ID: 1167576569

View in Genome Browser
Species Human (GRCh38)
Location 19:50320560-50320582
Sequence GGTCCCAGGGGATCAGTAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 182}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167576560_1167576569 1 Left 1167576560 19:50320536-50320558 CCTGGGCAGGGGAGAGAGAGGGA 0: 1
1: 1
2: 12
3: 157
4: 1186
Right 1167576569 19:50320560-50320582 GGTCCCAGGGGATCAGTAGGGGG 0: 1
1: 0
2: 0
3: 12
4: 182
1167576549_1167576569 15 Left 1167576549 19:50320522-50320544 CCTCTCCTCCCTCCCCTGGGCAG 0: 1
1: 0
2: 14
3: 141
4: 1242
Right 1167576569 19:50320560-50320582 GGTCCCAGGGGATCAGTAGGGGG 0: 1
1: 0
2: 0
3: 12
4: 182
1167576558_1167576569 2 Left 1167576558 19:50320535-50320557 CCCTGGGCAGGGGAGAGAGAGGG 0: 1
1: 0
2: 11
3: 114
4: 950
Right 1167576569 19:50320560-50320582 GGTCCCAGGGGATCAGTAGGGGG 0: 1
1: 0
2: 0
3: 12
4: 182
1167576556_1167576569 3 Left 1167576556 19:50320534-50320556 CCCCTGGGCAGGGGAGAGAGAGG 0: 1
1: 1
2: 8
3: 77
4: 740
Right 1167576569 19:50320560-50320582 GGTCCCAGGGGATCAGTAGGGGG 0: 1
1: 0
2: 0
3: 12
4: 182
1167576540_1167576569 25 Left 1167576540 19:50320512-50320534 CCCCCATCCCCCTCTCCTCCCTC 0: 1
1: 6
2: 64
3: 685
4: 4679
Right 1167576569 19:50320560-50320582 GGTCCCAGGGGATCAGTAGGGGG 0: 1
1: 0
2: 0
3: 12
4: 182
1167576543_1167576569 22 Left 1167576543 19:50320515-50320537 CCATCCCCCTCTCCTCCCTCCCC 0: 1
1: 24
2: 290
3: 2237
4: 13151
Right 1167576569 19:50320560-50320582 GGTCCCAGGGGATCAGTAGGGGG 0: 1
1: 0
2: 0
3: 12
4: 182
1167576547_1167576569 17 Left 1167576547 19:50320520-50320542 CCCCTCTCCTCCCTCCCCTGGGC 0: 1
1: 1
2: 15
3: 228
4: 1769
Right 1167576569 19:50320560-50320582 GGTCCCAGGGGATCAGTAGGGGG 0: 1
1: 0
2: 0
3: 12
4: 182
1167576539_1167576569 28 Left 1167576539 19:50320509-50320531 CCTCCCCCATCCCCCTCTCCTCC 0: 1
1: 3
2: 94
3: 867
4: 5935
Right 1167576569 19:50320560-50320582 GGTCCCAGGGGATCAGTAGGGGG 0: 1
1: 0
2: 0
3: 12
4: 182
1167576555_1167576569 6 Left 1167576555 19:50320531-50320553 CCTCCCCTGGGCAGGGGAGAGAG 0: 1
1: 1
2: 3
3: 54
4: 482
Right 1167576569 19:50320560-50320582 GGTCCCAGGGGATCAGTAGGGGG 0: 1
1: 0
2: 0
3: 12
4: 182
1167576554_1167576569 7 Left 1167576554 19:50320530-50320552 CCCTCCCCTGGGCAGGGGAGAGA 0: 1
1: 1
2: 7
3: 58
4: 491
Right 1167576569 19:50320560-50320582 GGTCCCAGGGGATCAGTAGGGGG 0: 1
1: 0
2: 0
3: 12
4: 182
1167576553_1167576569 10 Left 1167576553 19:50320527-50320549 CCTCCCTCCCCTGGGCAGGGGAG 0: 1
1: 0
2: 4
3: 88
4: 625
Right 1167576569 19:50320560-50320582 GGTCCCAGGGGATCAGTAGGGGG 0: 1
1: 0
2: 0
3: 12
4: 182
1167576541_1167576569 24 Left 1167576541 19:50320513-50320535 CCCCATCCCCCTCTCCTCCCTCC 0: 1
1: 6
2: 90
3: 694
4: 5187
Right 1167576569 19:50320560-50320582 GGTCCCAGGGGATCAGTAGGGGG 0: 1
1: 0
2: 0
3: 12
4: 182
1167576548_1167576569 16 Left 1167576548 19:50320521-50320543 CCCTCTCCTCCCTCCCCTGGGCA 0: 1
