTGGAGG + Intronic
1032248687 7:130234328-130234350 GAGGAAGGGGCCCCAGGTGGAGG + Intergenic
1033360742 7:140637478-140637500 GTTGCAGAGGAACCAGGAGTAGG - Intronic
1034277318 7:149829557-149829579 TGTGGAGGGGACACAGGTGGAGG - Intergenic
1034277468 7:149830042-149830064 TGTGGAGGGGACACAGGTGGAGG - Intergenic
1034494190 7:151410233-151410255 GGCTCAGGGGACCCAGGCGGCGG - Intronic
1035021113 7:155801036-155801058 GTTGTCAGGGTCCCAGGTGGAGG - Exonic
1035167431 7:157000036-157000058 GCTGCAGGGGACCCTCGGGGAGG - Intronic
1035637228 8:1156105-1156127 GTTTCAGGGGCCGCAGGTGCAGG + Intergenic
1036453845 8:8891993-8892015 GCTGCAGGGGAACCAGATCGCGG - Exonic
1037753908 8:21699442-21699464 GTTGCAGGGCTCCCTGGTGCTGG + Intronic
1041262304 8:56032300-56032322 GTTGCAGTGAACCGAGATGGTGG + Intergenic
1042810140 8:72816271-72816293 GTTGCAAAGGACCCAGGTTCAGG - Intronic
1043471717 8:80569605-80569627 GTTGCAGAGGACACAGGTAAGGG + Intergenic
1043958697 8:86390619-86390641 GTTGCAGTGAACCGAGATGGCGG + Intronic
1044553228 8:93535181-93535203 GATACAGAGGACCCAGGAGGAGG - Intergenic
1045343211 8:101272543-101272565 GAGGCAGGAGGCCCAGGTGGAGG + Intergenic
1045860588 8:106811507-106811529 GTTGCAGAGGACCCGGGGGCGGG - Intergenic
1046962285 8:120124554-120124576 GGTGCAGGGGAATCAGCTGGAGG - Intronic
1049068290 8:140337080-140337102 GCTGCAGGTGACCCAGGATGTGG + Intronic
1049688063 8:143946892-143946914 GTTGGGGAGGACTCAGGTGGAGG - Intronic
1049732897 8:144187883-144187905 GCTACACGGGAGCCAGGTGGGGG + Intronic
1049743846 8:144254734-144254756 GGTCCACGGCACCCAGGTGGCGG + Intronic
1049936610 9:505556-505578 GTTCCACGGGACCCGGGTGAAGG - Intronic
1052840728 9:33289428-33289450 GTTTCAGGGACCCCAGGAGGTGG + Intergenic
1052872698 9:33523848-33523870 GTAGCTGGGCGCCCAGGTGGTGG - Intergenic
1053266540 9:36718792-36718814 GCCCCAGGAGACCCAGGTGGTGG - Intergenic
1056580425 9:87885425-87885447 GGTGGAGAGGCCCCAGGTGGTGG - Exonic
1056658935 9:88530847-88530869 GTCACTGGGGGCCCAGGTGGTGG - Intergenic
1057020111 9:91690788-91690810 GTTACAGTGGGCCCTGGTGGAGG + Intronic
1057216403 9:93231199-93231221 GGTGCAGGAGACCCAGTGGGAGG + Intronic
1057684752 9:97221977-97221999 GTAGCTGGGCGCCCAGGTGGTGG + Intergenic
1057762965 9:97891247-97891269 GTTAAAGGGGACCCAGAAGGAGG - Intergenic
1058725229 9:107796826-107796848 ATTCCAAGGGACCCAGGTGGAGG - Intergenic
1060835758 9:126754176-126754198 GTTGCAGTGAACCCAGGAGGTGG + Intergenic
1061062833 9:128259160-128259182 GTTGCAGGAAACCCAGGTGAGGG - Exonic
1061405435 9:130391017-130391039 GTTGCAGGCGGCTCAGCTGGAGG - Intronic
1061506045 9:131032344-131032366 GATGCAGGGGACCCGGCAGGAGG - Intronic
1061874320 9:133536318-133536340 GGGGCTGGGGACCCAGGCGGGGG - Intronic
1062393208 9:136342264-136342286 GCTGCTGGGGTCCCAGATGGTGG - Intronic
1062473618 9:136717344-136717366 GCTGCAGGGGCCGGAGGTGGGGG - Intronic
1062502966 9:136859087-136859109 GTGGCTGGAGGCCCAGGTGGAGG + Exonic
1202800532 9_KI270719v1_random:170761-170783 GTAGCTGGGCGCCCAGGTGGTGG - Intergenic
1203552172 Un_KI270743v1:172166-172188 GTAGCTGGGTGCCCAGGTGGTGG - Intergenic
1185503186 X:614343-614365 GCTACAGGGGTCCCAGGTGGGGG - Intergenic
1187427122 X:19188043-19188065 GAGGAAGGGGCCCCAGGTGGAGG - Intergenic
1189396395 X:40626839-40626861 TTTGCAGGTGACCCTGGAGGTGG + Intergenic
1190245094 X:48685690-48685712 GTTGCGGGGGACCTGGGAGGCGG + Intronic
1191858921 X:65650147-65650169 GTTGCAGTGAATCCAGGAGGGGG - Intronic
1193179415 X:78436130-78436152 GTTGCAGAGGAGGAAGGTGGTGG + Intergenic
1193404235 X:81082503-81082525 GTTGCATGGGAGCTAGGTGAGGG + Intergenic
1199280759 X:145996779-145996801 GATGCAGGGGACAATGGTGGGGG - Intergenic
1201153453 Y:11107739-11107761 GTAGCTGGGCACCCAGTTGGTGG - Intergenic
1202373132 Y:24211420-24211442 GTTGCAGGAGACCCAGGGGAGGG - Intergenic
1202497650 Y:25458700-25458722 GTTGCAGGAGACCCAGGGGAGGG + Intergenic