1: 1
2: 13
3: 157
4: 1253
Right 1167576569 19:50320560-50320582 GGTCCCAGGGGATCAGTAGGGGG 0: 1
1: 0
2: 0
3: 12
4: 182
1167576542_1167576569 23 Left 1167576542 19:50320514-50320536 CCCATCCCCCTCTCCTCCCTCCC 0: 2
1: 2
2: 65
3: 645
4: 4327
Right 1167576569 19:50320560-50320582 GGTCCCAGGGGATCAGTAGGGGG 0: 1
1: 0
2: 0
3: 12
4: 182
1167576545_1167576569 18 Left 1167576545 19:50320519-50320541 CCCCCTCTCCTCCCTCCCCTGGG 0: 1
1: 0
2: 21
3: 210
4: 1591
Right 1167576569 19:50320560-50320582 GGTCCCAGGGGATCAGTAGGGGG 0: 1
1: 0
2: 0
3: 12
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167576569 Original CRISPR GGTCCCAGGGGATCAGTAGG GGG Intronic
900383382 1:2396826-2396848 GGCCCCAAGGGATCACTATGGGG - Intronic
901389898 1:8938125-8938147 GGTTCCAGGGGATTAGGATGTGG - Intergenic
901781879 1:11599516-11599538 GGAACCAGGGGATCAGGATGGGG + Intergenic
902292451 1:15444423-15444445 GGTCCCAGAGGGTCAGGAGCAGG - Intronic
902609231 1:17587608-17587630 AGTCCAAGTGGATCAGTGGGGGG - Exonic
902693693 1:18126433-18126455 TGTCCCAGGTCATCAGCAGGAGG + Intronic
904912057 1:33942445-33942467 GGTGCCAGGGCATCAGATGGAGG + Intronic
905641174 1:39591050-39591072 GTTCCCAGGGAATAAGGAGGGGG + Intergenic
907856461 1:58308359-58308381 GCTTCCAGGGGATGAGTATGGGG + Intronic
915364349 1:155306008-155306030 AGTCCCAAGGGATTAGCAGGAGG + Intergenic
915527676 1:156486125-156486147 TGTCCCAGGGTACCAGTAGGAGG - Intronic
916168635 1:161984589-161984611 TGTCCCAGGAGCTCAGGAGGAGG + Intronic
919757230 1:201073735-201073757 GGCTCCAGGGGATCTGTAGGAGG + Intronic
919812075 1:201415031-201415053 AGGCTCAGGTGATCAGTAGGTGG - Intronic
920311786 1:205052889-205052911 ACTCCCAGGGGACCAGTAGGAGG + Intronic
920659442 1:207902844-207902866 GGCCCCAGTGGGTCAGTAGCTGG - Intronic
922096773 1:222449697-222449719 GGACCTAGGGGATCAGCAGCTGG - Intergenic
924953733 1:248908223-248908245 GGTCCTAGGGGATTGGGAGGTGG - Intronic
1064223117 10:13458726-13458748 GGTCCCAGGGGACAAGCAGAGGG + Intronic
1064349762 10:14566277-14566299 GGTGACAGGTGAACAGTAGGTGG - Intronic
1066377052 10:34867073-34867095 GCTGCCAGGGGATCAGTGGTAGG + Intergenic
1067696722 10:48541246-48541268 TGTGGCAGGGGATTAGTAGGTGG - Intronic
1067842234 10:49690208-49690230 GGTTGCAAGGTATCAGTAGGTGG + Intronic
1067993870 10:51246824-51246846 GGTCACAGGGTATCAATAAGGGG - Intronic
1070971564 10:80571610-80571632 GGTCTCAGGGGCTAATTAGGTGG - Intronic
1073051198 10:100668411-100668433 CGTCCCAGGGGGGCAGTTGGAGG - Intergenic
1075069058 10:119308779-119308801 GGTTCCAGGGGGCCAGGAGGAGG + Intronic
1076135243 10:128041026-128041048 GGTCCCAGGAGCTTAGGAGGAGG - Intronic
1077239105 11:1501430-1501452 GGTGCCAGGGGATCCTCAGGGGG + Intergenic
1077368243 11:2169902-2169924 GGTCCCCGGGTCTCAGCAGGTGG - Intronic
1079310379 11:19360359-19360381 AGTGACAGGGGATCAGTGGGTGG - Intronic
1079564279 11:21862519-21862541 GTTCCCAAGGGAACAGTAGAAGG - Intergenic
1083152144 11:60798593-60798615 GTTCCCAGGGGAGCTGTAAGGGG + Intronic
1083243940 11:61411048-61411070 GGTCCCGGGAGAGCAGCAGGAGG - Exonic
1086437007 11:86791465-86791487 TGGCCCAGGGGTTCAGCAGGAGG - Intronic
1086728899 11:90223353-90223375 GGTCGCAGGGGATGAGAGGGCGG - Exonic
1087258711 11:95986314-95986336 AATCCCAGGGGCTCAGGAGGAGG - Intronic
1089884211 11:121803677-121803699 GGCCCCAGGAGATCAGCAGTAGG + Intergenic
1090187803 11:124749681-124749703 GGGCCCAGGGCATCAGGAAGAGG - Intronic
1095805882 12:46320996-46321018 AGTCCCAGGGTATCAGAAGTGGG - Intergenic
1096320237 12:50605608-50605630 TTTGCCAGGGGATGAGTAGGGGG - Intronic
1096531683 12:52246586-52246608 GGCCGCAGGGTATGAGTAGGAGG + Intronic
1097224777 12:57470913-57470935 TATCCCAGAGTATCAGTAGGTGG - Exonic
1098014569 12:66090810-66090832 GGACGCAGGGTATCAGTAAGTGG + Intergenic
1098309537 12:69134575-69134597 GGGCCCATGGGATCACTAGAGGG - Intergenic
1099769525 12:87033495-87033517 AGTCCCATGTGATCAGAAGGAGG - Intergenic
1100179458 12:92069655-92069677 GGGCCCAGGGGATTTGTTGGTGG + Intronic
1102035005 12:109766081-109766103 GGCGCCGGGGGCTCAGTAGGGGG - Intronic
1104859199 12:131915998-131916020 GCTCCCAGGGGGTCCGTGGGGGG - Exonic
1105429191 13:20321740-20321762 GGCTCCAGGGGCTCAGAAGGTGG + Intergenic
1105588555 13:21768319-21768341 AGTAACAAGGGATCAGTAGGAGG - Intergenic
1106402277 13:29442054-29442076 GTTCCCAGGGGATGTGGAGGTGG + Intronic
1106432250 13:29692435-29692457 GGTACATGGGGAGCAGTAGGCGG - Intergenic
1106710120 13:32322153-32322175 GCTGCCAGGGGCTCAGGAGGAGG - Intronic
1109528445 13:63606703-63606725 GTTCCCATGGGATCACTAGATGG - Intergenic
1111412401 13:87894308-87894330 GGTCCCAGCGAATCAGAAAGAGG - Intergenic
1114084467 14:19229363-19229385 AGTCCCAGGGCAGCAGAAGGAGG + Intergenic
1114340225 14:21735650-21735672 GATCCCAGGGAATCAGGAGATGG + Intergenic
1118748669 14:68791534-68791556 GGTCCCTTAGGATCAGCAGGGGG + Intronic
1121544298 14:94752132-94752154 GATCCCAGAGCATCAGGAGGTGG - Intergenic
1122939042 14:104973075-104973097 GGTGCCAGGGGTCCGGTAGGTGG - Intronic
1126790748 15:52218946-52218968 TGTCCCATGGGAACAGTAAGTGG - Intronic
1128061232 15:64737083-64737105 CGTCCCTGGGGATCAGTACAAGG - Intergenic
1128711639 15:69876555-69876577 GCTCTCAGGGGCTCAGGAGGAGG - Intergenic
1129256122 15:74335110-74335132 GCTCCCAGGGGTTCAGGTGGTGG + Intronic
1131509796 15:93043742-93043764 GGTCCCTGGGGAACAGCAGAGGG + Intronic
1132730925 16:1361710-1361732 GGACCCTGGGGATCAGTGTGAGG + Intronic
1134098506 16:11435546-11435568 GGTCTCAGGGGAACAGAAGAGGG + Intronic
1136409850 16:30069900-30069922 GGGCCCAGGGCTTCAGCAGGGGG - Exonic
1137273411 16:46917975-46917997 GGGCCCTGGGGATCAGTCGGAGG - Intronic
1138489281 16:57366813-57366835 GGTCCCAGGGGCCCTGGAGGTGG + Intergenic
1139549281 16:67664556-67664578 TGTCTCAGGGACTCAGTAGGAGG - Intronic
1141334571 16:83142482-83142504 AGACCCAAGGGATGAGTAGGAGG - Intronic
1142217808 16:88838416-88838438 GGTCCCAGGAGAGCGGTTGGTGG - Intronic
1142673682 17:1500064-1500086 GGTCCCAGCTGGTCAGGAGGCGG - Intronic
1142703833 17:1681743-1681765 AGTCCTGGGAGATCAGTAGGTGG - Intronic
1143272928 17:5689040-5689062 GGTCCCATGGGGTCAGTCAGAGG + Intergenic
1146000430 17:29127443-29127465 GGTCCCAGGGGATGAGTGGCTGG + Intronic
1146280463 17:31541174-31541196 GGTCCCTTGGGAGCAGCAGGCGG + Intergenic
1146905955 17:36618042-36618064 GGTCCCAGTGGAGCAGCAGCTGG + Intergenic
1151701232 17:75743641-75743663 GGTCACAGGAGAGCAGGAGGTGG + Intronic
1153653283 18:7260424-7260446 GGTCTCTGGGGATCACAAGGTGG - Intergenic
1156502491 18:37568299-37568321 TGTCCTAGGGGACCAGAAGGAGG - Intergenic
1157126996 18:44965876-44965898 GGTCCCAGGGACACTGTAGGTGG - Intronic
1157684568 18:49631889-49631911 GGTCCCAAGAGATCTGGAGGTGG - Intergenic
1159287983 18:66376969-66376991 TGTGCCAGTGGATCACTAGGGGG - Intergenic
1160354891 18:78218825-78218847 GGTCCCACGAGATCAGCCGGAGG + Intergenic
1160574574 18:79845247-79845269 GTTTCCAGGGGTTCAGGAGGAGG + Intergenic
1160767358 19:814378-814400 GTTCCCAGGGGATCTGAGGGGGG - Intronic
1162728123 19:12701914-12701936 GGTCACTGGGGATCAGTGAGTGG + Intronic
1164415668 19:28044940-28044962 GATCCCAGGTGCTCAGAAGGAGG + Intergenic
1167100012 19:47398995-47399017 GGACCCAGGGGATAGGCAGGCGG - Intergenic
1167576569 19:50320560-50320582 GGTCCCAGGGGATCAGTAGGGGG + Intronic
1167676914 19:50892951-50892973 GGTACCAGGGCCTCAGGAGGTGG + Intergenic
925901405 2:8511782-8511804 GGGCCCAGGGGAAAAGGAGGTGG - Intergenic
926799367 2:16646067-16646089 GGTCCCAGGAGAAAAGGAGGTGG + Intronic
932337104 2:70937753-70937775 GGTCCCTGGGTATCAGGAGGTGG - Intronic
932489807 2:72113554-72113576 GGTCACAGGGGGTCAGTTTGGGG - Intergenic
934094030 2:88582048-88582070 GTTGCCAGTGGATCACTAGGTGG - Intronic
934604484 2:95683406-95683428 GGTCCCAGGGGATCAGGGTGTGG - Intergenic
934654225 2:96108914-96108936 GGGGTCAGGGGATCAGCAGGAGG + Intergenic
936519087 2:113200547-113200569 GGTCCCAGCTGGTCAGTGGGAGG - Intronic
936537886 2:113325637-113325659 GGTCCCAGGGGATCAGGGTGTGG - Intergenic
936773559 2:115944544-115944566 GGTCTCAGAGGATCAGTGAGTGG - Intergenic
936950945 2:117976849-117976871 GGTGGCAGGGGAACAGCAGGGGG + Intronic
937078281 2:119123098-119123120 GGTGCCAGGGGATCTGCAAGAGG + Intergenic
938696173 2:133837406-133837428 GTCCCCAGGGCATCAGGAGGAGG + Intergenic
938964680 2:136377767-136377789 TGTCCCATGGGAGCAGTAGGAGG - Intergenic
940161822 2:150721634-150721656 GGTCCCAGCGACTCAGGAGGCGG + Intergenic
942289220 2:174453054-174453076 GGTCCTAGGGGATGAGAATGGGG + Intronic
943712152 2:191109138-191109160 GGTCGCAGGGCATCACTAGGAGG + Intronic
946302348 2:218831708-218831730 GGTCCCAGGGGAGCCGGAGCCGG - Intronic
947967562 2:234294259-234294281 TGTGCCAGGGGATGAGTTGGGGG + Intergenic
948025663 2:234774147-234774169 GGTCCCAGCAGAGCAGCAGGTGG - Intergenic
1169701416 20:8451464-8451486 GGTCCCAGCTACTCAGTAGGCGG - Intronic
1172010427 20:31843083-31843105 GGCCCCAGGGGACCTGTCGGGGG + Intergenic
1172233785 20:33355655-33355677 GGAACTAGGGGATTAGTAGGCGG + Intergenic
1172301021 20:33850512-33850534 GGTCCTAGAGGATCCATAGGTGG + Intronic
1172319133 20:33982662-33982684 GGTCCCTGTGGGTCAGTAAGTGG + Intergenic
1172786034 20:37469509-37469531 GGTCCCAGGAGAACAGGAGAAGG - Intergenic
1172786046 20:37469563-37469585 GGTCCTAGGGGAGCAGGAGAAGG - Intergenic
1174526592 20:51176702-51176724 GGTGCAAGAAGATCAGTAGGAGG + Intergenic
1175926085 20:62472292-62472314 GGTCCCAGTGGAGCAGGTGGTGG - Intronic
1178776472 21:35556056-35556078 TGTCCCAGGAGCTCTGTAGGTGG - Intronic
1179946083 21:44677626-44677648 GGTCCCTGGGGTTCAGCATGAGG - Intronic
1180293505 22:10863839-10863861 AGTCCCAGGGCAGCAGAAGGAGG - Intergenic
1180496310 22:15893254-15893276 AGTCCCAGGGCAGCAGAAGGAGG - Intergenic
1180850941 22:19019841-19019863 GTTCCCAGGAGAAGAGTAGGAGG - Intergenic
1181936787 22:26444469-26444491 GGTCCCAGGAGACCAGTTTGAGG + Exonic
1182555495 22:31126512-31126534 GGCCCGAGGGGCTCAGGAGGGGG - Intronic
1184247174 22:43241640-43241662 GGTCCCAGGGGGAGAGGAGGGGG - Intronic
1184744214 22:46446597-46446619 GGTCGCAGGGGGTCGGTGGGGGG + Intronic
1185169235 22:49282773-49282795 GGTCACACGGGATCAGCCGGCGG - Intergenic
949355870 3:3179793-3179815 GGCCCCAGGGGAGCAGACGGCGG + Intergenic
949891235 3:8734835-8734857 GGTCCCAGCTAATCAGGAGGTGG - Intronic
950726071 3:14917834-14917856 GGTGCCAGGGGCTGAGAAGGAGG - Intronic
954610407 3:51941989-51942011 GGACCCAATGGAGCAGTAGGAGG - Intergenic
954655969 3:52194563-52194585 GGCCCCAGGGCTTCAGGAGGGGG - Intergenic
954689089 3:52386403-52386425 GGTCCCAGGGGATGTGCAGAGGG - Intronic
954833014 3:53439222-53439244 GATCCGAAGGGAGCAGTAGGAGG - Intergenic
955529429 3:59857935-59857957 GGTGTCAGGGGACCAGCAGGTGG - Intronic
956002774 3:64747099-64747121 AGTCCCATGGGAACAGTATGGGG + Intergenic
961539871 3:127591980-127592002 AGTCCCAGAGGATCACAAGGTGG - Intronic
962315586 3:134357547-134357569 GGTCCCAGGAGCTCAGGAGGAGG - Exonic
962927090 3:140004933-140004955 GGTCCCAGTGGACCAATAGAAGG - Intronic
965968414 3:174524664-174524686 GGTCCCAGCTGCCCAGTAGGAGG - Intronic
966124235 3:176556788-176556810 GCTCCCAAGGGAACAGGAGGTGG - Intergenic
966863216 3:184241969-184241991 GGTCCCAGTGGCGCAGTAGCAGG - Exonic
967279772 3:187810767-187810789 GGTAGCAGGGGATCTGGAGGAGG - Intergenic
968974962 4:3817274-3817296 GGTTCCAGGGGCTCAGCAGATGG + Intergenic
970840019 4:20457386-20457408 CGCCCCAGAGGATGAGTAGGAGG + Intronic
975735165 4:77373555-77373577 AGTCCCAGGGCAGCAGGAGGAGG + Intronic
975736901 4:77389707-77389729 GGTTCCAGGGCAGCAGGAGGAGG + Intronic
978435886 4:108684019-108684041 CTTCCCAGGAGATCAGTAGCTGG + Intergenic
985678524 5:1244387-1244409 GGTCCCAGAGGAGCACTCGGCGG - Intronic
987100947 5:14590670-14590692 GGTCCCAGGGGATGGGTGAGAGG + Intronic
990717064 5:58649167-58649189 GCTCCCAGTGGACCAGCAGGTGG - Intronic
990856573 5:60274002-60274024 GGTCTCAGGGCATCAGGAGATGG + Intronic
991306760 5:65185093-65185115 GGTCCCAGCGGAAGAGCAGGCGG - Intronic
999301376 5:150492718-150492740 GGTCCCAGGGTGGCATTAGGTGG + Intronic
1001143035 5:169161219-169161241 GGTCCCAGGGGATTTGTGGTCGG + Intronic
1001514518 5:172346059-172346081 GGTGACAGGGGAGAAGTAGGAGG + Intronic
1003533945 6:6959713-6959735 GGTTACAGGTGTTCAGTAGGTGG + Intergenic
1005449840 6:25961920-25961942 GGTCCAAGGGAACCAGTAAGGGG - Intergenic
1006054954 6:31377460-31377482 AGTCCTAGGGGATCAGAAGTAGG - Intergenic
1017683360 6:156886486-156886508 TGTCCCAGGAGAGCAGTACGGGG - Intronic
1019523850 7:1472069-1472091 GGGCCCAGGGGAGCTGGAGGTGG - Intronic
1019783267 7:2957441-2957463 GGTCCCAGCTACTCAGTAGGTGG - Intronic
1022493301 7:30837219-30837241 GGTCACAGGGGACCAGGAGCAGG + Intronic
1025084395 7:56010884-56010906 GGTCCCAGGGCTTCAGGAAGTGG + Intergenic
1030565551 7:111150482-111150504 TGTCCCAGGGACTCAGTTGGAGG - Intronic
1036813989 8:11887734-11887756 GGACGCAGGGGGTCATTAGGAGG - Intergenic
1038495519 8:27999408-27999430 AGTGCCAGAGGCTCAGTAGGTGG - Intergenic
1039141154 8:34390058-34390080 GTTGCCAGGGGATCAGAGGGAGG + Intergenic
1039380941 8:37084735-37084757 GGTCCCAGTGGCTCAGTGGTTGG + Intergenic
1039560699 8:38510371-38510393 GGTCCCAGGGGCTCAGGGTGTGG + Intergenic
1039890318 8:41681567-41681589 AGTCCCAGGGCCTCAGAAGGAGG + Intronic
1040289775 8:46118325-46118347 GGCCCCAGGGACTCAGGAGGAGG - Intergenic
1042796003 8:72664132-72664154 GATCCCAGGAGATCAGAATGAGG + Intronic
1047035306 8:120931916-120931938 GGTCCAAGGAGATCATTAGTAGG + Intergenic
1048020906 8:130538147-130538169 GTTGCCAGGGGTTCAGCAGGAGG - Intergenic
1048987303 8:139741411-139741433 GGTCCCAGGTGAACAGCAGTAGG + Intronic
1053377637 9:37621474-37621496 GGCCCCAGGGGATAAGGAAGGGG + Intronic
1060976968 9:127770595-127770617 GGTCCCGGGGCACCAGAAGGGGG + Intronic
1061144282 9:128787951-128787973 GGTCCAAGGAGTTCAGTTGGTGG + Intronic
1061974941 9:134063318-134063340 GGTACCAGGGGCTGGGTAGGAGG - Intronic
1062004486 9:134232327-134232349 GGGCCCGGGGGAGCAGGAGGGGG - Intergenic
1187311539 X:18149067-18149089 GCTCCCAGGGGTTGAGGAGGAGG - Intergenic
1187487210 X:19715913-19715935 GGTGCCAGGGGCTCAGGGGGTGG + Intronic
1189967565 X:46390352-46390374 GGTCCATGGGGATCAGTGGTTGG - Intergenic
1192798724 X:74446127-74446149 GGTCCCAGGGGAAGAGGAGGGGG - Intronic
1196456318 X:115893778-115893800 TGTCACAGGGGAGCAGTAGATGG + Intergenic
1199331491 X:146565833-146565855 GGCCCCAGGGGAGCACTGGGAGG - Intergenic
1199615503 X:149652180-149652202 GGCCTCAGGGGAGCAGAAGGTGG - Intergenic
1200797256 Y:7352336-7352358 GGTCTCTGGGGATCAGTAAATGG + Intergenic